The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015138	Escherichia coli strain Ecol_732 chromosome, complete genome	5009900	6480	45982	5009900	transposase,capsid,tail,plate,integrase	Burkholderia_virus(45.0%)	57	NA	NA
WP_001281701.1|6480_6870_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_001170114.1|6841_7291_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_000206212.1|7292_7499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|7488_7719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|7715_8399_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763554.1|8395_8611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|8625_8922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|8931_9204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|9492_10023_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|10050_10320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|10322_11489_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000186588.1|11499_13269_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_001095645.1|13284_13602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533817.1|13601_14522_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000047759.1|14532_14841_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|14893_15082_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|15175_15532_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|15648_16413_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|16603_16819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|16817_17222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194951.1|17197_17926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|18056_18407_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|18409_19150_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264665.1|19133_19784_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_000175099.1|19780_20107_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000227701.1|20106_20418_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|20417_20963_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
WP_001295924.1|21022_22555_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
WP_000090684.1|22554_24051_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000117548.1|24031_24853_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|24855_25314_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|25528_26644_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|26658_27612_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|27621_27960_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|27961_28408_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|28407_28872_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|28868_29123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|29112_30540_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000034294.1|30539_31061_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110114.1|31063_31345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|31442_31778_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|31701_31860_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000016538.1|31935_34887_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_000458387.1|34886_35771_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|35767_35983_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808007.1|35970_37125_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000148266.1|37121_37718_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000859111.1|37772_38120_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219098.1|38110_39214_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000138756.1|39206_39785_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_000527461.1|39787_41119_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.8e-40
WP_000072165.1|41118_41733_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|41739_42201_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_064767240.1|42211_42652_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_000904922.1|42711_43284_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000445240.1|43539_44823_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|44893_45982_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
>prophage 2
NZ_CP015138	Escherichia coli strain Ecol_732 chromosome, complete genome	5009900	1102262	1155720	5009900	transposase	Stx2-converting_phage(20.0%)	47	NA	NA
WP_000343765.1|1102262_1103483_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_001295734.1|1105164_1105881_+	N-acetylneuraminic acid outer membrane channel NanC	NA	NA	NA	NA	NA
WP_001295733.1|1105900_1107007_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_000991462.1|1107070_1108051_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	H6WZJ9	Escherichia_phage	57.2	4.7e-101
WP_001363826.1|1108633_1109677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949154.1|1109760_1110908_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000788354.1|1111070_1111325_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_000366620.1|1112428_1114504_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	33.8	7.7e-37
WP_000504875.1|1114496_1115783_+	McrC family protein	NA	NA	NA	NA	NA
WP_000781649.1|1115892_1117632_+	Alw26I/Eco31I/Esp3I family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_001295727.1|1117644_1118835_-	DNA cytosine methyltransferase	NA	Q02778	Bacillus_phage	31.0	7.3e-16
WP_001332039.1|1118827_1120468_-	Alw26I/Eco31I/Esp3I family type II restriction adenine-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_001298859.1|1122057_1123599_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1123613_1124360_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000839286.1|1124625_1124802_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761690.1|1124818_1125307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854759.1|1125303_1125681_-	toxin	NA	NA	NA	NA	NA
WP_001295723.1|1125770_1126139_-	antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|1126301_1126523_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186775.1|1126585_1127062_-	RadC family protein	NA	NA	NA	NA	NA
WP_001350782.1|1127077_1127551_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001234738.1|1127892_1128711_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	9.4e-47
WP_001323397.1|1128865_1129024_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_021526504.1|1129094_1131941_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001553935.1|1132313_1133186_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000250227.1|1133270_1134188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813435.1|1135388_1135991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211308.1|1136086_1136293_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071526287.1|1137066_1137216_+	hemolysin activation protein	NA	NA	NA	NA	NA
WP_001547002.1|1137548_1137746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221530.1|1137945_1138515_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270962.1|1138774_1139176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221615.1|1139163_1139598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171523.1|1139952_1140333_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1140329_1140677_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998019.1|1140726_1142112_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
WP_000823243.1|1142350_1143709_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_001283626.1|1145270_1145792_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068908.1|1145788_1146742_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_000188262.1|1146828_1149153_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879164.1|1149197_1150100_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|1150096_1151095_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684856.1|1151091_1152048_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|1152048_1152816_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177057.1|1153372_1153630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000088391.1|1154563_1154866_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000336726.1|1154901_1155720_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
>prophage 3
NZ_CP015138	Escherichia coli strain Ecol_732 chromosome, complete genome	5009900	2702479	2747293	5009900	transposase,protease	Stx2-converting_phage(27.27%)	33	NA	NA
