The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014806	Rummeliibacillus stabekisii strain PP9 chromosome, complete genome	3412092	375106	388230	3412092		Prochlorococcus_phage(30.0%)	13	NA	NA
WP_066784859.1|375106_375652_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	49.4	2.0e-37
WP_066784861.1|375725_376487_+	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	58.9	1.0e-42
WP_066784864.1|376495_377074_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_066784872.1|378049_378535_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	46.5	3.6e-22
WP_066784875.1|378518_379667_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_149031981.1|379763_380483_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FUQ7	Synechococcus_phage	43.9	8.8e-49
WP_066784878.1|380475_380730_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	2.1e-05
WP_066784881.1|380726_381413_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_066784882.1|381396_383619_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.2	9.4e-166
WP_066784887.1|383603_385028_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.8	4.6e-49
WP_066784890.1|385081_386098_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	48.0	4.7e-72
WP_066784892.1|386097_386682_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	37.6	1.8e-23
WP_066784895.1|386694_388230_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.7	2.1e-71
>prophage 2
NZ_CP014806	Rummeliibacillus stabekisii strain PP9 chromosome, complete genome	3412092	565374	634403	3412092	terminase,protease,tRNA,integrase,portal,tail,head,capsid	Bacillus_phage(22.22%)	89	574484:574514	627791:627821
WP_066791835.1|565374_566109_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_066785363.1|566243_566588_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_066785366.1|566734_567304_+	signal peptidase I	NA	NA	NA	NA	NA
WP_066785368.1|567316_568180_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_066785370.1|568268_569042_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	38.5	7.3e-25
WP_066785372.1|569048_570974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785374.1|570970_571267_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_066785376.1|571432_572593_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_066785379.1|572609_573512_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_066785381.1|573580_574477_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.0	1.2e-26
574484:574514	attL	GTTGCAAAATTTGATTTTCTGTTATACATTT	NA	NA	NA	NA
WP_066785385.1|574593_575724_-|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	30.1	1.0e-43
WP_066785388.1|575796_576426_-	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	58.1	3.4e-65
WP_066785390.1|576579_576822_+	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	71.6	9.0e-22
WP_066785395.1|576846_577029_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066785397.1|577049_577748_+	ORF6C domain-containing protein	NA	A9CR56	Staphylococcus_phage	41.8	1.8e-43
WP_066785401.1|577768_577972_+	DUF2829 domain-containing protein	NA	A0A2H4JF85	uncultured_Caudovirales_phage	42.6	2.0e-06
WP_066785404.1|577995_578736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785407.1|578755_579124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066785410.1|579185_579905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785413.1|579901_580105_+	hypothetical protein	NA	A0A2D1GQB9	Lysinibacillus_phage	56.9	1.1e-09
WP_084246858.1|580197_580455_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	72.0	1.2e-13
WP_066785415.1|580469_580892_+	replication terminator protein	NA	A0A097BY30	Enterococcus_phage	64.3	1.5e-40
WP_066785417.1|580891_581650_+	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	54.4	2.3e-71
WP_066785419.1|581666_581894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785422.1|581909_582182_-	hypothetical protein	NA	A0A097BY83	Enterococcus_phage	50.0	6.8e-18
WP_066785425.1|582236_583535_+	AAA family ATPase	NA	Q5YA97	Bacillus_phage	78.8	1.0e-167
WP_066785428.1|583534_584662_+	AAA family ATPase	NA	A0A0K2CZH1	Paenibacillus_phage	63.0	5.0e-131
WP_066785431.1|584684_585302_+	hypothetical protein	NA	A0A2I7SC41	Paenibacillus_phage	80.8	6.2e-67
