The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012985	Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437, complete genome	4958254	305730	406646	4958254	integrase,coat,portal,lysis,transposase,protease,terminase,plate	Enterobacteria_phage(76.81%)	123	352468:352484	415237:415253
WP_000145244.1|305730_306726_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000371508.1|306722_308606_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000108007.1|308621_309116_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000750535.1|309112_309937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000806681.1|309923_310826_-	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_000449778.1|311193_313833_+	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	34.5	1.1e-77
WP_000996817.1|313932_314475_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000013881.1|314498_316007_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_010988967.1|316069_316180_+	invasol SirA	NA	NA	NA	NA	NA
WP_014344502.1|316306_316639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312802.1|316892_317378_+	type VI secretion system effector	NA	NA	NA	NA	NA
WP_001541860.1|317397_317553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081550.1|317682_318168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379146.1|318152_318536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050196397.1|318678_319164_+	Hcp1 family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001007106.1|319230_319767_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000118732.1|319770_321114_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000132483.1|321110_322415_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_000976553.1|322419_323193_+	membrane protein	NA	NA	NA	NA	NA
WP_071526812.1|323199_323427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227044.1|323395_323827_+	Shiga toxin A subunit	NA	NA	NA	NA	NA
WP_001168956.1|323860_327730_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001254137.1|327729_328518_+	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_001596567.1|328514_328931_+	DUF2195 domain-containing protein	NA	NA	NA	NA	NA
WP_000968384.1|328954_329476_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_001751266.1|329617_329827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000011534.1|329872_332062_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_000375832.1|332085_332532_+	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_000935097.1|334547_334994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742610.1|335556_335994_+	SciY protein	NA	NA	NA	NA	NA
WP_000994224.1|336046_336322_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_010988969.1|336762_337071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001738030.1|337172_337421_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_001224073.1|337473_337671_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_010988970.1|338927_339440_+	Saf-pilin pilus formation protein SafA	NA	NA	NA	NA	NA
WP_001535430.1|339523_340261_+	pili assembly chaperone protein SafB	NA	NA	NA	NA	NA
WP_000669634.1|340284_342795_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000266939.1|342816_343287_+	pilin structural protein SafD	NA	NA	NA	NA	NA
WP_000119390.1|343692_344514_+	carbohydrate transporter	NA	NA	NA	NA	NA
WP_001550229.1|344593_344854_+	transcriptional activator PerC	NA	NA	NA	NA	NA
WP_022742611.1|345328_346276_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001575654.1|346392_346608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000787603.1|346611_347331_-	outer membrane protein PagN	NA	NA	NA	NA	NA
WP_000788200.1|347661_348069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000015789.1|348439_349207_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000973041.1|349315_351760_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000284051.1|351999_352578_+	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
352468:352484	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_000333387.1|352790_353558_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225658.1|353528_354269_-	transpeptidase	NA	NA	NA	NA	NA
WP_001226198.1|354518_355574_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000602086.1|356921_357536_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292977.1|357691_359149_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001292018.1|359397_359856_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189588.1|359944_361189_+	esterase	NA	NA	NA	NA	NA
WP_000174696.1|361246_361648_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_001043675.1|361698_362751_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|363033_364137_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|364148_365399_+	gamma-glutamyl-phosphate reductase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_000051897.1|365604_366768_-|integrase	phage integrase family protein	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_000002104.1|367206_367491_-	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_000371199.1|367483_367768_-	DUF4752 domain-containing protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_025617570.1|367767_368412_-	hypothetical protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_071533029.1|368398_368632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000812203.1|368628_369138_-	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_001214777.1|369134_369305_-	DUF2737 domain-containing protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_001111291.1|369315_369609_-	hypothetical protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001253476.1|369655_369940_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001046968.1|369939_370647_-	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_000156731.1|370776_370965_-	hypothetical protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000141641.1|370945_371104_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000776963.1|371188_371503_-	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000713613.1|371778_372066_-	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_015974224.1|372099_372744_-	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	6.5e-51
WP_000213982.1|372827_373022_-	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_001066179.1|373235_373823_+	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000216178.1|373835_374138_-	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_071533030.1|374157_374355_+	hypothetical protein	NA	A0A075B8J1	Enterobacteria_phage	97.1	1.5e-11