WP_000997995.1|2702479_2704018_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|2705145_2705496_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|2705492_2705918_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|2706289_2706427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001149834.1|2706578_2707496_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|2707529_2708405_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|2708453_2709926_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|2709929_2710760_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|2710805_2711516_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|2711528_2712638_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|2712699_2713623_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|2713658_2714393_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|2714492_2715479_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_096928816.1|2715630_2716858_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|2717358_2719449_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001305021.1|2720280_2720553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322947.1|2720640_2720832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|2720843_2721203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|2721206_2721422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032212789.1|2725299_2726154_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_001254932.1|2726202_2727354_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001034083.1|2727950_2731838_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_000973516.1|2732781_2734983_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|2735064_2736342_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|2736338_2738081_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|2738080_2739028_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|2739028_2740753_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|2740888_2742082_+	MFS transporter	NA	NA	NA	NA	NA
WP_001296373.1|2742799_2743228_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109147.1|2743267_2743828_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|2743869_2744130_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|2745963_2746077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099156432.1|2746167_2747293_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
>prophage 4
NZ_CP015138	Escherichia coli strain Ecol_732 chromosome, complete genome	5009900	3040877	3048017	5009900		Escherichia_phage(83.33%)	6	NA	NA
WP_001279004.1|3040877_3041516_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|3041512_3042775_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|3042771_3043680_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001272542.1|3043845_3044643_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_001141293.1|3044693_3045350_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|3045455_3048017_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 5
NZ_CP015138	Escherichia coli strain Ecol_732 chromosome, complete genome	5009900	3118282	3208177	5009900	transposase,terminase,tRNA,lysis,tail,portal,protease	Enterobacteria_phage(42.37%)	95	NA	NA
WP_023363292.1|3118282_3119182_-	DNA adenine methylase	NA	A0A0C5AMX6	Cyanophage	23.2	2.5e-08
WP_001596855.1|3119261_3120995_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001596854.1|3121053_3122220_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.2	1.8e-147
WP_001331174.1|3122180_3122387_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001331173.1|3122446_3122662_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001596853.1|3122658_3123021_-	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	1.5e-65
WP_000008200.1|3123011_3123548_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081269.1|3123675_3124500_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000135680.1|3124565_3124928_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859460.1|3125596_3126271_-	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
WP_000649477.1|3126361_3126562_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|3126605_3127157_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_001087352.1|3127153_3127990_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	98.9	5.1e-149
WP_015364394.1|3127994_3128219_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	91.9	1.2e-33
WP_000061506.1|3128215_3129034_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	89.5	2.7e-126
WP_077881878.1|3129030_3129528_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	94.5	7.6e-84
WP_001442792.1|3129524_3130178_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	4.7e-126
WP_000210170.1|3130174_3130501_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_063112468.1|3130497_3130887_+	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	97.7	2.3e-67
WP_001061379.1|3130906_3131716_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.5	8.2e-152
WP_001360050.1|3131723_3132713_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001047105.1|3132726_3133479_+	antitermination protein	NA	A0A291AWZ5	Escherichia_phage	100.0	1.3e-138
WP_000217632.1|3133759_3134185_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_000654812.1|3134330_3135299_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.7	2.1e-186
WP_000595432.1|3135474_3135678_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	97.0	3.0e-31
WP_063112469.1|3135828_3136881_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	5.2e-207
WP_000839596.1|3136948_3137164_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|3137163_3137661_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|3137657_3138125_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001139675.1|3138112_3138265_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_000373425.1|3138940_3139435_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001700320.1|3139434_3141537_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.9	0.0e+00
WP_001072975.1|3141533_3141746_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_023363268.1|3141745_3143254_+|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.2	1.9e-287
WP_023363265.1|3143198_3145226_+|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_001097045.1|3145313_3145637_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_023363262.1|3145629_3145905_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	5.0e-45
WP_000677106.1|3145916_3146495_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_023363259.1|3146491_3146893_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	5.4e-72
WP_001402994.1|3146903_3147647_+	cell motility protein	NA	A0A291AWU6	Escherichia_phage	99.2	6.6e-132
WP_001299384.1|3147707_3148094_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	4.7e-65
WP_001161009.1|3148102_3148432_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_063112470.1|3148403_3151469_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.8	0.0e+00
WP_000447253.1|3151468_3151798_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_063112471.1|3151807_3152506_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	1.5e-133
WP_063112472.1|3152510_3153254_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	7.7e-149
WP_063112473.1|3153190_3153799_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.5	2.4e-103
WP_063112474.1|3153859_3157357_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.2	0.0e+00
WP_001233090.1|3157427_3158027_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_071938245.1|3158091_3161490_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_063112476.1|3161489_3162074_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	2.4e-105
WP_001597763.1|3162259_3162415_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	92.6	2.2e-05
WP_024190590.1|3162474_3163545_+	type II toxin-antitoxin system RnlA family toxin	NA	NA	NA	NA	NA
WP_000461705.1|3163537_3163900_+	type II toxin-antitoxin system RnlB family antitoxin	NA	NA	NA	NA	NA