WP_066785433.1|585315_586893_+	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	85.7	5.3e-264
WP_066785435.1|586912_587488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785439.1|587488_587713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158512558.1|587702_587873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785440.1|587877_588069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785442.1|588405_588615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158512559.1|588668_588836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158512560.1|588894_589071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785445.1|589370_591602_+	AAA family ATPase	NA	Q5YA88	Bacillus_phage	72.3	0.0e+00
WP_066785446.1|591950_592301_+	hypothetical protein	NA	A0A0C5AN02	Paenibacillus_phage	69.0	6.9e-31
WP_066785449.1|592312_592726_+	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	72.5	3.4e-53
WP_149032048.1|592953_593364_+	HNH endonuclease	NA	A0A220GJG3	Streptococcus_phage	50.4	4.9e-28
WP_066785453.1|593353_593578_+	hypothetical protein	NA	Q5YA85	Bacillus_phage	46.6	8.9e-16
WP_066785456.1|593609_594134_+	hypothetical protein	NA	S5MNT8	Brevibacillus_phage	44.1	2.9e-25
WP_066785459.1|594529_594727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785462.1|594952_595144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785465.1|595237_595522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785468.1|595884_596130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785471.1|596147_596510_+	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	50.8	4.2e-31
WP_066785473.1|596617_597100_+|terminase	phage terminase small subunit P27 family	terminase	Q2I8G1	Bacillus_phage	55.3	2.0e-41
WP_066785475.1|597096_598782_+|terminase	terminase large subunit	terminase	Q2LII3	Bacillus_virus	64.5	6.0e-205
WP_066785477.1|598824_599334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785479.1|599364_600585_+|portal	phage portal protein	portal	A0A0C5AE82	Paenibacillus_phage	60.8	3.2e-144
WP_066785482.1|600568_601309_+|protease	Clp protease ClpP	protease	A0A0U3U021	Bacillus_phage	58.0	2.1e-74
WP_066785485.1|601328_602549_+|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	65.6	8.0e-135
WP_066785488.1|602599_602833_+	hypothetical protein	NA	A0A0U4JVC3	Bacillus_phage	56.0	1.6e-07
WP_066785491.1|602832_603147_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBP7	Clostridium_phage	31.2	4.0e-06
WP_066785494.1|603139_603472_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_066785497.1|603472_603904_+	HK97 gp10 family phage protein	NA	X2KQN7	Enterococcus_phage	34.5	4.7e-13
WP_066785499.1|603900_604293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785500.1|604293_604875_+	hypothetical protein	NA	A0A059T7Y4	Listeria_phage	43.2	1.1e-41
WP_066785502.1|604931_605258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158512561.1|605290_605440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785505.1|605455_610393_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	41.6	9.3e-81
WP_066785509.1|610389_612033_+|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	37.5	7.8e-101
WP_066785512.1|612045_614571_+|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	45.7	1.3e-99
WP_066785515.1|614570_616175_+	hypothetical protein	NA	A0A1I9KK49	Lactobacillus_phage	37.6	6.0e-05
WP_066785520.1|616167_616359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785524.1|616336_617458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785526.1|617545_617761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785529.1|617880_618285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785532.1|618297_618549_+	PTS mannose transporter subunit IID	NA	A0A2H4JAG6	uncultured_Caudovirales_phage	44.6	3.0e-12
WP_066785541.1|618550_619366_+	N-acetylmuramoyl-L-alanine amidase	NA	Q5ILA1	Bacillus_phage	42.4	2.7e-25
WP_066785545.1|619624_619804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785548.1|619811_620447_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_066785550.1|620611_620833_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_066785553.1|620829_621213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785556.1|621228_621504_+	hypothetical protein	NA	A0A2I7SCS8	Paenibacillus_phage	41.8	2.8e-11