WP_000834175.1|374501_374705_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_001532928.1|374743_375823_-	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000712403.1|375987_376677_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000182204.1|376787_377003_+	transcriptional regulator	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|377113_377395_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000539342.1|377577_378399_+	hypothetical protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_001248410.1|378395_379772_+	DNA helicase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_001036030.1|379768_380038_+	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_000736891.1|380111_380549_+	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_000679703.1|380545_380719_+	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000113770.1|380685_380862_+	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_001532927.1|380864_381206_+	protein ninX	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000950963.1|381198_381375_+	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001108073.1|381367_381979_+	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000036320.1|381975_382200_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_000149882.1|382196_382400_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000219133.1|382380_382560_+	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_001047566.1|382556_383330_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_071533031.1|383442_383676_+	hypothetical protein	NA	M1E3N9	Enterobacteria_phage	87.0	1.1e-21
WP_000286100.1|383760_383964_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_024136257.1|383941_384439_+	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_001687043.1|384435_384903_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_071533034.1|384937_385162_+	hypothetical protein	NA	A0A1V0E5I0	Salmonella_phage	88.7	3.6e-25
WP_000877028.1|385115_385646_+	hypothetical protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_000808099.1|385868_386111_+	hypothetical protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|386114_386504_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_001687044.1|386503_386908_+	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_000729923.1|386911_387400_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_000417860.1|387377_388877_+|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000774652.1|388876_391054_+|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000433855.1|391067_391979_+	scaffold protein	NA	Q76H22	Enterobacteria_phage	100.0	1.5e-162
WP_001196937.1|391978_393271_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000538670.1|393311_393872_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001166103.1|393855_394356_+	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_001122420.1|394315_395734_+	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_000774917.1|395737_396439_+	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_000627593.1|396438_396894_+	hypothetical protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000964904.1|396896_397586_+	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000246977.1|397596_399033_+	DNA transfer protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_001029860.1|399032_401009_+	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_015974226.1|401141_401441_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	5.1e-51
WP_000532177.1|401461_401710_-	hypothetical protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_000129933.1|401845_403849_+	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000671496.1|403907_405365_-	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000703639.1|405354_406287_-	glycosyltransferase	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|406283_406646_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
415237:415253	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 2
NZ_CP012985	Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437, complete genome	4958254	999338	1006352	4958254	protease,transposase	Dickeya_phage(16.67%)	8	NA	NA
WP_001201751.1|999338_1000457_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1000453_1002400_+	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_071524039.1|1002380_1002575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000447499.1|1002529_1002751_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1003074_1003395_+|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1003425_1005702_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001542475.1|1005748_1005937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|1005893_1006352_+|transposase	IS200/IS605 family transposase IS200F	transposase	A0A0A8WIU6	Clostridium_phage	34.1	1.4e-12
>prophage 3
NZ_CP012985	Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437, complete genome	4958254	1044786	1156941	4958254	holin,integrase,tRNA,portal,lysis,protease,tail	Salmonella_phage(41.38%)	113	1061041:1061060	1132829:1132848
WP_000792312.1|1044786_1045548_+|protease	metalloprotease	protease	NA	NA	NA	NA
WP_000125006.1|1045720_1046404_+	cytidylate kinase	NA	NA	NA	NA	NA
WP_000140324.1|1046517_1048191_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167332.1|1048346_1048631_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
WP_022742648.1|1048860_1051125_+	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	22.5	8.8e-10
WP_000551246.1|1051161_1052910_+	lipid A export ATP-binding/permease MsbA	NA	W8CYL7	Bacillus_phage	30.5	3.2e-60
WP_000561681.1|1052906_1053884_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056911.1|1053927_1055160_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350061.1|1055211_1055394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000011576.1|1055390_1056137_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436889.1|1056347_1057241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000899563.1|1057220_1057997_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001154025.1|1058132_1058936_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1058928_1060251_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1060231_1060936_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_022742649.1|1060935_1065402_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1061041:1061060	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1065746_1067588_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1067847_1068396_+	DUF882 domain-containing protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1068423_1069071_+	MBL fold hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1069132_1070323_-	aspartate aminotransferase	NA	NA	NA	NA	NA
WP_000977713.1|1070507_1071599_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1072205_1073606_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1073806_1074268_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301921.1|1074264_1074498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000544849.1|1074584_1075799_+	PLP-dependent lyase/thiolase	NA	NA	NA	NA	NA
WP_000191399.1|1077556_1078759_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001526473.1|1078953_1080294_-|integrase	integrase	integrase	S4TSP2	Salmonella_phage	99.6	3.6e-261