WP_000429347.1|3164037_3164307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162574.1|3165184_3165667_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600193.1|3165798_3166275_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117834.1|3166264_3166555_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|3166616_3166958_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880939.1|3167106_3168768_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059176.1|3168853_3169732_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|3169854_3170448_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|3170501_3171788_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001189256.1|3171808_3172675_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|3172766_3174128_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|3174264_3174513_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|3174531_3175080_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264790.1|3175110_3175878_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|3175919_3176267_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589791.1|3176343_3176826_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969008.1|3176841_3178068_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212400.1|3178057_3178576_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001296308.1|3178722_3179088_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|3179297_3180368_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225212.1|3180378_3181500_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200140.1|3181542_3182703_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|3182801_3182849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|3182952_3183294_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|3183563_3184301_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079111.1|3184435_3185416_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040156.1|3185412_3186144_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|3186273_3188847_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000852119.1|3194633_3195932_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
WP_001467872.1|3195928_3196252_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001312028.1|3196297_3197653_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082935.1|3197766_3200427_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001296305.1|3200458_3201157_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|3201225_3201645_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997384.1|3201851_3202889_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262723.1|3202936_3203626_-	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000627804.1|3203930_3204314_+	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_000189207.1|3204369_3204957_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001296304.1|3205059_3205941_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|3205973_3207308_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000083664.1|3207439_3208177_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP015138	Escherichia coli strain Ecol_732 chromosome, complete genome	5009900	3672585	3682030	5009900		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|3672585_3673512_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_000783109.1|3673516_3674248_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3674228_3674336_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|3674395_3675127_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|3675348_3677034_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3677030_3677750_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3677796_3678267_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|3678307_3678769_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|3678893_3680897_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|3680893_3682030_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 7
NZ_CP015138	Escherichia coli strain Ecol_732 chromosome, complete genome	5009900	3776206	3782509	5009900		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116066.1|3776206_3777601_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
WP_000183040.1|3777775_3778669_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_000699407.1|3779041_3780127_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_001023641.1|3780126_3781026_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|3781083_3781962_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|3781966_3782509_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 8
NZ_CP015138	Escherichia coli strain Ecol_732 chromosome, complete genome	5009900	3805656	3847168	5009900	transposase	Stx2-converting_phage(21.43%)	45	NA	NA
WP_001531805.1|3805656_3806115_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
WP_000980556.1|3806225_3807653_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001296209.1|3807861_3809028_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_001105368.1|3809146_3809620_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200889.1|3809817_3810876_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|3811047_3811377_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001296208.1|3811477_3811660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|3812148_3812262_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|3812274_3812469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854815.1|3812465_3812840_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001280918.1|3812928_3813297_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086752.1|3813312_3813957_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|3813975_3814197_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186200.1|3814259_3814736_-	RadC family protein	NA	NA	NA	NA	NA
WP_001542276.1|3814751_3815225_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001164966.1|3815318_3815564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|3815563_3816382_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_000846703.1|3816602_3817013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|3817461_3818208_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|3818222_3819764_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001542273.1|3819878_3820292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102633.1|3820427_3821498_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203551.1|3821494_3822400_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_001531797.1|3822396_3824781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069649.1|3824998_3825433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000856948.1|3825861_3828027_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000778018.1|3828037_3829027_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000217077.1|3829045_3830104_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000016207.1|3830100_3830868_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_001163787.1|3830921_3831179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296206.1|3831709_3832855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089438313.1|3834054_3834234_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000255956.1|3834379_3835402_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_000970353.1|3835401_3836094_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_001327829.1|3836430_3836646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813432.1|3837119_3837722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304240.1|3837815_3838094_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001296203.1|3838217_3839414_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_001336659.1|3840177_3840354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221519.1|3840993_3841563_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271042.1|3841728_3842130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221618.1|3842117_3842528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|3844751_3845177_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3845173_3845524_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080195.1|3845554_3847168_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
>prophage 9
NZ_CP015138	Escherichia coli strain Ecol_732 chromosome, complete genome	5009900	3911691	3982659	5009900	transposase,terminase,holin,capsid,tail,portal,integrase,head,protease	Stx2-converting_phage(24.56%)	79	3907865:3907879	3913775:3913789
3907865:3907879	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|3911691_3912822_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|3912799_3913048_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|3913112_3915584_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
