The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014657	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 chromosome, complete genome	4704371	1153854	1159658	4704371		Enterobacteria_phage(100.0%)	8	NA	NA
WP_021000674.1|1153854_1156188_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.5	0.0e+00
WP_000743150.1|1156202_1156523_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001604623.1|1156519_1156747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023243884.1|1156743_1157295_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	8.6e-36
WP_001604627.1|1157291_1157558_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	1.7e-29
WP_039500098.1|1158095_1158833_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.6	3.2e-78
WP_000984211.1|1158829_1159075_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	6.3e-31
WP_000210078.1|1159091_1159658_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
>prophage 2
NZ_CP014657	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 chromosome, complete genome	4704371	1163188	1228039	4704371	portal,lysis,plate,head,integrase,terminase,tRNA,tail,capsid	Salmonella_phage(91.3%)	65	1163025:1163071	1198982:1199028
1163025:1163071	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001536726.1|1163188_1164214_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_063177042.1|1164217_1164850_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	99.0	1.1e-114
WP_000102102.1|1164969_1165212_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	100.0	1.1e-38
WP_000460858.1|1165244_1165754_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	100.0	1.6e-89
WP_000957775.1|1165761_1165995_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	59.1	3.6e-12
WP_000166366.1|1165942_1166401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963195.1|1166620_1166962_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.0	4.2e-49
WP_001244234.1|1167029_1167263_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	84.4	2.0e-26
WP_000785509.1|1167262_1167490_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	1.3e-35
WP_000104122.1|1167486_1168344_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	80.7	9.3e-130
WP_063177043.1|1168334_1170746_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	95.8	0.0e+00
WP_001154444.1|1170901_1171090_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_001217581.1|1171101_1171335_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	94.8	4.4e-34
WP_000094765.1|1171621_1171840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023972208.1|1171839_1172682_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.1	1.7e-59
WP_063177045.1|1172912_1174577_+	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.9	4.5e-11
WP_063177046.1|1174623_1175658_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	93.3	1.2e-187
WP_063177047.1|1175657_1177424_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
WP_063177048.1|1177566_1178400_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.5	5.5e-127
WP_023230741.1|1178416_1179481_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	98.0	6.6e-194
WP_000059172.1|1179484_1180135_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	100.0	2.2e-115
WP_001528530.1|1180228_1180693_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	1.9e-84
WP_000868175.1|1180692_1180896_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_063177049.1|1180899_1181115_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	1.2e-25
WP_023230739.1|1181095_1181605_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	4.0e-88
WP_023230738.1|1181609_1181987_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	98.4	6.9e-61
WP_162492817.1|1181983_1182412_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	98.6	1.1e-67
WP_077950564.1|1182507_1182939_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	93.7	3.8e-71
WP_063177052.1|1182931_1183396_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	5.5e-60
WP_063177053.1|1183483_1184995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063177054.1|1185121_1185700_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.4	1.5e-91
WP_023230735.1|1185696_1186056_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	5.5e-52
WP_063177055.1|1186042_1186951_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	92.4	3.4e-146
WP_063177056.1|1186943_1187549_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	96.0	9.5e-113
WP_064507161.1|1188349_1189201_+	hypothetical protein	NA	A0A1S6KZZ8	Salmonella_phage	98.9	6.3e-163
WP_063177058.1|1189203_1189743_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	99.4	3.8e-97
WP_077950565.1|1189746_1190364_-|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	99.0	2.8e-112
WP_071891164.1|1190333_1191383_-|tail	phage tail protein	tail	A0A1S6KZZ0	Salmonella_phage	98.5	8.9e-191
WP_001165558.1|1191352_1191910_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	98.4	5.5e-99
WP_000046109.1|1192012_1193185_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001207652.1|1193194_1193710_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_001280962.1|1193764_1194067_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1194081_1194201_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_063177061.1|1194193_1197001_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.1	0.0e+00
WP_000980409.1|1196997_1197483_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_063177062.1|1197479_1198580_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.4	1.7e-192
WP_000980498.1|1198648_1198867_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_072101134.1|1199417_1200581_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1198982:1199028	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023244174.1|1200588_1202769_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_023243957.1|1202765_1204175_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_038389487.1|1204239_1215714_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1216333_1216816_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1216965_1217442_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1217431_1217722_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1217887_1218226_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001525072.1|1218374_1220036_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1220121_1221000_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1221122_1221713_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023243603.1|1221747_1222353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1222473_1223760_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1223779_1224571_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1224736_1226098_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1226411_1226660_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1226678_1227227_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1227271_1228039_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP014657	