The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015076	Escherichia coli strain Ecol_448 chromosome, complete genome	5007393	32796	108807	5007393	head,tRNA,portal,protease,integrase,tail,terminase,capsid,lysis	Enterobacteria_phage(33.93%)	86	32892:32907	119864:119879
WP_001157954.1|32796_33903_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
32892:32907	attL	GATACATCGGGTCGTA	NA	NA	NA	NA
WP_000460119.1|33971_34898_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776372.1|35127_35610_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141269.1|35687_36503_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001295838.1|36592_38374_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.2	7.8e-38
WP_000943566.1|38386_39163_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000401115.1|40310_41765_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006873.1|41824_43186_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001295839.1|43241_44543_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001295840.1|44564_45710_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.0	9.7e-50
WP_000540974.1|45837_46623_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001385234.1|46633_47869_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703882.1|47890_48940_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580888.1|49256_50924_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495391.1|50933_52193_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001313637.1|52203_53019_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855407.1|53015_53909_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815584.1|54442_55510_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|55506_56016_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_001188439.1|56111_56441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000212245.1|56551_57274_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255987.1|57276_57771_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912352.1|57944_59330_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143517.1|59365_59887_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190282.1|59994_60207_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|60208_61075_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000025786.1|61115_61313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298992.1|61437_62601_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000433946.1|62456_62828_-	helix-turn-helix domain-containing protein	NA	S5FM74	Shigella_phage	82.8	2.5e-47
WP_000206810.1|62827_63133_-	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_001595423.1|63132_63495_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.4	1.7e-64
WP_000008165.1|63485_64022_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_000081287.1|64149_64974_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|65039_65402_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|65872_66388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848748.1|66602_67277_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|67367_67568_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515829.1|67611_68169_+	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_001250269.1|68344_68524_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104986.1|68513_69455_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	1.9e-152
WP_077764601.1|69451_69946_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	5.2e-85
WP_000210176.1|69945_70272_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_001547119.1|70268_70658_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	2.3e-67
WP_001061408.1|70677_71475_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_001547120.1|71482_72472_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.3	6.4e-191
WP_001204776.1|72489_72873_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|73061_74144_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839597.1|74733_74949_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	2.6e-33
WP_001135253.1|74948_75446_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	6.0e-89
WP_000088942.1|75442_75880_+|lysis	lysis protein	lysis	A0A220NRM0	Escherichia_phage	97.2	3.2e-70
WP_000839225.1|76081_76579_+	DNA-binding protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
WP_001283921.1|76575_76833_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000079508.1|77119_77530_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001331705.1|77587_77821_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000453587.1|78209_78755_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027298.1|78729_80655_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|80651_80858_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001595430.1|80854_82456_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	1.6e-308
WP_001595431.1|82436_83768_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	97.9	1.5e-230
WP_000201478.1|83777_84110_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_000118192.1|84165_85191_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	95.6	5.4e-185
WP_001586767.1|85232_85628_+	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.2e-55
WP_000752965.1|85639_85993_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_001595432.1|86004_86583_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683142.1|86579_86975_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
WP_001424234.1|86982_87723_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.1	1.2e-125
WP_001595434.1|87738_88161_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	9.1e-62
WP_000459464.1|88142_88577_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	1.7e-63
WP_063131892.1|88569_91131_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.5	0.0e+00
WP_000847352.1|91127_91457_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	1.1e-57
WP_001152612.1|91456_92155_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_063131893.1|92160_92904_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	3.7e-143
WP_000090949.1|92840_93443_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	2.6e-86
WP_063131894.1|93503_96983_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.8	0.0e+00
WP_001228249.1|97050_97650_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	1.5e-102
WP_063131895.1|97714_100114_+|tail	phage tail protein	tail	A0A0E3M194	Enterobacteria_phage	55.2	3.9e-133
WP_000654158.1|100110_100392_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	48.9	1.6e-17
WP_001595444.1|100401_101106_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	7.0e-59
WP_000355609.1|101116_101410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239881.1|101603_102272_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226375.1|102810_104295_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|104481_105435_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_137444657.1|105909_106644_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	78.4	3.7e-79
WP_000259982.1|106593_106899_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	64.3	4.7e-44
WP_000239877.1|106953_107622_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001201855.1|107853_108807_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
119864:119879	attR	TACGACCCGATGTATC	NA	NA	NA	NA
>prophage 2
NZ_CP015076	Escherichia coli strain Ecol_448 chromosome, complete genome	5007393	634542	672792	5007393	transposase,integrase,tail,plate,capsid	Burkholderia_virus(43.24%)	54	631328:631349	672049:672070
631328:631349	attL	CCCTGTAACATCTGGCGGTAGC	NA	NA	NA	NA
WP_000904922.1|634542_635115_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_063131899.1|635186_635660_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	51.8	1.4e-34
WP_000072166.1|635666_636281_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_021537399.1|636280_636763_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	45.3	3.4e-28