WP_066785558.1|621617_622127_-	hypothetical protein	NA	A0A2H4JA12	uncultured_Caudovirales_phage	43.4	2.5e-13
WP_066785561.1|622142_622745_-	replication-relaxation family protein	NA	M1HML1	Bacillus_virus	51.8	2.9e-53
WP_066785563.1|622683_623979_-	cell division protein FtsK	NA	A0A1S5QTS4	Bacillus_phage	58.4	4.5e-136
WP_149032049.1|624364_624526_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066785566.1|624663_625458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066785569.1|625496_625706_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_066785572.1|625880_626768_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066785574.1|626793_627549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066785576.1|627875_629951_+	type I DNA topoisomerase	NA	A0A167R9A0	Powai_lake_megavirus	40.3	3.3e-104
627791:627821	attR	GTTGCAAAATTTGATTTTCTGTTATACATTT	NA	NA	NA	NA
WP_066785577.1|629981_631292_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_066785580.1|631548_632448_+	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	30.3	7.2e-32
WP_066785582.1|632466_633015_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_066785584.1|633011_634403_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	26.5	2.1e-38
>prophage 3
NZ_CP014806	Rummeliibacillus stabekisii strain PP9 chromosome, complete genome	3412092	1407015	1431058	3412092	terminase,protease,head,tail,capsid	Bacillus_phage(29.41%)	25	NA	NA
WP_066787680.1|1407015_1409541_-|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	46.1	1.7e-99
WP_066787681.1|1409553_1411203_-|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	37.7	4.2e-102
WP_066787682.1|1411199_1416140_-|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	41.6	1.6e-80
WP_158512576.1|1416155_1416305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066787685.1|1416337_1416664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066787687.1|1416721_1417303_-	hypothetical protein	NA	A0A059T7Y4	Listeria_phage	44.2	2.2e-42
WP_066787689.1|1417303_1417696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066787692.1|1417692_1418124_-	HK97 gp10 family phage protein	NA	X2KQN7	Enterococcus_phage	33.1	4.0e-12
WP_066787695.1|1418124_1418457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066787698.1|1418449_1418764_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBP7	Clostridium_phage	31.2	4.0e-06
WP_066787701.1|1418763_1418997_-	hypothetical protein	NA	A0A0U4JVC3	Bacillus_phage	53.1	3.9e-06
WP_066787704.1|1419047_1420268_-|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	65.9	4.7e-135
WP_066787706.1|1420287_1421061_-|protease	Clp protease ClpP	protease	A0A0A7RUD3	Clostridium_phage	41.2	8.6e-42
WP_066787713.1|1422290_1423976_-|terminase	terminase large subunit	terminase	Q2LII3	Bacillus_virus	64.8	2.7e-205
WP_066787716.1|1423972_1424455_-|terminase	phage terminase small subunit P27 family	terminase	Q2I8G1	Bacillus_phage	55.3	2.0e-41
WP_066785471.1|1424562_1424925_-	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	50.8	4.2e-31
WP_066785468.1|1424942_1425188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066785465.1|1425550_1425835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066785462.1|1425928_1426120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066787721.1|1426282_1426543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066785456.1|1426938_1427463_-	hypothetical protein	NA	S5MNT8	Brevibacillus_phage	44.1	2.9e-25
WP_066785453.1|1427494_1427719_-	hypothetical protein	NA	Q5YA85	Bacillus_phage	46.6	8.9e-16
WP_066787724.1|1427715_1428117_-	RusA family crossover junction endodeoxyribonuclease	NA	Q5YA86	Bacillus_phage	77.9	2.2e-57
WP_066787726.1|1428128_1428479_-	hypothetical protein	NA	A0A0C5AN02	Paenibacillus_phage	69.0	6.9e-31
WP_066787728.1|1428826_1431058_-	AAA family ATPase	NA	Q5YA88	Bacillus_phage	72.7	0.0e+00
>prophage 4
NZ_CP014806	Rummeliibacillus stabekisii strain PP9 chromosome, complete genome	3412092	1434328	1445936	3412092	integrase	Paenibacillus_phage(41.67%)	19	1429063:1429078	1447022:1447037
1429063:1429078	attL	CTAACATAATGTCTTT	NA	NA	NA	NA
WP_066787745.1|1434328_1435906_-	DEAD/DEAH box helicase	NA	A0A2I7SC38	Paenibacillus_phage	85.9	3.7e-265