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 chromosome, complete genome	4704371	1718490	1727661	4704371	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1718490_1719438_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1719421_1720153_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1720133_1720241_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1720300_1721032_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023243038.1|1721254_1722940_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1722936_1723656_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1723702_1724170_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1724226_1724757_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1724928_1725387_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1725627_1727661_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP014657	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 chromosome, complete genome	4704371	1795753	1802050	4704371		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023244537.1|1795753_1797157_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1797334_1798228_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1798604_1799690_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023662.1|1799689_1800589_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_023243995.1|1800636_1801515_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	2.3e-107
WP_001100808.1|1801519_1802050_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	4.8e-52
>prophage 5
NZ_CP014657	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 chromosome, complete genome	4704371	1912340	1919589	4704371		Morganella_phage(33.33%)	8	NA	NA
WP_023243860.1|1912340_1912760_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457663.1|1912762_1914031_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000208509.1|1914485_1914698_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1914708_1914897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|1915156_1916350_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_000107435.1|1916998_1917310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023243859.1|1917389_1918085_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_023243858.1|1918158_1919589_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP014657	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 chromosome, complete genome	4704371	2022843	2030606	4704371	integrase	Enterobacteria_phage(28.57%)	12	2025053:2025075	2037176:2037198
WP_000856224.1|2022843_2023074_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|2023211_2023586_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_072101102.1|2023586_2024462_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2024478_2024832_+	YebY family protein	NA	NA	NA	NA	NA
2025053:2025075	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_020438172.1|2025203_2026283_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.0	6.3e-99
WP_023244250.1|2026279_2027386_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	Q9QF34	Lambdoid_phage	65.0	1.4e-53
WP_001013467.1|2027416_2027647_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|2027700_2028234_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|2028490_2028658_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2028722_2028911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|2028965_2029457_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_023244117.1|2030009_2030606_+	hypothetical protein	NA	Q1MVL8	Enterobacteria_phage	43.1	7.8e-35
2037176:2037198	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
>prophage 7
NZ_CP014657	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 chromosome, complete genome	4704371	2818067	2912185	4704371	portal,head,terminase,tRNA,protease,tail,holin,capsid	Salmonella_phage(58.06%)	102	NA	NA
WP_000938188.1|2818067_2818748_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	72.4	1.6e-84
WP_000374046.1|2819403_2820063_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2820149_2820479_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_023243627.1|2820475_2820757_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548091.1|2820805_2821585_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2821610_2822159_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2822373_2823585_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2823642_2823960_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2824004_2824418_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|2824591_2825254_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2825348_2825807_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_024155604.1|2825842_2827897_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_023243628.1|2828020_2828467_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950869.1|2828485_2830639_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2830625_2831231_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2831447_2831957_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|2832313_2833366_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2833437_2833890_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|2834075_2835836_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2835904_2836423_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2836522_2836690_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2836945_2837509_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2837505_2839146_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2839150_2840404_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2840418_2842326_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086481.1|2842338_2844447_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224073.1|2844545_2845655_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|2845651_2846194_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2846359_2847370_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_023242979.1|2847577_2850190_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497440.1|2850616_2850823_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_000776343.1|2851515_2852718_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	100.0	6.3e-209
WP_001805559.1|2852932_2853091_+	DinI-like family protein	NA	S4TND2	Salmonella_phage	100.0	5.8e-22
WP_023137449.1|2853159_2854290_-|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	100.0	4.4e-204
WP_001113925.1|2854300_2855260_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	100.0	9.6e-184
WP_001110473.1|2855268_2857989_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	100.0	0.0e+00
WP_000682267.1|2857988_2858387_-	hypothetical protein	NA	S4TR39	Salmonella_phage	100.0	8.8e-75
WP_000967282.1|2858393_2858978_-	hypothetical protein	NA	S4TND4	Salmonella_phage	100.0	1.5e-107