WP_000065276.1|1080290_1080539_-	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1080579_1080819_-	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1080861_1082019_-	enterohemolysin	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_063503113.1|1081981_1084867_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	97.5	0.0e+00
WP_001668146.1|1084993_1085293_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1085314_1085473_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_010989002.1|1085465_1085726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1085775_1086186_-	transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1086305_1086545_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1086510_1086885_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1086969_1087953_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1087955_1088705_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1088715_1089063_+	DNA-binding protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1089059_1089371_+	hypothetical protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1089448_1089739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1090030_1090264_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1090375_1090597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001241019.1|1091281_1091488_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_001096552.1|1091490_1092102_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1092098_1092245_+	hypothetical protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_022742653.1|1092234_1093032_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	5.2e-151
WP_010989004.1|1093098_1093416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1093589_1093715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1093850_1094300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1094660_1095347_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1095622_1095952_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1095935_1096388_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1096405_1096885_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1097092_1097626_+	DNA breaking-rejoining protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1097582_1099721_+	DNA packaging protein	NA	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1099717_1099924_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_077679777.1|1099950_1101468_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_010989008.1|1101391_1103473_+	peptidase S14	NA	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1103563_1103887_+	recombinase RecA	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1103879_1104179_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1104159_1104726_+|tail	tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1104722_1105124_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1105135_1105885_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1105930_1106329_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1106325_1106655_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1106734_1109722_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1109718_1110051_+|tail	tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1110149_1110647_+	Ail/OmpX	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1110763_1111297_-	superoxide dismutase [Cu-Zn] SodC1	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_022742655.1|1111386_1112082_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.2	6.5e-89
WP_000246065.1|1112726_1113431_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_077907871.1|1115348_1116854_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	63.9	6.9e-120
WP_000178849.1|1116892_1117135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742660.1|1117188_1119627_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	1.7e-91
WP_022742661.1|1119626_1120208_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.5	3.3e-94
WP_001533476.1|1120683_1121652_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1122299_1122926_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1122994_1123294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1123278_1123965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1124235_1124427_-	DNA-damage-inducible protein I	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1124853_1127466_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_022742665.1|1127673_1128684_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1128849_1129392_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1129388_1130498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086485.1|1130596_1132705_+	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
WP_000053044.1|1132717_1134625_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1132829:1132848	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1134639_1135893_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_000433414.1|1135897_1137538_+	paraquat-inducible protein B	NA	NA	NA	NA	NA
WP_000759136.1|1137534_1138098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001537784.1|1138353_1138521_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1138620_1139139_-	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_000156454.1|1139207_1140968_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1141153_1141606_+	macrodomain Ter protein	NA	NA	NA	NA	NA
WP_001674965.1|1141677_1142730_-	outer membrane protein A	NA	NA	NA	NA	NA
WP_000288732.1|1143086_1143596_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1143812_1144418_+	DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1144404_1146558_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1146576_1147023_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1147146_1149201_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1149236_1149695_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1149789_1150452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000975203.1|1150622_1151039_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1151083_1151401_-	heat-shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1151458_1152670_-	ribosomal RNA large subunit methyltransferase I	NA	NA	NA	NA	NA
WP_000859419.1|1152884_1153433_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1153458_1154238_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1154286_1154568_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1154564_1154894_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1154980_1155640_-	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_071531552.1|1155705_1155915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000938191.1|1156260_1156941_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP012985	Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437, complete genome	4958254	1920802	1997662	4958254	integrase,head,tail,protease,lysis,transposase,terminase	Salmonella_phage(15.79%)	108	1953564:1953578	1995502:1995516
