The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015069	Escherichia coli strain Ecol_743 chromosome, complete genome	4856574	860729	869400	4856574		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|860729_861833_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|861840_863088_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|863084_863642_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|863641_864523_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023617.1|864580_865480_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	6.3e-28
WP_000699450.1|865479_866565_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	3.9e-101
WP_000183060.1|866937_867831_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001115960.1|868005_869400_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	6.3e-19
>prophage 2
NZ_CP015069	Escherichia coli strain Ecol_743 chromosome, complete genome	4856574	965438	973750	4856574		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001296230.1|965438_967442_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|967566_968028_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|968068_968539_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|968585_969305_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|969301_970987_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|971208_971940_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|971999_972107_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|972087_972819_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|972823_973750_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 3
NZ_CP015069	Escherichia coli strain Ecol_743 chromosome, complete genome	4856574	1205573	1283415	4856574	integrase,transposase	Stx2-converting_phage(33.33%)	52	1205380:1205399	1281551:1281570
1205380:1205399	attL	ATTCCTGCAGGGGACACCAT	NA	NA	NA	NA
WP_001131472.1|1205573_1206764_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.3	7.6e-130
WP_000160236.1|1208031_1208187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610751.1|1209499_1211860_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000100142.1|1212503_1213520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001610752.1|1214001_1216200_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_000117528.1|1216196_1217513_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_000424707.1|1217516_1219826_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001361538.1|1220294_1220453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123863910.1|1220576_1220867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610754.1|1222100_1223132_+	MFS transporter	NA	NA	NA	NA	NA
WP_000864948.1|1224138_1225164_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_097748387.1|1225719_1226864_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.3	2.0e-66
WP_000950719.1|1230429_1230768_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000186596.1|1230761_1231049_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_001361993.1|1231808_1232168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000906844.1|1232215_1232887_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001610764.1|1234425_1234773_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_032158436.1|1234772_1235450_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
WP_077250878.1|1236174_1236465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001610769.1|1237304_1238912_+	FGGY-family carbohydrate kinase	NA	NA	NA	NA	NA
WP_024193919.1|1238935_1240585_+	signal transduction protein	NA	NA	NA	NA	NA
WP_001610771.1|1240727_1242182_+	MFS transporter	NA	NA	NA	NA	NA
WP_001610772.1|1242239_1243343_+	mandelate racemase/muconate lactonizing enzyme family protein	NA	NA	NA	NA	NA
WP_001610773.1|1243366_1244194_+	SDR family oxidoreductase	NA	A0A167REC2	Powai_lake_megavirus	29.2	5.3e-05
WP_001610774.1|1244187_1245093_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_001610775.1|1245085_1245514_+	heme-binding protein	NA	NA	NA	NA	NA
WP_024193920.1|1245562_1246573_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_154675828.1|1249282_1249450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001610781.1|1249794_1250220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000270955.1|1250216_1250600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000860849.1|1250971_1251571_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_072146520.1|1251802_1251952_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001367564.1|1253018_1253810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001347898.1|1254193_1254400_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000782651.1|1254487_1255096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339397.1|1258456_1259134_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_001610764.1|1259133_1259481_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001610787.1|1259500_1261072_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.1	1.2e-167
WP_110046492.1|1260992_1261670_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	93.6	1.5e-98
WP_000255956.1|1261666_1262689_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001493615.1|1263713_1264649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998321.1|1264645_1266958_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001610790.1|1267262_1267865_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	33.3	1.8e-07
WP_001610792.1|1268263_1269364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001610793.1|1269660_1270095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069762.1|1274395_1275268_+	GTPase family protein	NA	NA	NA	NA	NA
WP_063131951.1|1275640_1278487_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001610805.1|1278814_1279633_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.3	2.7e-46
WP_001610806.1|1279724_1280210_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	9.0e-13
WP_001610807.1|1280224_1280701_+	RadC family protein	NA	NA	NA	NA	NA
WP_000691817.1|1280763_1280985_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.1e-10
WP_001298859.1|1281873_1283415_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
1281551:1281570	attR	ATTCCTGCAGGGGACACCAT	NA	NA	NA	NA
>prophage 4
NZ_CP015069	Escherichia coli strain Ecol_743 chromosome, complete genome	4856574	1612506	1619646	4856574		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|1612506_1615068_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|1615173_1615830_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001296319.1|1615880_1616648_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|1616843_1617752_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|1617748_1619011_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|1619007_1619646_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 5
NZ_CP015069	Escherichia coli strain Ecol_743 chromosome, complete genome	4856574	1868919	1929790	4856574	tRNA,transposase,protease,lysis,integrase	Staphylococcus_phage(20.0%)	49	1870128:1870145	1934458:1934475
WP_001546095.1|1868919_1869678_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|1870107_1871028_-	agmatinase	NA	NA	NA	NA	NA