WP_010835817.1|2858977_2859571_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	99.5	1.9e-110
WP_000064923.1|2859736_2859949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000171561.1|2859987_2860299_-	hypothetical protein	NA	S4TNM6	Salmonella_phage	80.2	1.7e-36
WP_023231014.1|2860344_2863659_-|tail	phage tail tape measure protein	tail	S4TTF9	Salmonella_phage	100.0	0.0e+00
WP_000404385.1|2863705_2864041_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	100.0	7.0e-57
WP_024134502.1|2864097_2864376_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	100.0	1.9e-44
WP_001129939.1|2864399_2864771_-|tail	phage tail protein	tail	S4TSQ0	Salmonella_phage	94.2	3.0e-61
WP_046722419.1|2864798_2865503_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	73.9	2.2e-92
WP_001648721.1|2865559_2865907_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	96.5	5.5e-57
WP_010835820.1|2865903_2866353_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	96.6	2.5e-73
WP_020898872.1|2866349_2866688_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	6.6e-39
WP_001648719.1|2866697_2867024_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	85.2	5.2e-49
WP_052940370.1|2867023_2867221_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	2.9e-10
WP_001648716.1|2867264_2868482_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	89.6	5.8e-202
WP_000039020.1|2868491_2869340_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	87.9	1.7e-131
WP_063177081.1|2869353_2870658_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	85.9	6.2e-218
WP_077909829.1|2870657_2872400_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	5.3e-140
WP_023171050.1|2872353_2872818_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.7e-48
WP_023137451.1|2872950_2873295_-	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	3.9e-47
WP_000495546.1|2873362_2873740_-	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	66.1	1.2e-41
WP_001050802.1|2873782_2874322_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	46.6	3.7e-07
WP_001075994.1|2874318_2874933_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	94.6	2.2e-109
WP_000226307.1|2874932_2875214_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294874.1|2875200_2875590_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.0	1.8e-40
WP_000658039.1|2875679_2875868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001648707.1|2876372_2877170_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	99.6	2.0e-150
WP_001648706.1|2877159_2877306_-	YlcG family protein	NA	H6WRZ0	Salmonella_phage	100.0	1.5e-19
WP_023136402.1|2877302_2877944_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	99.5	1.3e-115
WP_023136401.1|2877946_2878153_-	hypothetical protein	NA	H6WRY8	Salmonella_phage	100.0	7.8e-35
WP_023136400.1|2878152_2878752_-	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	97.5	2.0e-107
WP_001217668.1|2879157_2879391_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	4.7e-36
WP_000062345.1|2879720_2880866_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	32.7	2.7e-44
WP_023137432.1|2880862_2881477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001648689.1|2881957_2882242_-	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	46.5	2.3e-16
WP_000208078.1|2882238_2882664_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	84.6	3.0e-65
WP_023137431.1|2882674_2883430_-	hypothetical protein	NA	H6WRY1	Salmonella_phage	99.2	1.2e-149
WP_023136498.1|2883566_2884259_-	phage replication protein P	NA	G8C7U6	Escherichia_phage	58.9	5.6e-77
WP_020843826.1|2884255_2885161_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.3	4.5e-175
WP_001648682.1|2885252_2885576_-	bacteriophage CII	NA	H6WRX6	Salmonella_phage	59.1	7.2e-27
WP_001555460.1|2885610_2885838_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.9	1.7e-14
WP_000981510.1|2885943_2886378_+	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	38.2	2.5e-14
WP_000186242.1|2886562_2886763_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000995352.1|2886853_2887150_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_001648679.1|2887155_2887941_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.2	1.4e-148
WP_001648676.1|2887937_2888618_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.3	1.3e-129
WP_001648675.1|2888614_2889484_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	95.2	1.3e-158
WP_023137216.1|2889489_2889729_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	2.8e-36
WP_000065276.1|2889769_2890018_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2890062_2891355_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000191404.1|2891549_2892752_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023243872.1|2892832_2894266_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_023243871.1|2894511_2895726_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2896043_2896505_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023243869.1|2896705_2898106_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.6	1.3e-80
WP_153274566.1|2898270_2898429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000977709.1|2898712_2899804_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000462653.1|2899988_2901179_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|2901240_2901888_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2901915_2902464_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925888.1|2902723_2904571_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572733.1|2904915_2909382_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|2909381_2910086_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_063177082.1|2910066_2911389_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154028.1|2911381_2912185_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP014657	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 chromosome, complete genome	4704371	2983741	2992823	4704371	protease,integrase	Ralstonia_phage(16.67%)	8	2982134:2982146	3001320:3001332
2982134:2982146	attL	CTGTTTTACCTTA	NA	NA	NA	NA
WP_024155556.1|2983741_2984983_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	40.7	2.5e-75
WP_023243338.1|2985510_2985888_+|integrase	phage integrase	integrase	NA	NA	NA	NA
WP_001117984.1|2986049_2986247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|2986459_2988736_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2988766_2989087_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2989410_2989632_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|2989761_2991708_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_023202044.1|2991704_2992823_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
3001320:3001332	attR	TAAGGTAAAACAG	NA	NA	NA	NA
>prophage 9
NZ_CP014657	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 chromosome, complete genome	4704371	4074829	4083777	4704371	integrase	Enterobacteria_phage(83.33%)	11	4072053:4072069	4083947:4083963