3913775:3913789	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|3915676_3915868_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|3915864_3916053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|3916618_3916837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|3916996_3917152_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|3917424_3918141_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|3918190_3918406_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|3918402_3918828_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|3918850_3919813_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|3919819_3920566_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|3920587_3921358_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|3921373_3921799_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|3921973_3922639_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|3922819_3923032_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|3923199_3923472_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|3923473_3924529_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|3924529_3924910_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|3924906_3925728_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|3925954_3926152_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|3926303_3927353_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|3928154_3928286_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|3928566_3928902_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|3929162_3931016_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|3931166_3931382_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|3931386_3931731_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|3931696_3931969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949154.1|3932070_3933217_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000992071.1|3933327_3933861_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|3934415_3934502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|3934723_3934909_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|3934994_3935210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|3935408_3935609_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|3935650_3936016_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|3936306_3936870_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|3936866_3938528_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|3938591_3940529_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|3940573_3940795_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|3940740_3943326_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|3943322_3943649_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|3943658_3944009_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|3944005_3944452_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|3944448_3944793_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|3944859_3945576_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|3945590_3945965_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|3946060_3946270_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|3946317_3949560_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|3949552_3949894_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|3949893_3950592_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|3950602_3951346_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|3951291_3951924_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|3952266_3955740_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001298859.1|3956380_3957922_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|3957936_3958683_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_071550361.1|3959144_3962051_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001164137.1|3962066_3962594_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|3962624_3963158_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_022645053.1|3963159_3963945_-	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_001421220.1|3964172_3964355_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|3964553_3965222_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|3965278_3965548_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001348267.1|3965959_3966517_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|3966513_3966789_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|3967164_3967971_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|3967970_3969164_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|3969175_3970534_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|3970537_3972133_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|3972132_3973695_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|3973786_3973831_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|3973968_3974850_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|3974846_3975467_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|3975494_3977390_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|3977602_3978478_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_023141019.1|3978683_3979670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|3979679_3979988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|3980044_3980635_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|3980631_3981390_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|3981609_3982659_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 10
NZ_CP015138	Escherichia coli strain Ecol_732 chromosome, complete genome	5009900	4475876	4564123	5009900	transposase,terminase,tRNA,holin,capsid,tail,plate,portal,integrase	Escherichia_phage(22.73%)	104	4521573:4521632	4564185:4564309
WP_099156422.1|4475876_4477225_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
WP_000568520.1|4477334_4478345_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|4478353_4478965_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|4479103_4479169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024911.1|4479239_4479842_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|4479843_4480365_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|4480399_4481140_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|4481168_4481621_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|4481613_4483386_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|4483695_4484262_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|4484258_4485077_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|4485129_4485525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|4485565_4486309_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|4486305_4487277_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|4487312_4489742_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|4489766_4490867_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|4491254_4492001_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|4492014_4492581_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|4492796_4494530_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|4494582_4494975_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|4494974_4497053_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|4497045_4498194_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|4498382_4499027_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|4499037_4499427_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|4499441_4500491_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|4500493_4501354_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|4501644_4503306_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|4503450_4503954_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|4503974_4505939_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|4505943_4506870_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|4506866_4507754_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|4507880_4508459_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|4508461_4508812_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|4509591_4510020_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|4510026_4511451_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|4511425_4512226_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987895.1|4512392_4513382_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|4513393_4514908_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|4514977_4515967_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|4516761_4517265_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|4517342_4517594_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|4517708_4517795_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|4518058_4518382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|4518553_4519051_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|4519088_4519328_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|4519518_4520730_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|4520780_4521446_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