WP_077881674.1|636801_638397_-|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.6	1.0e-41
WP_063131900.1|638399_638978_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	4.9e-66
WP_001219102.1|638970_640074_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	8.3e-107
WP_000859111.1|640064_640412_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148267.1|640466_641063_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	1.4e-36
WP_000808006.1|641059_642214_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	3.2e-85
WP_012602373.1|642201_642417_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|642413_643298_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_001202894.1|646584_646743_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|646666_647002_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001513983.1|647099_647381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|647383_647905_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|647904_649332_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|649321_649576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|649572_650037_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|650036_650483_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|650484_650823_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|650832_651786_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|651800_652916_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|653130_653589_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117556.1|653591_654413_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
WP_063131901.1|654393_655890_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	1.8e-168
WP_063131926.1|655889_657422_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	63.0	3.6e-185
WP_000124060.1|657481_658027_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_000227700.1|658026_658338_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175097.1|658337_658664_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_063131902.1|658660_659311_-	hypothetical protein	NA	Q5ZQY9	Pseudomonas_phage	33.3	4.7e-09
WP_001104440.1|659294_660035_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|660037_660388_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_021526138.1|660518_661247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|661222_661627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|661625_661841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016238312.1|662031_662799_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.7	4.5e-99
WP_016238311.1|662851_663289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016238310.1|663248_664142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016238309.1|664264_664681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016238308.1|664769_664994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016238307.1|664990_665299_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	54.9	6.1e-23
WP_021526139.1|665309_666221_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	53.7	1.9e-72
WP_021552089.1|666224_667994_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.5	6.2e-229
WP_021552090.1|668004_669171_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.8e-121
WP_000843445.1|669173_669443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001381528.1|669470_670001_+	bacteriophage Mu Gam like family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_021526141.1|670289_670562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197789.1|670571_670877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131941.1|670873_671557_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	37.3	2.6e-34
WP_021526143.1|671553_671784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021526144.1|671773_671989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552092.1|671978_672431_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	7.3e-25
672049:672070	attR	GCTACCGCCAGATGTTACAGGG	NA	NA	NA	NA
WP_001281695.1|672402_672792_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	4.5e-31
>prophage 3
NZ_CP015076	Escherichia coli strain Ecol_448 chromosome, complete genome	5007393	725889	813294	5007393	head,tRNA,holin,portal,transposase,integrase,tail,terminase,capsid,lysis	Enterobacteria_phage(36.36%)	118	749843:749858	791341:791356
WP_000074983.1|725889_727008_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|726976_727246_-	excisionase	NA	NA	NA	NA	NA
WP_000102155.1|727307_729764_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	3.3e-103
WP_001093951.1|729841_730045_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|730041_730230_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935596.1|730240_731095_-	hypothetical protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000394557.1|731625_732000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379564.1|732011_732164_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000787428.1|732370_732778_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912294.1|732854_733082_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|733065_733617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|733588_734629_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001309414.1|734540_735083_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450706.1|735116_735887_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
WP_001141099.1|735902_736295_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|736291_736588_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|736584_737046_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403791.1|737023_737380_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_000137947.1|737475_737883_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	6.1e-23
WP_001229301.1|737884_738250_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000208092.1|738246_739233_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_001336454.1|739314_739533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|739791_739947_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001309416.1|740163_740415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309417.1|740481_740760_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001265256.1|740761_741820_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_000140038.1|741820_742189_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001064909.1|742181_742871_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_001309418.1|743083_743281_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
WP_157835956.1|743256_743370_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000871291.1|743650_743986_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001309419.1|744231_744435_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_001309421.1|744431_744593_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_063131903.1|744742_744958_+|holin	holin	holin	A0A0P0ZFW5	Escherichia_phage	98.6	3.4e-33
WP_001037013.1|744962_745853_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	1.2e-108
WP_001092866.1|745889_746423_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001446668.1|746579_746762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|746776_746908_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_032142285.1|746910_747378_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_000830178.1|747688_748015_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|748137_748491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235436.1|748973_749483_+|terminase	terminase	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001309424.1|749454_751383_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
749843:749858	attL	AAGACCTTTTTCCATG	NA	NA	NA	NA
WP_000258993.1|751366_751573_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001322425.1|751569_753162_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_001253887.1|753151_754600_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	9.9e-100