WP_066787746.1|1435919_1436534_-	hypothetical protein	NA	A0A2I7SC41	Paenibacillus_phage	79.1	6.8e-66
WP_066787750.1|1436556_1437696_-	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	61.9	5.5e-130
WP_066787753.1|1437695_1438997_-	AAA family ATPase	NA	Q5YA97	Bacillus_phage	78.8	2.9e-167
WP_066787756.1|1439018_1439777_-	hypothetical protein	NA	A0A097BY87	Enterococcus_phage	54.4	1.0e-71
WP_066787759.1|1439776_1440199_-	replication terminator protein	NA	A0A097BY30	Enterococcus_phage	62.9	5.7e-40
WP_084246858.1|1440214_1440472_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	72.0	1.2e-13
WP_066787762.1|1440564_1440768_-	hypothetical protein	NA	A0A2D1GQB9	Lysinibacillus_phage	57.4	2.7e-11
WP_066787766.1|1440764_1441430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158512579.1|1441702_1441879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066787767.1|1441941_1442130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158512580.1|1442110_1442287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066787768.1|1442397_1442787_+	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	40.9	4.8e-17
WP_066787771.1|1442783_1443032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066787777.1|1443141_1443450_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_066791876.1|1443427_1443619_-	transcriptional regulator	NA	A0A2H4JAT3	uncultured_Caudovirales_phage	63.5	9.2e-14
WP_066787780.1|1443853_1444261_+	helix-turn-helix domain-containing protein	NA	A0A2H4J386	uncultured_Caudovirales_phage	47.7	8.6e-17
WP_066787783.1|1444383_1444608_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066787786.1|1444811_1445936_+|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	50.3	1.5e-90
1447022:1447037	attR	CTAACATAATGTCTTT	NA	NA	NA	NA
>prophage 5
NZ_CP014806	Rummeliibacillus stabekisii strain PP9 chromosome, complete genome	3412092	1486974	1539695	3412092	protease,integrase,head,tail,plate	Bacillus_phage(22.22%)	63	1497612:1497627	1542247:1542262
WP_066787891.1|1486974_1488168_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	34.3	2.9e-44
WP_066787894.1|1488248_1489499_-	2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_066787897.1|1489530_1492341_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_066787905.1|1492572_1493991_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_066787908.1|1493987_1494668_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.9	3.4e-34
WP_066787914.1|1494799_1496533_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_066787916.1|1496556_1497528_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
1497612:1497627	attL	TATAAACATAATTGAA	NA	NA	NA	NA
WP_066787918.1|1498134_1498683_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_066787921.1|1499942_1500890_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_066787923.1|1500915_1501494_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_158512586.1|1501532_1501748_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066787930.1|1502089_1503385_+	cell division protein FtsK	NA	A0A1S5QTS4	Bacillus_phage	58.4	7.7e-136
WP_066787932.1|1503323_1503926_+	replication-relaxation family protein	NA	M1HML1	Bacillus_virus	51.3	5.5e-52
WP_066787935.1|1503941_1504481_+	hypothetical protein	NA	A0A2H4JA12	uncultured_Caudovirales_phage	49.5	1.3e-15
WP_066787938.1|1504685_1505480_-	N-acetylmuramoyl-L-alanine amidase	NA	Q8W5Y8	Listeria_phage	42.0	3.9e-21
WP_066787941.1|1505481_1505733_-	PTS mannose transporter subunit IID	NA	A0A2H4JAG6	uncultured_Caudovirales_phage	47.0	4.2e-14
WP_066787944.1|1505747_1506197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149032001.1|1506180_1506561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149032056.1|1506624_1507515_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	28.5	4.8e-20
WP_173668476.1|1507732_1507897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066787950.1|1507883_1508096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066787953.1|1508161_1509397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158512587.1|1509374_1509545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066787956.1|1509537_1510779_-|tail	phage tail protein	tail	Q19UQ3	Mannheimia_phage	38.8	9.0e-25