WP_000984498.1|1920802_1921684_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|1921877_1923926_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|1923945_1924632_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_000145727.1|1924729_1925314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001207294.1|1925355_1926639_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_000551143.1|1926601_1929241_+	MCE family protein	NA	NA	NA	NA	NA
WP_001542138.1|1929318_1930758_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_000978525.1|1930872_1931112_+	DUF1480 domain-containing protein	NA	NA	NA	NA	NA
WP_000457836.1|1931222_1931414_+	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_000986176.1|1931432_1932083_-	serine/threonine-protein phosphatase 1	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_001134856.1|1932306_1932471_-	membrane protein	NA	NA	NA	NA	NA
WP_000182072.1|1932755_1933478_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_022742706.1|1934161_1934557_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.0	6.0e-15
WP_000030934.1|1934886_1935363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354408.1|1935750_1936170_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_001526544.1|1936298_1936493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001752421.1|1936539_1936809_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_001617922.1|1936974_1937115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000684835.1|1938578_1938947_+|integrase	integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
WP_050956126.1|1938884_1939142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531557.1|1939432_1939633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233446.1|1940250_1941165_+	protein PagO	NA	NA	NA	NA	NA
WP_000480735.1|1941297_1941456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|1941465_1942080_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_014344507.1|1942406_1942532_-	putative cytoplasmic protein	NA	S4TTF2	Salmonella_phage	89.5	4.3e-12
WP_071590377.1|1942832_1943099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|1943227_1943353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520426.1|1943615_1943732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989029.1|1943922_1944123_+	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000275418.1|1944219_1945101_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_000348546.1|1945255_1945519_-	DUF1441 domain-containing protein	NA	Q9EYD0	Enterobacteria_phage	59.8	9.1e-20
WP_001521334.1|1945573_1945762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1945826_1945994_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1946250_1946784_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001709685.1|1946837_1947125_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	9.9e-28
WP_010989030.1|1947257_1947752_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001173880.1|1947769_1948666_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.3	6.6e-78
WP_022742707.1|1949573_1950716_+	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_022742708.1|1950978_1951878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742709.1|1952338_1952995_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024150649.1|1952995_1953691_-	hypothetical protein	NA	NA	NA	NA	NA
1953564:1953578	attL	GCATTAATGCCAACT	NA	NA	NA	NA
WP_022742711.1|1954073_1954649_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	2.9e-95
WP_022742712.1|1954648_1956100_-	hypothetical protein	NA	E5G6P0	Salmonella_phage	71.2	2.9e-43
WP_022742713.1|1956089_1956692_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
WP_022742714.1|1956693_1957935_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.6	4.5e-101
WP_001191865.1|1957931_1958288_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_022742715.1|1958300_1958978_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	35.5	4.6e-31
WP_000122818.1|1958958_1959828_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000890115.1|1959824_1960127_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_022742716.1|1960126_1960837_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
WP_022742717.1|1960833_1963005_-	transglycosylase	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_000228831.1|1962988_1963171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101348.1|1963212_1963617_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000016414.1|1963616_1964063_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_001748488.1|1964063_1965548_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	4.0e-96
WP_000094504.1|1965528_1966074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748490.1|1966058_1966424_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
WP_022742718.1|1966420_1967005_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
WP_023139348.1|1966998_1967454_-	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	46.0	1.2e-19
WP_001748493.1|1967460_1967808_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
WP_001031915.1|1967811_1968840_-	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_001525451.1|1968839_1969322_-	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
WP_023139349.1|1969323_1970670_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
WP_000552017.1|1970666_1971356_-|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_023139350.1|1971396_1972917_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	7.5e-106
WP_022742723.1|1972916_1974338_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.8e-186
WP_022742724.1|1974303_1975056_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	75.6	5.3e-12
WP_001113128.1|1975126_1975309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139351.1|1975534_1975999_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	81.5	1.6e-56
WP_001208103.1|1975995_1976484_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	2.1e-57
WP_001526513.1|1976461_1976764_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000502119.1|1976930_1977389_-|transposase	IS200/IS605 family transposase IS200F	transposase	A0A0A8WIU6	Clostridium_phage	34.1	1.4e-12
WP_001542475.1|1977345_1977534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139352.1|1978202_1978409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071590376.1|1978525_1978753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139353.1|1978886_1979816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742728.1|1979802_1980333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139354.1|1980364_1980706_-	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.1e-54
WP_023139355.1|1981045_1981357_-	hypothetical protein	NA	K7P7Q1	Enterobacteria_phage	84.8	6.1e-39
WP_021000145.1|1981353_1981548_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_022742730.1|1981544_1982144_-	DUF1367 domain-containing protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
WP_023139356.1|1982207_1982456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024150652.1|1982705_1982858_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_023139357.1|1983064_1983337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742732.1|1983333_1983729_-	DUF977 domain-containing protein	NA	A0A088CBK9	Shigella_phage	37.0	6.4e-17