1870128:1870145	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|1871163_1871895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|1872040_1874017_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|1874025_1874157_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|1874292_1874508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|1874811_1875966_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|1876402_1877797_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|1877873_1878371_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001305312.1|1878465_1879173_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001531929.1|1879252_1879984_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593260.1|1879996_1880947_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001355636.1|1881055_1881619_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|1881618_1882035_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001546096.1|1882213_1883194_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|1883211_1883916_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|1883933_1884500_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|1884496_1884787_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174747.1|1884794_1885388_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239978.1|1885380_1886517_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745201.1|1886585_1887593_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|1887709_1888756_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|1888931_1889651_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|1889834_1890161_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|1890160_1890880_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001376017.1|1891040_1892093_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|1892120_1892396_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001618095.1|1892459_1893539_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001327414.1|1893740_1894997_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001546097.1|1895045_1897181_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|1897573_1898281_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|1898659_1899925_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|1900180_1901224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|1902917_1903469_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296368.1|1905972_1906194_+	pap operon regulatory protein PapI	NA	NA	NA	NA	NA
WP_001189123.1|1907320_1908829_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001513409.1|1910331_1910445_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|1912278_1912539_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|1912580_1913141_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|1913180_1913609_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_149019277.1|1914317_1915545_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	4.5e-170
WP_000074472.1|1915658_1916852_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|1916987_1918712_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|1918712_1919660_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|1919659_1921402_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|1921398_1922676_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|1922757_1924959_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_011076574.1|1925509_1925653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001546100.1|1925902_1929790_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	38.8	7.5e-227
1934458:1934475	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 6
NZ_CP015069	Escherichia coli strain Ecol_743 chromosome, complete genome	4856574	4806521	4854469	4856574	tRNA,transposase,tail,head,portal,lysis,capsid,terminase,integrase	Enterobacteria_phage(57.14%)	65	4800703:4800717	4822846:4822860
4800703:4800717	attL	CGCCCAGCAGGCGAT	NA	NA	NA	NA
WP_001295972.1|4806521_4807628_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4807681_4808143_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|4808152_4808806_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4808977_4810228_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|4810341_4811484_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|4811473_4811710_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|4811849_4812089_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763364.1|4812136_4812355_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_001308571.1|4812453_4812735_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.2e-46
WP_000548537.1|4812745_4812937_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149539.1|4812909_4813092_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	6.3e-28
WP_000186858.1|4813088_4813769_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	4.6e-132
WP_000100847.1|4813765_4814551_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995417.1|4814556_4814853_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	96.9	1.5e-47
WP_000233576.1|4814928_4815135_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|4815610_4815988_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|4815965_4817027_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000712396.1|4817107_4817800_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.3	2.5e-109
WP_000184665.1|4817910_4818138_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182881.1|4818168_4818708_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	8.9e-62
WP_000147914.1|4818704_4819724_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.7	2.7e-112
WP_000788877.1|4819720_4820422_+	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_000145918.1|4820418_4820721_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	93.5	1.3e-41
WP_001070442.1|4820788_4821121_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032143398.1|4821169_4821319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709098.1|4821376_4822903_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	30.8	2.7e-31
4822846:4822860	attR	CGCCCAGCAGGCGAT	NA	NA	NA	NA
WP_000700204.1|4823252_4824296_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072093903.1|4824645_4824747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053004.1|4824743_4825199_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_000224907.1|4825198_4825369_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774475.1|4825361_4825652_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099697.1|4825648_4826011_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971095.1|4826007_4826148_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001204794.1|4826233_4826617_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000737277.1|4826805_4827888_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.0	4.1e-167
WP_000839596.1|4828477_4828693_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000075094.1|4828692_4829190_+	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	99.4	1.7e-91
WP_001441931.1|4829186_4829630_+|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	92.5	4.3e-70
WP_000084844.1|4829668_4830043_+	hypothetical protein	NA	M1FPD9	Enterobacteria_phage	80.6	1.5e-47
WP_012896773.1|4830274_4830553_+	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	87.5	1.3e-08
WP_000867568.1|4830634_4831183_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001573719.1|4831154_4833083_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.9	1.1e-260
WP_000258997.1|4833066_4833273_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001441934.1|4833269_4834862_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253893.1|4834851_4836357_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.5	7.9e-100
WP_000256813.1|4836393_4836741_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.6e-22
WP_000522650.1|4836798_4837827_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	4.5e-115
WP_000201530.1|4837878_4838253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|4838245_4838599_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_001007370.1|4838610_4839189_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	91.7	1.1e-78
WP_000683150.1|4839185_4839581_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001545921.1|4839588_4840329_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	2.8e-130
WP_000479204.1|4840344_4840767_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	3.7e-71
WP_000459449.1|4840748_4841183_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	3.8e-63
WP_000840282.1|4841175_4843737_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	88.8	0.0e+00
WP_000847387.1|4843733_4844063_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	9.9e-56
WP_001152542.1|4844062_4844761_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	5.2e-131
WP_000194748.1|4844766_4845510_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	3.3e-147
WP_000090860.1|4845446_4846079_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	97.6	4.6e-94
WP_001545959.1|4846139_4849538_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001545960.1|4849596_4851525_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	60.1	7.5e-111