WP_000256814.1|754636_754984_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_000522603.1|755041_756070_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.4e-116
WP_000201530.1|756121_756496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|756488_756842_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000974996.1|756857_757391_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.6	2.5e-56
WP_000683079.1|757387_757783_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235048.1|757790_758540_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.8	2.7e-125
WP_001309426.1|758558_758990_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	7.4e-43
WP_000533401.1|759016_759430_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.8	4.6e-42
WP_000082417.1|759410_761972_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847291.1|761968_762298_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001309428.1|762297_762996_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	3.2e-128
WP_000194723.1|763006_763750_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_122991350.1|763695_764328_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.7	1.2e-102
WP_000514740.1|764671_768364_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.6	0.0e+00
WP_001233148.1|768431_769031_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216486.1|769182_772209_+	membrane protein	NA	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_000885577.1|772208_772793_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|772847_773516_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|773572_773839_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000799406.1|774070_774934_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|774917_776054_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001545930.1|776303_777530_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|777578_778700_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|778775_780236_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|780235_780907_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423736.1|781075_782446_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.9e-107
WP_001295971.1|782449_783091_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001295972.1|783126_784233_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|784286_784748_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|784757_785411_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|785582_786833_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|786946_788089_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|788078_788315_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|788454_788694_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763364.1|788741_788960_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_001308571.1|789058_789340_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_000548537.1|789350_789542_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_077881675.1|789519_789696_-	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.0	6.5e-22
WP_000186858.1|789692_790373_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	4.6e-132
WP_000100847.1|790369_791155_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995417.1|791160_791457_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	96.9	1.5e-47
791341:791356	attR	AAGACCTTTTTCCATG	NA	NA	NA	NA
WP_000233576.1|791532_791739_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|792214_792592_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|792569_793631_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000712396.1|793711_794404_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000184665.1|794514_794742_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182881.1|794772_795312_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_001441930.1|795398_796328_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	1.9e-112
WP_000788877.1|796324_797026_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000145918.1|797022_797325_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	93.5	1.3e-41
WP_001070442.1|797392_797725_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032143398.1|797773_797923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709098.1|797980_799507_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	30.8	2.7e-31
WP_000700204.1|799856_800900_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072093903.1|801249_801351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053004.1|801347_801803_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_000224907.1|801802_801973_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774475.1|801965_802256_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099697.1|802252_802615_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971095.1|802611_802752_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001204794.1|802837_803221_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000737277.1|803409_804492_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.0	4.1e-167
WP_001545960.1|805488_807417_+	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	60.1	7.5e-111
WP_000422741.1|807498_807924_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|807920_808271_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|808301_809915_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000654168.1|810082_810361_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
WP_000355360.1|810373_810667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968127.1|810758_811616_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101732.1|811612_812470_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983701.1|812466_813294_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	27.7	8.7e-08
>prophage 4
NZ_CP015076	Escherichia coli strain Ecol_448 chromosome, complete genome	5007393	1518554	1595856	5007393	head,terminase,holin,portal,transposase,integrase,tail,protease,capsid	Escherichia_phage(40.0%)	97	1574911:1574925	1596545:1596559
WP_032143406.1|1518554_1519094_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.3	3.3e-32
WP_000879825.1|1519250_1520048_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|1520057_1520609_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|1520777_1521110_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|1521453_1521768_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994422.1|1521982_1523641_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|1523633_1524629_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282656.1|1524621_1525308_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|1525307_1526681_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|1526699_1527143_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000133106.1|1528370_1528835_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|1528839_1529844_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282103.1|1529840_1530254_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001313947.1|1530256_1530622_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253318.1|1530621_1531359_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|1531368_1531638_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983988.1|1531646_1532432_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103980.1|1532721_1533345_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|1533388_1533631_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|1533739_1533967_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491480.1|1534264_1535080_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001545998.1|1535076_1536771_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	34.5	1.9e-17