WP_000140163.1|1983741_1984203_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.8e-67
WP_022742734.1|1984195_1985203_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	1.8e-124
WP_001534383.1|1985246_1985741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033911.1|1985727_1985982_-	XRE family transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001574209.1|1986080_1986479_+	transcriptional regulator	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_000783771.1|1986776_1986965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024135672.1|1986909_1987089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103933.1|1987349_1987625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|1987628_1987835_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000799627.1|1987910_1988246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742735.1|1988386_1991077_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
WP_001534364.1|1991069_1991900_+	DNA recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033921.1|1991935_1992256_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_023139358.1|1992248_1992581_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	72.7	8.5e-15
WP_023139359.1|1993191_1993371_+	hypothetical protein	NA	A0A0U2QL97	Escherichia_phage	60.3	7.3e-13
WP_077907869.1|1993661_1993898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001575998.1|1993958_1994237_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_022742740.1|1994211_1995291_+|integrase	integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
WP_010989031.1|1995496_1995616_-	hypothetical protein	NA	NA	NA	NA	NA
1995502:1995516	attR	AGTTGGCATTAATGC	NA	NA	NA	NA
WP_000722368.1|1995673_1996027_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000979702.1|1996043_1996919_-	membrane protein	NA	NA	NA	NA	NA
WP_000168393.1|1996919_1997294_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1997431_1997662_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP012985	Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437, complete genome	4958254	2073112	2151772	4958254	holin,integrase,head,tail,transposase,capsid,protease,portal,terminase,plate	Salmonella_phage(80.88%)	107	2079650:2079665	2153395:2153410
WP_000502119.1|2073112_2073571_-|transposase	IS200/IS605 family transposase IS200F	transposase	A0A0A8WIU6	Clostridium_phage	34.1	1.4e-12
WP_001542475.1|2073527_2073716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000659236.1|2073751_2074957_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079806.1|2075035_2076523_-	flagellin FliC	NA	NA	NA	NA	NA
WP_000146802.1|2076779_2078183_+	flagellar hook-associated protein 2	NA	NA	NA	NA	NA
WP_000287764.1|2078197_2078605_+	flagellar protein FliS	NA	NA	NA	NA	NA
WP_000204899.1|2078604_2078973_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2079044_2080529_+	alpha-amylase	NA	NA	NA	NA	NA
2079650:2079665	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2080568_2080994_-	lipoprotein	NA	NA	NA	NA	NA
WP_000580669.1|2081119_2082385_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000790504.1|2082381_2082615_+	SirA-like protein	NA	NA	NA	NA	NA
WP_000639596.1|2082879_2083266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2083385_2083700_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2083916_2085599_+	flagellar M-ring protein	NA	NA	NA	NA	NA
WP_000067735.1|2085591_2086587_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2086579_2087287_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2087286_2088657_+	flagellum-specific ATP synthase	NA	NA	NA	NA	NA
WP_000046981.1|2088678_2089122_+	flagellar protein FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2089118_2090336_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2090440_2090908_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2090912_2091917_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2091913_2092327_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2092326_2092704_+	flagellar protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2092703_2093441_+	flagellar biosynthetic protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2093450_2093720_+	flagellar biosynthetic protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2093728_2094523_+	flagellar biosynthesis protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2094804_2095428_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000978758.1|2095466_2095664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000844798.1|2095789_2096017_+	DUF2525 domain-containing protein	NA	NA	NA	NA	NA
WP_000948794.1|2096326_2097142_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2097120_2098833_-	cellulose synthesis regulatory protein	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2098997_2099243_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000929134.1|2099259_2100171_-	membrane protein	NA	NA	NA	NA	NA
WP_001212264.1|2100346_2101267_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2101255_2101726_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2101706_2103137_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2103210_2103906_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2103997_2104297_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2104946_2106143_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2106403_2106592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2106602_2106815_-	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2107269_2108538_-	protein UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2108540_2108960_-	protein UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2109086_2109248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343854.1|2109225_2109468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2110441_2110654_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2110650_2111064_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_000836773.1|2111299_2111533_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_000760502.1|2111646_2112222_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.5e-107
WP_020899405.1|2112221_2113784_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_001207832.1|2113770_2114358_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|2114360_2115440_-	hypothetical protein	NA	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|2115432_2115846_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2115850_2116384_-|plate	phage baseplate assembly protein V	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066630.1|2116383_2117442_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|2117438_2118779_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_000785390.1|2118812_2120741_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_000588854.1|2120825_2121152_-|tail	phage tail assembly protein	tail	A0A192Y6C5	Salmonella_phage	100.0	1.3e-52