WP_000422741.1|4851606_4852032_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|4852028_4852379_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|4852409_4854023_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000654168.1|4854190_4854469_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
>prophage 1
NZ_CP015070	Escherichia coli strain Ecol_743 plasmid pEC743_1, complete sequence	111851	0	64321	111851	transposase,protease,integrase	Escherichia_phage(40.0%)	51	8116:8132	62418:62434
WP_001553854.1|0_3117_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_001617890.1|3238_4522_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_001617892.1|4518_6075_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_001190712.1|6257_6479_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|6478_6859_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|6863_7043_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|7070_7430_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|7716_8034_-	hypothetical protein	NA	NA	NA	NA	NA
8116:8132	attL	GGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_012372828.1|8261_9278_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001373486.1|9485_10889_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|10875_11808_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000361610.1|15150_16128_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001066941.1|16412_17153_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309252.1|17273_17462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|17828_18998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|19844_20117_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001298664.1|21359_23330_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|23336_24128_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001323403.1|24866_25646_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_001310017.1|25645_26668_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000612626.1|27747_28095_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|28091_28496_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001189113.1|28997_30506_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_001020413.1|32771_33947_-	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001100763.1|34015_36277_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001398199.1|37349_37751_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|37683_37941_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|38033_38687_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001617855.1|39626_40484_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_031943482.1|40476_40551_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083850.1|40787_41042_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_023144756.1|41338_41473_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000080195.1|41908_43522_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|43552_43903_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|43899_44325_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_013023861.1|44883_45096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139341.1|45226_45787_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000205718.1|45841_46588_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.9	3.2e-09
WP_001617867.1|46607_51878_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_023356304.1|51877_54094_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000199914.1|54090_54870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000850429.1|55072_55804_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000605862.1|55835_56333_-	entry exclusion protein	NA	NA	NA	NA	NA
WP_001007062.1|56351_59171_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_000944328.1|59167_60541_-	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_001348758.1|60527_60953_-	F-type conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_071571857.1|60900_61248_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_000059829.1|61177_61723_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_001617873.1|61709_61994_-	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_001348757.1|62120_62441_-	conjugal transfer protein TrbA	NA	NA	NA	NA	NA
62418:62434	attR	GGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000019450.1|63340_64321_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
>prophage 1
NZ_CP015071	Escherichia coli strain Ecol_743 plasmid pEC743_OXA48, complete sequence	69471	32901	66742	69471	integrase,transposase	Enterobacteria_phage(15.38%)	44	31750:31768	53025:53043
31750:31768	attL	TGTTCAAATATGAACATTT	NA	NA	NA	NA
WP_165503372.1|32901_35934_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.9	0.0e+00
WP_000480968.1|35837_36674_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|36673_37477_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_015586042.1|37592_38294_+|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_015586041.1|38948_39728_-	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	35.1	1.1e-31
WP_001082319.1|39955_40759_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001067855.1|41067_41772_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004187345.1|42122_42353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206912.1|42450_42789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206911.1|42978_43839_-	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.9	2.8e-17
WP_004187364.1|43911_44091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187367.1|44767_45034_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206910.1|45078_45528_-	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_004206909.1|45649_46012_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_004206908.1|46033_46297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206907.1|46414_46825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206906.1|46853_47333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206905.1|47325_47571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187378.1|47949_48513_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.3	5.2e-20
WP_004206904.1|48522_48966_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_011091047.1|48968_49943_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	52.0	6.1e-85
WP_004187383.1|50183_50924_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
WP_020316874.1|50942_51146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187390.1|51187_51673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206901.1|51669_52257_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_004187394.1|52249_52498_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
WP_015586036.1|52494_52956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206899.1|53096_53642_+	hypothetical protein	NA	NA	NA	NA	NA
53025:53043	attR	AAATGTTCATATTTGAACA	NA	NA	NA	NA
WP_004206898.1|53794_54202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062853.1|54203_54782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206896.1|54759_55116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015059996.1|55643_56831_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_015059995.1|56849_57122_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015059994.1|57118_57802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187411.1|57846_58065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187413.1|58067_58277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019725070.1|58399_59665_-	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.4	2.6e-112
WP_004187425.1|59652_60087_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.3	1.2e-29
WP_020277900.1|60179_60545_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_004187429.1|60513_60771_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_025987686.1|61102_62308_-|transposase	IS4 family transposase	transposase	Q9E8P4	Bluetongue_virus	72.0	9.9e-170
WP_015059991.1|63220_64018_+	carbapenem-hydrolyzing class D beta-lactamase OXA-48	NA	NA	NA	NA	NA
WP_015586033.1|64319_65231_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011790968.1|65491_66742_+|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	4.2e-171