WP_000009302.1|1536941_1537124_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|1537202_1538120_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|1538292_1539213_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|1539201_1539672_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157268.1|1539652_1541071_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001527153.1|1541137_1541833_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001330593.1|1541872_1542238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824389.1|1542803_1543862_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	49.1	2.5e-92
WP_000218225.1|1544456_1545308_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826725.1|1545415_1546774_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_024175729.1|1546773_1547445_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	34.7	1.2e-31
WP_000920127.1|1547577_1547991_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740055.1|1548099_1549104_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240061.1|1549104_1549740_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007774.1|1549997_1550648_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000355608.1|1551731_1552019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235967.1|1552029_1552734_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000654154.1|1552743_1553025_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_001545999.1|1553021_1555421_-|tail	phage tail fiber protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_001228252.1|1555485_1556085_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_063131909.1|1556152_1559632_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.5	0.0e+00
WP_021539543.1|1559692_1560340_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	1.2e-110
WP_032202024.1|1560237_1560981_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.1	4.9e-143
WP_001152456.1|1560985_1561684_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
WP_001330090.1|1561683_1562040_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001546000.1|1562017_1565245_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.8	0.0e+00
WP_071590020.1|1565291_1565552_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_000164664.1|1565593_1565965_-	hypothetical protein	NA	A0A1B5FP91	Escherichia_phage	99.2	5.5e-63
WP_000097526.1|1565979_1566684_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
WP_001546001.1|1566744_1567089_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	2.3e-55
WP_014639219.1|1567085_1567535_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
WP_001147814.1|1567531_1567870_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|1567878_1568196_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766108.1|1568272_1569490_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.4	1.7e-161
WP_000999828.1|1569504_1570104_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923131.1|1570096_1571323_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.8	4.1e-203
WP_001140892.1|1571470_1573228_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001317918.1|1573227_1573710_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_001532429.1|1573858_1574209_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	1.4e-63
WP_001532432.1|1574347_1574887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100260.1|1574892_1575159_-	hypothetical protein	NA	NA	NA	NA	NA
1574911:1574925	attL	CGCCTTATTATGCTC	NA	NA	NA	NA
WP_001228685.1|1575376_1575562_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000992100.1|1575778_1576312_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_000193280.1|1576375_1576726_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000839572.1|1576730_1576946_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_001064894.1|1577741_1578431_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	9.6e-61
WP_000140004.1|1578427_1578793_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
WP_024188444.1|1578793_1579849_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	7.5e-89
WP_024175747.1|1579850_1580129_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_000737636.1|1580425_1580818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|1580961_1581174_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000206826.1|1581407_1581752_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000207997.1|1581748_1581916_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000224227.1|1581926_1582190_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000206712.1|1582191_1582632_-	hypothetical protein	NA	A0A2I6PID2	Escherichia_phage	50.3	2.0e-19
WP_001514293.1|1582633_1582993_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	74.5	1.6e-38
WP_021539545.1|1583158_1583341_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	6.9e-27
WP_072189218.1|1583434_1583833_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	5.7e-58
WP_001514296.1|1583792_1584329_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	97.9	6.3e-52
WP_001514297.1|1584321_1584621_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	97.0	5.6e-50
WP_001514298.1|1584617_1585040_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	4.7e-66
WP_001514299.1|1585080_1586151_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_000693853.1|1586222_1586648_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261754.1|1586644_1586872_-	cell division control protein	NA	NA	NA	NA	NA
WP_000444613.1|1586971_1587616_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	8.8e-08
WP_000379575.1|1587893_1588049_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171947.1|1588208_1588427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296188.1|1588430_1588595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|1588994_1589183_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070256.1|1589179_1589371_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_032166410.1|1589464_1591936_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000096344.1|1591994_1592198_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533615.1|1592197_1593223_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001311896.1|1593458_1594256_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_024175719.1|1594593_1595856_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	4.1e-73
1596545:1596559	attR	CGCCTTATTATGCTC	NA	NA	NA	NA
>prophage 5
NZ_CP015076	Escherichia coli strain Ecol_448 chromosome, complete genome	5007393	1719150	1727821	5007393		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|1719150_1720254_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|1720261_1721509_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|1721505_1722063_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|1722062_1722944_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023617.1|1723001_1723901_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	6.3e-28
WP_000699450.1|1723900_1724986_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.9e-101
WP_000183060.1|1725358_1726252_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001115960.1|1726426_1727821_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
>prophage 6
NZ_CP015076	Escherichia coli strain Ecol_448 chromosome, complete genome	5007393	2398651	2405791	5007393		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|2398651_2401213_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|2401318_2401975_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001272542.1|2402025_2402823_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_000847996.1|2402988_2403897_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|2403893_2405156_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|2405152_2405791_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 7
NZ_CP015076	Escherichia coli strain Ecol_448 chromosome, complete genome	5007393	2655060	2722105	5007393	protease,tRNA,transposase,integrase	Pseudomonas_phage(25.0%)	51	2656269:2656286	2720599:2720616