WP_000515952.1|2121148_2121505_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007996.1|2121504_2123001_-|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000497740.1|2122990_2123155_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_000779216.1|2123158_2123719_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_001135699.1|2123715_2124228_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000702410.1|2124199_2124604_-|head,tail	head-tail adaptor protein	head,tail	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2124600_2124924_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601352.1|2124926_2125127_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000257526.1|2125177_2126383_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_001193639.1|2126397_2127048_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_020899404.1|2127025_2128267_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_000605609.1|2128266_2128449_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088175.1|2128460_2130194_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000929171.1|2130190_2130685_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_001135098.1|2130810_2131161_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2131211_2131544_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2132006_2132399_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2132395_2133010_-	lytic enzyme	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2133009_2133291_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2133277_2133664_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2133809_2134067_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2134217_2134970_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_020899400.1|2134983_2135973_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899399.1|2135980_2136841_-	hypothetical protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_001241579.1|2136857_2137247_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2137243_2138137_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2138136_2138619_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2138620_2139439_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2139435_2139660_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2139656_2140814_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2140810_2141365_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2141393_2141618_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071529734.1|2141556_2141742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020636.1|2141715_2142411_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2142616_2142955_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_071961451.1|2142917_2143334_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	6.4e-76
WP_071961452.1|2143398_2143584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997191.1|2143681_2144053_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2144110_2144938_+	DUF2303 domain-containing protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2145074_2145614_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2145684_2146218_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2146219_2146477_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2146487_2147069_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2147072_2147642_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2147666_2147909_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2147910_2148900_+|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2149191_2149989_+	protein MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2150360_2150651_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2151298_2151772_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2153395:2153410	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP012985	Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437, complete genome	4958254	2238477	2248983	4958254		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2238477_2239791_-	LPS biosynthesis protein	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2239817_2240897_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2240901_2241675_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2241671_2242664_-	protein RfbI	NA	NA	NA	NA	NA
WP_000973708.1|2242669_2243221_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2243221_2244100_-	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2244147_2245047_-	NAD(P)-dependent oxidoreductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2245046_2246132_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2246508_2247402_-	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2247579_2248983_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP012985	Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437, complete genome	4958254	2317291	2326462	4958254	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2317291_2319325_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2319565_2320024_+	lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2320195_2320726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950413.1|2320782_2321250_-	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2321296_2322016_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_000272845.1|2322012_2323698_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2323920_2324652_+	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2324711_2324819_+	membrane protein	NA	NA	NA	NA	NA
WP_000824855.1|2324799_2325531_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2325514_2326462_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_CP012985	Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437, complete genome	4958254	2398345	2412096	4958254	protease,holin,head,tail	Salmonella_phage(38.46%)	14	NA	NA
WP_000806401.1|2398345_2398849_-	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2398876_2399167_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2399514_2401344_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2401397_2401841_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2402218_2402746_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2402748_2403990_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_000003792.1|2404050_2404569_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	88.0	5.2e-75
WP_001120499.1|2404582_2404912_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2405208_2406540_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2406568_2406937_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2406951_2407941_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2408269_2410636_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2410804_2411008_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2411304_2412096_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP012985	Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437, complete genome	4958254	2751681	2857272	4958254	holin,integrase,tRNA,portal,head,capsid,tail,lysis,terminase	Salmonella_phage(33.9%)	111	2843931:2843990	2865688:2866164