WP_066787959.1|1510781_1511345_-|tail	phage tail protein	tail	A0A2K9V471	Faecalibacterium_phage	38.7	1.3e-15
WP_066787962.1|1511337_1512450_-|plate	baseplate J/gp47 family protein	plate	A0A059WFM2	Vibrio_phage	36.6	7.7e-52
WP_149032002.1|1512436_1512757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066787968.1|1512770_1513493_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_066787971.1|1513506_1514592_-	phage late control D family protein	NA	A0A0C5AJ59	Bacteriophage	28.1	2.0e-36
WP_066787973.1|1514566_1514851_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_066787976.1|1514862_1518120_-|tail	phage tail tape measure protein	tail	X2KQI5	Enterococcus_phage	43.1	2.4e-61
WP_066787979.1|1518304_1518592_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_066787982.1|1518663_1519182_-|tail	phage major tail tube protein	tail	A0A0E3Y6F4	Fusobacterium_phage	32.9	4.4e-18
WP_066787985.1|1519199_1520654_-	hypothetical protein	NA	A0A059WKP9	Vibrio_phage	34.4	1.1e-69
WP_066787987.1|1520653_1520953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066787990.1|1520949_1521456_-	hypothetical protein	NA	A0A2K9V310	Faecalibacterium_phage	27.0	3.6e-12
WP_066787993.1|1521452_1522019_-|tail	phage tail protein	tail	A0A067ZG41	Vibrio_phage	42.0	1.5e-27
WP_066787996.1|1522018_1522336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066787999.1|1522319_1522619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066788002.1|1522629_1522947_-	DUF2190 family protein	NA	A0A2K9V343	Faecalibacterium_phage	35.8	3.5e-10
WP_084246910.1|1524457_1525039_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2K9V308	Faecalibacterium_phage	63.2	8.7e-47
WP_066788005.1|1528506_1529031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066788006.1|1529426_1529969_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	53.5	5.6e-48
WP_066788007.1|1529968_1530562_-	hypothetical protein	NA	A0A1L2JY33	Aeribacillus_phage	45.9	4.6e-27
WP_066788008.1|1530573_1530783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066788010.1|1530833_1531103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066788012.1|1531279_1531504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149032057.1|1531519_1531681_-	DUF3954 domain-containing protein	NA	NA	NA	NA	NA
WP_066788018.1|1531695_1531962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066788021.1|1532116_1532323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066788024.1|1532323_1532695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066788030.1|1532691_1532874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066788032.1|1532904_1533369_-	hypothetical protein	NA	Q3HKY3	Bacillus_phage	42.0	3.2e-28
WP_158512588.1|1533422_1533560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066788034.1|1533578_1533785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066788036.1|1533781_1534159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066788043.1|1534161_1534974_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	33.2	1.7e-32
WP_066788047.1|1534918_1535716_-	conserved phage C-terminal domain-containing protein	NA	A0A2H4J2N5	uncultured_Caudovirales_phage	49.6	2.6e-25
WP_066788050.1|1535708_1536368_-	ORF6N domain-containing protein	NA	A0A0K2CNP0	Brevibacillus_phage	39.4	1.9e-34
WP_066788052.1|1536489_1536678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066788055.1|1536710_1536977_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066788058.1|1537096_1537798_+	hypothetical protein	NA	A6M973	Geobacillus_virus	41.1	1.2e-37
WP_066788061.1|1537889_1539695_+	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	28.0	1.1e-28
1542247:1542262	attR	TATAAACATAATTGAA	NA	NA	NA	NA
>prophage 6
NZ_CP014806	Rummeliibacillus stabekisii strain PP9 chromosome, complete genome	3412092	2443810	2451491	3412092		Bacillus_virus(33.33%)	8	NA	NA
WP_066790127.1|2443810_2444635_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	55.3	1.3e-72
WP_066790129.1|2444631_2446113_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	48.4	2.4e-117
WP_066790134.1|2446214_2446715_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	53.8	1.1e-21
WP_066790136.1|2446865_2447597_+	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.2	1.6e-21