4072053:4072069	attL	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
WP_000783715.1|4074829_4077163_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
WP_000743145.1|4077177_4077498_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216597.1|4077494_4077722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000979749.1|4077718_4078270_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_000556587.1|4078266_4078533_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_023244191.1|4079073_4079817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000468231.1|4079820_4080060_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_000214429.1|4080075_4080642_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.9	7.9e-61
WP_000775190.1|4081080_4082022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000957221.1|4082030_4082486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772664.1|4082508_4083777_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	5.7e-75
4083947:4083963	attR	CGAAGGCCGGACTCGAA	NA	NA	NA	NA
>prophage 10
NZ_CP014657	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 chromosome, complete genome	4704371	4336491	4381269	4704371	tail,tRNA,plate	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4336491_4337490_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242904.1|4337577_4338888_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4339134_4339650_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4339749_4339959_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4339980_4340094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4340090_4341416_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4341594_4342203_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4342311_4342680_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4342850_4345271_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4345369_4346242_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4346255_4346753_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001749156.1|4346933_4347851_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4348014_4349373_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4349461_4350571_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4350932_4352123_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_023242906.1|4352254_4353799_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_020845801.1|4353813_4354704_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4354869_4355280_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750805.1|4355422_4357519_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4357518_4358256_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4358252_4358921_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4358954_4359197_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4359640_4361290_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4361634_4362984_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4363114_4363462_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226440.1|4364037_4364325_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	5.1e-16
WP_001270438.1|4364327_4364933_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	60.4	6.5e-61
WP_000777266.1|4364945_4365260_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4365419_4365875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242908.1|4365871_4366069_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	6.6e-07
WP_023242909.1|4366058_4367486_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	71.2	8.1e-195
WP_000907495.1|4367485_4368010_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4368061_4368379_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4368338_4368467_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023242910.1|4368563_4370918_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	3.1e-66
WP_023242911.1|4370917_4371871_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4371870_4372080_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023244444.1|4372067_4373111_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	4.2e-76
WP_000679393.1|4373120_4373843_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4374170_4374533_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4374529_4375459_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4375458_4377006_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4377169_4377529_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001749150.1|4377519_4378635_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.0	4.1e-101
WP_001749149.1|4378627_4379260_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	55.6	1.9e-23
WP_000368203.1|4379262_4380744_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	1.3e-51
WP_023244443.1|4380753_4381269_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	41.2	1.3e-33
>prophage 1
NZ_CP014658	Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 plasmid pSAN1-1736, complete sequence	160227	108391	127349	160227	transposase,integrase	Escherichia_phage(44.44%)	21	117573:117588	129499:129514
WP_000427623.1|108391_109396_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000414383.1|109495_109930_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_001294666.1|110001_110352_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732290.1|110367_110643_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000149288.1|110714_112400_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.9	1.1e-38
WP_000761850.1|112414_113053_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_000995361.1|113164_113530_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087810.1|113526_113763_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001276635.1|113759_114749_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|114958_115663_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018329.1|115852_116668_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_063177098.1|116820_117525_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.4e-138
117573:117588	attL	GTGCCCGCCGATGCGC	NA	NA	NA	NA
WP_000344784.1|118015_118876_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000287615.1|118926_120471_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_001324342.1|120593_122117_+|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000983249.1|122103_122889_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_000376623.1|123423_123924_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|124051_124891_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|124884_125232_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_031306504.1|125395_126187_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA12	NA	NA	NA	NA	NA
WP_000845039.1|126335_127349_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
129499:129514	attR	GTGCCCGCCGATGCGC	NA	NA	NA	NA