WP_000940032.1|2751681_2752413_-|tRNA	tRNA (cytidine/uridine-2'-O-)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2752531_2753335_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2753479_2754358_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2754539_2755583_+	sulfite reductase subunit alpha	NA	NA	NA	NA	NA
WP_000017587.1|2755586_2756405_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2756415_2757429_+	anaerobic sulfite reductase subunit AsrC	NA	NA	NA	NA	NA
WP_000111027.1|2757429_2758416_-	nickel transporter	NA	NA	NA	NA	NA
WP_000805728.1|2758406_2759045_-	DUF1007 domain-containing protein	NA	NA	NA	NA	NA
WP_000982961.1|2759170_2760448_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2760442_2761582_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2761777_2763031_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2763355_2764546_+	flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2764727_2766272_+	transcriptional regulator CadC	NA	NA	NA	NA	NA
WP_000100008.1|2766632_2767964_+	arginine:agmatine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2768046_2770191_+	lysine decarboxylase inducible	NA	NA	NA	NA	NA
WP_000856793.1|2770246_2771707_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2771755_2772094_-	nitrogen regulatory protein P-II 1	NA	NA	NA	NA	NA
WP_000625591.1|2772170_2773508_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2773504_2774269_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001542313.1|2774270_2775656_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	1.9e-15
WP_000970045.1|2776350_2780238_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2780259_2780493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2780493_2782038_+	lytic transglycosylase F	NA	NA	NA	NA	NA
WP_001134566.1|2782088_2782640_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2782664_2783300_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2783303_2784665_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001048530.1|2784675_2785569_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2785684_2786533_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_063503120.1|2786571_2787489_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_001276365.1|2787510_2788707_-	MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2788822_2789749_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2789786_2790047_+	ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2790158_2790539_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2790538_2791270_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2791281_2792010_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2792021_2792927_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2792923_2793604_-	ribonuclease 3	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2793877_2794852_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_000790154.1|2794868_2796668_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2797072_2798566_+	type III secretion system protein	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2799074_2799212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989048.1|2799458_2800004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015701342.1|2800668_2800734_-	bacteriophage protein	NA	NA	NA	NA	NA
WP_001738443.1|2800796_2801009_-	hypothetical protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2801115_2801343_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2801439_2802018_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2802007_2802832_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_022742779.1|2802828_2805201_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	65.4	2.0e-89
WP_000178853.1|2805254_2805497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2805535_2808898_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2808959_2809607_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2809504_2810242_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2810248_2810947_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2810956_2811286_-|tail	tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_022742781.1|2811288_2814384_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.1e-276
WP_010989052.1|2814355_2814694_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2814690_2815086_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971953.1|2815136_2815883_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_022742782.1|2815890_2816292_-	hypothetical protein	NA	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
WP_000677089.1|2816288_2816867_-|tail	tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|2816853_2817231_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201485.1|2817241_2817607_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_022742784.1|2817664_2818693_-|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.3e-114
WP_000011260.1|2818747_2819095_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189498.1|2819107_2820604_-	scaffold protein	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
WP_000831821.1|2820593_2822174_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2822170_2822374_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623088.1|2822357_2824289_-|terminase	terminase	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_001102153.1|2824260_2824806_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669689.1|2825091_2825493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603581.1|2825749_2826253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050955063.1|2826580_2827027_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	9.3e-57
WP_022742788.1|2827059_2827674_-	phage encoded lysozyme	NA	Q8HA86	Salmonella_phage	93.6	2.2e-109
WP_021000643.1|2827673_2827955_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294873.1|2827941_2828331_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_023221874.1|2828420_2828609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071786602.1|2828663_2828855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024150660.1|2829135_2829561_-	subtilase	NA	NA	NA	NA	NA
WP_022742790.1|2829693_2830419_-	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	66.2	4.0e-81
WP_022742791.1|2830619_2831198_-	DUF1133 domain-containing protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.1e-49
WP_050196634.1|2831212_2832202_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	3.5e-189
WP_024150661.1|2832209_2833070_-	hypothetical protein	NA	Q8HA92	Salmonella_phage	99.3	9.2e-162
WP_000767086.1|2833086_2833476_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_024150662.1|2834364_2834847_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	1.8e-85
WP_022742797.1|2834848_2835808_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.2e-117
WP_000620702.1|2835804_2836029_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_031609052.1|2836025_2837168_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	98.2	1.0e-208