WP_066790138.1|2447593_2448349_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_066790140.1|2448760_2449735_+	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	52.6	9.0e-89
WP_066790141.1|2449785_2450391_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_066791957.1|2450495_2451491_-	fatty acid desaturase	NA	A0A1V0SAL5	Catovirus	30.7	3.7e-29
>prophage 7
NZ_CP014806	Rummeliibacillus stabekisii strain PP9 chromosome, complete genome	3412092	2656318	2664789	3412092		Staphylococcus_phage(66.67%)	8	NA	NA
WP_066790508.1|2656318_2656789_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	63.4	1.2e-43
WP_066790509.1|2656804_2657995_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.8	2.9e-113
WP_066791998.1|2658012_2658651_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	41.0	2.5e-39
WP_066790512.1|2658661_2659747_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	37.7	3.5e-57
WP_149032026.1|2660720_2660867_-	lmo0937 family membrane protein	NA	NA	NA	NA	NA
WP_149032027.1|2661025_2661874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790518.1|2662164_2662374_-	copper chaperone CopZ	NA	A0A218MNH0	uncultured_virus	44.6	7.5e-09
WP_066790520.1|2662404_2664789_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.1	2.7e-126
>prophage 8
NZ_CP014806	Rummeliibacillus stabekisii strain PP9 chromosome, complete genome	3412092	2750040	2792436	3412092	terminase,holin,portal,coat,integrase,transposase,head,tail,plate	Deep-sea_thermophilic_phage(26.09%)	47	2744047:2744062	2780177:2780192
2744047:2744062	attL	GAATTACATCAAAGAA	NA	NA	NA	NA
WP_066790697.1|2750040_2752200_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_149032028.1|2752190_2753051_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_066790700.1|2755582_2756332_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_066790701.1|2756331_2757165_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_066790706.1|2757334_2759137_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	37.5	9.2e-95
WP_173668488.1|2759620_2760139_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_066790710.1|2760246_2761599_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_066790712.1|2761675_2762995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790714.1|2762994_2763837_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_066790719.1|2764068_2764689_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_066790721.1|2764702_2765266_-	RNA polymerase sigma factor SigW	NA	NA	NA	NA	NA
WP_066790722.1|2765622_2766525_-	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.3	3.2e-24
WP_066790724.1|2767580_2769023_-	hypothetical protein	NA	A0A090DBU6	Clostridium_phage	28.4	3.7e-46
WP_066790726.1|2769028_2769565_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A090D850	Clostridium_phage	37.4	7.8e-26
WP_066790731.1|2769577_2770087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158512607.1|2770372_2770516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066790733.1|2770752_2770938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066790735.1|2771003_2771792_-	N-acetylmuramoyl-L-alanine amidase	NA	Q8W5Y8	Listeria_phage	40.3	1.8e-23
WP_066790737.1|2771795_2772191_-|holin	phage holin family protein	holin	D0R0E9	Streptococcus_phage	28.1	2.3e-06
WP_066790739.1|2772290_2772542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790740.1|2772649_2773882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158512587.1|2773859_2774030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790742.1|2774022_2774871_-|tail	tail fiber domain-containing protein	tail	NA	NA	NA	NA
WP_066790743.1|2774882_2775521_-	DUF2612 domain-containing protein	NA	E5DV65	Deep-sea_thermophilic_phage	49.3	8.9e-53
WP_066790745.1|2775520_2776693_-|plate	baseplate J/gp47 family protein	plate	E5DV64	Deep-sea_thermophilic_phage	42.9	3.1e-83
WP_066790746.1|2776676_2777033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790748.1|2777029_2777410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790750.1|2777418_2778225_-	hypothetical protein	NA	A0A1L2JY62	Aeribacillus_phage	43.6	4.7e-59
WP_066790752.1|2778217_2778547_-	hypothetical protein	NA	E5DV60	Deep-sea_thermophilic_phage	61.7	5.0e-15