WP_001546095.1|2655060_2655819_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|2656248_2657169_-	agmatinase	NA	NA	NA	NA	NA
2656269:2656286	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|2657304_2658036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|2658181_2660158_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|2660166_2660298_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|2660433_2660649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|2660952_2662107_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|2662543_2663938_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|2664014_2664512_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001305312.1|2664606_2665314_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001531929.1|2665393_2666125_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593260.1|2666137_2667088_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126436.1|2667124_2667760_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|2667759_2668176_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001546096.1|2668354_2669335_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|2669352_2670057_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|2670074_2670641_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|2670637_2670928_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174747.1|2670935_2671529_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239978.1|2671521_2672658_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745201.1|2672726_2673734_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|2673850_2674897_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|2675072_2675792_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|2675975_2676302_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|2676301_2677021_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001376017.1|2677181_2678234_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|2678261_2678537_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001618095.1|2678600_2679680_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001327414.1|2679881_2681138_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001546097.1|2681186_2683322_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|2683714_2684422_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|2684800_2686066_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|2686321_2687365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|2689058_2689610_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000006213.1|2692101_2692335_+	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_023146305.1|2692801_2693017_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
WP_001189123.1|2693461_2694970_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001513409.1|2696472_2696586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110186.1|2698419_2698680_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|2698721_2699282_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|2699321_2699750_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_103103190.1|2700458_2701686_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
WP_000074472.1|2701799_2702993_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|2703128_2704853_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|2704853_2705801_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|2705800_2707543_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|2707539_2708817_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|2708898_2711100_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001546100.1|2712043_2715931_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	38.8	7.5e-227
WP_001189123.1|2717652_2719161_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_032212789.1|2721250_2722105_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
2720599:2720616	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 1
NZ_CP015077	Escherichia coli strain Ecol_448 plasmid pEC448_1, complete sequence	133735	25320	80718	133735	transposase,integrase	Escherichia_phage(30.0%)	50	59107:59166	77213:77363
WP_000016982.1|25320_26127_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|26127_26433_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|26434_26653_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000151784.1|27219_27732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545987.1|27765_28899_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000905949.1|29065_29839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000528931.1|29851_30352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261278.1|30616_30847_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001034046.1|30843_31260_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_061092170.1|35090_35348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|35453_35729_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|35728_36013_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000562172.1|36617_37370_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001022265.1|37415_38381_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000710783.1|38413_38794_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_001077068.1|38818_39709_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000796505.1|39941_40136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338039.1|40680_41559_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_001271561.1|41548_42436_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000922702.1|42446_43271_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000950177.1|43276_44350_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000476108.1|44342_45653_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001067834.1|47572_48277_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000874189.1|48986_49472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267177.1|49496_49982_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|49968_50664_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729220.1|50668_51799_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|51788_53072_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|53074_54454_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|54557_55085_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|55125_57012_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|57358_58174_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|58356_58863_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|58852_59011_-	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
59107:59166	attL	ACGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_001072355.1|60452_61622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023141670.1|62821_62947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066953.1|63067_63808_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361611.1|64092_65070_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_000949004.1|68051_68966_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983710.1|68965_69793_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_001101723.1|69789_70647_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968139.1|70643_71501_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000361402.1|72850_73873_-	helicase UvrD	NA	NA	NA	NA	NA
WP_001128474.1|73857_75423_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001034044.1|75497_75914_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261286.1|75910_76141_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|77266_77971_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
77213:77363	attR	ACGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACC	NA	NA	NA	NA
WP_000027057.1|78555_79416_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|79565_79967_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|80013_80718_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139