WP_023139406.1|2837164_2837719_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	1.2e-101
WP_001191666.1|2837747_2837972_-	XRE family transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_071529734.1|2837910_2838096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020640.1|2838069_2838765_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000917563.1|2839118_2839277_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_022742800.1|2839298_2839649_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_063503121.1|2839775_2842703_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	96.8	0.0e+00
WP_001237031.1|2843866_2844106_+	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
2843931:2843990	attL	CGGCGCATCATGAAAAGTTCGGCGATTACGGCAGACAAAAGCACGTTACCAATTACACCG	NA	NA	NA	NA
WP_001670787.1|2844146_2844431_+	excisionase	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_022742803.1|2844408_2845638_-|integrase	integrase	integrase	H6WRW7	Salmonella_phage	93.9	5.4e-232
WP_012218543.1|2845989_2846106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000589087.1|2846135_2846615_-	SoxR reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2846611_2847568_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2847567_2848218_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2848249_2848825_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001521719.1|2848985_2849165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742804.1|2849249_2850872_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2850856_2851594_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000219174.1|2851724_2853059_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2853076_2853976_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2854078_2854666_+	cysteine/O-acetylserine efflux protein	NA	NA	NA	NA	NA
WP_000627811.1|2854727_2855111_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2855429_2856119_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2856234_2857272_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2865688:2866164	attR	CGGCGCATCATGAAAAGTTCGGCGATTACGGCAGACAAAAGCACGTTACCAATTACACCGTTGTAGTGGATGGCGTAAAGGTGCCTGTTGAAGTAGTTAACCGGGCCACCAGCTACGTAGCCACCGCAATGATCGGCGTCCGGAAACTTAGAAATCTGCCAGCACAGGCAAACTGAATATTAGCGATGGCCCGCTGCGGGGCCACTGGAGAAAACGATGAGCAAAAAAATTAGAGACTTTGAATTGATGAGCACCCGCGAAATTTGCTGCCAGCTCAGGATTTCTTCCAGGACGCTGGAGCGTTACCGTAAGCGACCAAGCGACAACAACCCATTCCCGGAGCCTGACTGTTCATATATGGGTGGCTCCAACAAATGGCTTAAAACCAAAGTCAATGAGTGGCAGGTCAGGGAAATGTCACGACCAACACGCCGTCCAATGTCGCATCTGAATCTGCCCCGTGACAACAAAGGTCGG	NA	NA	NA	NA
>prophage 10
NZ_CP012985	Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437, complete genome	4958254	4001335	4015325	4958254	integrase	Enterobacteria_phage(88.89%)	15	4001153:4001174	4012776:4012797
4001153:4001174	attL	GACTCCTGTGATCTTCCGCCAA	NA	NA	NA	NA
WP_001697482.1|4001335_4002526_+|integrase	integrase	integrase	Q7M297	Enterobacteria_phage	85.0	1.8e-195
WP_001697485.1|4002518_4004615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001697486.1|4004616_4005270_+	DUF2290 domain-containing protein	NA	NA	NA	NA	NA
WP_000446132.1|4005474_4006047_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638636.1|4006120_4006621_-	transactivation protein	NA	NA	NA	NA	NA
WP_061352225.1|4006617_4007352_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	2.3e-129
WP_071977969.1|4007730_4007949_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001149156.1|4007903_4008170_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	98.9	6.3e-45
WP_061352226.1|4008166_4008757_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	97.8	7.0e-68
WP_061352227.1|4008749_4009037_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000459294.1|4009029_4009485_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4009620_4009941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063503125.1|4009955_4012289_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_000120776.1|4013112_4013457_-	hypothetical protein	NA	NA	NA	NA	NA
4012776:4012797	attR	GACTCCTGTGATCTTCCGCCAA	NA	NA	NA	NA
WP_001541628.1|4014134_4015325_+	ATP-binding protein	NA	C7BGE8	Burkholderia_phage	34.3	1.2e-10
>prophage 11
NZ_CP012985	Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437, complete genome	4958254	4519447	4539866	4958254	plate,tail	Burkholderia_phage(47.37%)	25	NA	NA
WP_000587738.1|4519447_4520176_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4520372_4520663_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4520911_4521367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4521363_4521969_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4521973_4523719_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4523721_4524354_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4524346_4525462_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4525452_4525812_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4525975_4527523_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4527522_4528452_-	glycosyltransferase	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4528448_4528811_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4529138_4529861_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4529870_4530914_-	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4530901_4531111_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_001262499.1|4532062_4534417_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4534513_4534642_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4534601_4534919_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4534970_4535495_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4535494_4536922_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4536911_4537109_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4537105_4537561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4537720_4538035_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4538047_4538653_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4538655_4538943_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4539518_4539866_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP014577	Salmonella enterica subsp. enterica serovar Typhimurium strain RM9437 plasmid pRM9437, complete sequence	93930	40862	50158	93930		Escherichia_phage(28.57%)	10	NA	NA
WP_001541564.1|40862_41279_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|41462_41798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728917.1|42452_43394_-	hypothetical protein	NA	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|43808_45014_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_001541561.1|45010_45988_+	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_022743179.1|46069_47344_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.9	3.9e-156
WP_000925627.1|47343_47766_-	protein SamA	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|48276_48747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|48739_49096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|49477_50158_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