WP_066790754.1|2778546_2779128_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JD33	uncultured_Caudovirales_phage	39.6	6.1e-24
WP_066790756.1|2779129_2781568_-	hypothetical protein	NA	A0A223LI73	Staphylococcus_phage	29.9	2.6e-23
2780177:2780192	attR	TTCTTTGATGTAATTC	NA	NA	NA	NA
WP_066790758.1|2781765_2782056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790760.1|2782151_2782550_-	hypothetical protein	NA	A0A1L2K2P1	Aeribacillus_phage	53.4	6.0e-31
WP_066790763.1|2782604_2783615_-	DUF3383 family protein	NA	A0A1L2JZ70	Aeribacillus_phage	49.6	3.1e-84
WP_066790765.1|2783625_2784096_-	hypothetical protein	NA	A0A2H4J4R9	uncultured_Caudovirales_phage	31.9	1.3e-11
WP_066790767.1|2784088_2784430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790769.1|2784426_2784954_-	hypothetical protein	NA	A0A2H4J4S5	uncultured_Caudovirales_phage	44.0	1.4e-35
WP_066790772.1|2784946_2785270_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_066790773.1|2785253_2785481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790774.1|2785522_2786497_-|coat	coat protein	coat	A0A2P1JTX1	Anoxybacillus_phage	61.8	4.2e-110
WP_066790778.1|2786510_2787122_-	phage scaffolding protein	NA	I1TLE1	Bacillus_phage	52.0	1.3e-37
WP_066790780.1|2787234_2787453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790782.1|2787488_2788403_-	hypothetical protein	NA	E5DV54	Deep-sea_thermophilic_phage	39.2	1.4e-51
WP_066790785.1|2788403_2789810_-|portal	phage portal protein	portal	A0A0A8WFC0	Clostridium_phage	46.5	1.3e-101
WP_066790787.1|2789824_2791105_-|terminase	PBSX family phage terminase large subunit	terminase	E5DV50	Deep-sea_thermophilic_phage	74.2	4.1e-190
WP_066790789.1|2791097_2791985_-|terminase	terminase small subunit	terminase	E5DV49	Deep-sea_thermophilic_phage	50.7	1.2e-74
WP_066790792.1|2791968_2792436_-	DUF1064 domain-containing protein	NA	A0A2P1JUQ3	Bacillus_phage	45.1	4.3e-28
>prophage 9
NZ_CP014806	Rummeliibacillus stabekisii strain PP9 chromosome, complete genome	3412092	2795910	2809657	3412092	integrase	Bacillus_phage(15.38%)	22	2798163:2798177	2815498:2815512
WP_149032029.1|2795910_2796090_-	hypothetical protein	NA	A0A1B1P7M4	Bacillus_phage	51.1	9.3e-08
WP_158512609.1|2796255_2796408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790801.1|2796644_2796875_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	66.2	6.5e-22
WP_066790803.1|2796874_2797084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790805.1|2797080_2797569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084246970.1|2797581_2798442_-	ATP-binding protein	NA	A0A2D1GQF9	Lysinibacillus_phage	38.6	1.4e-40
2798163:2798177	attL	GGAATTTATCAAATG	NA	NA	NA	NA
WP_066790808.1|2798389_2799337_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	45.7	1.5e-51
WP_173668489.1|2799349_2799517_-	hypothetical protein	NA	A0A290G4G7	Caldibacillus_phage	65.2	1.9e-07
WP_066790810.1|2799520_2800327_-	recombination protein RecT	NA	S6AVW6	Thermus_phage	62.7	4.3e-84
WP_066790812.1|2800329_2801265_-	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	48.2	6.2e-79
WP_066790814.1|2801340_2801532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790816.1|2801818_2802085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790817.1|2802081_2802612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066790819.1|2802672_2802945_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066790820.1|2802979_2803783_-	phage antirepressor KilAC domain-containing protein	NA	A0A075KK42	Lactobacillus_phage	57.4	1.3e-77
WP_066792017.1|2804264_2804495_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066790822.1|2804657_2805143_+	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	38.8	7.1e-18
WP_066790823.1|2805154_2805571_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	48.6	3.3e-32
WP_066790825.1|2805607_2806333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066790827.1|2806589_2807147_+	DUF4352 domain-containing protein	NA	E5DV69	Deep-sea_thermophilic_phage	37.6	4.6e-05
WP_149032032.1|2807154_2808150_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	51.4	8.7e-87
WP_066790829.1|2808427_2809657_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	32.6	7.7e-53
2815498:2815512	attR	GGAATTTATCAAATG	NA	NA	NA	NA