4521573:4521632	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|4521917_4522337_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|4523551_4523776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531768.1|4523937_4524327_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|4524362_4526003_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|4526111_4526393_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|4526405_4526918_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000117510.1|4526935_4528438_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|4528434_4528824_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|4528823_4530008_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|4530000_4530627_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|4530629_4531550_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|4531546_4531888_-|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|4531890_4532793_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|4532773_4533310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|4533306_4533987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|4534018_4534399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|4534395_4534815_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|4534849_4535884_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|4535942_4536272_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|4536271_4537579_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|4537578_4539153_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|4539149_4539383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|4539382_4541245_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|4541231_4541798_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|4542166_4542412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|4542471_4542666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|4542673_4543153_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|4543152_4543425_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|4543424_4543808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|4543920_4544592_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|4544591_4544885_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|4544881_4545478_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|4545555_4545735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|4545886_4546528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|4546771_4547005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|4547403_4547892_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|4547901_4548507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|4548969_4549668_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|4550856_4551780_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|4551954_4552743_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000466605.1|4553015_4553237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661082.1|4553424_4553649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|4553645_4553957_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|4553953_4554190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|4554191_4554602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|4554640_4556056_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|4556045_4556801_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|4556797_4557022_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|4557061_4557538_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|4557596_4557827_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|4557925_4558339_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|4559349_4559670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|4559700_4561917_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|4561913_4562483_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|4562482_4562665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|4562874_4563138_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|4563106_4564123_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
4564185:4564309	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 11
NZ_CP015138	Escherichia coli strain Ecol_732 chromosome, complete genome	5009900	4613675	4697914	5009900	transposase,integrase	Bacillus_phage(26.67%)	54	4641588:4641602	4699057:4699071
WP_099156434.1|4613675_4615024_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001007778.1|4615284_4615935_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001311896.1|4616787_4617585_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060157.1|4617922_4619185_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
WP_000703040.1|4619378_4620683_-	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_001286284.1|4620710_4621991_-	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_000654452.1|4621983_4623786_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.5	6.1e-22
WP_001296192.1|4623772_4625485_-	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.0	1.0e-31
WP_000140402.1|4625741_4626701_+	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_063112481.1|4626891_4632999_+	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9L3I8	Tupanvirus	27.3	1.4e-33
WP_000369500.1|4633086_4642578_+	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
4641588:4641602	attL	TGAACTCTGGCAATC	NA	NA	NA	NA
WP_000982870.1|4642574_4643675_+	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_160342141.1|4643737_4644475_+	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_001088830.1|4644478_4646056_+	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	NA	NA	NA	NA
WP_063112482.1|4646186_4648208_+	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_000039780.1|4648857_4649607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000646566.1|4649739_4651002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001360219.1|4651221_4651698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000480517.1|4651825_4652878_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000378563.1|4653192_4654509_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060231.1|4654610_4656065_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532923.1|4656407_4657124_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_122984588.1|4657753_4659397_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011024.1|4659514_4660465_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011491.1|4660566_4661484_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000986344.1|4661941_4662877_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001166163.1|4662938_4664018_-	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001296197.1|4664029_4664773_-	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_000973199.1|4664769_4665315_-	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_000966628.1|4666986_4669134_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000502870.1|4669504_4670149_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	8.2e-54
WP_001542270.1|4670133_4671357_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.5	2.0e-61
WP_001297930.1|4672404_4673058_+	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_000854360.1|4673071_4674268_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_077249421.1|4674245_4674827_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000589885.1|4674828_4675602_+	YaiO family outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_000667429.1|4676603_4677818_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001066372.1|4677831_4678590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739817.1|4678643_4679609_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000656349.1|4679611_4680646_+	phosphotriesterase	NA	NA	NA	NA	NA
WP_099975602.1|4680685_4680841_-	gamma-glutamyltranspeptidase	NA	NA	NA	NA	NA
WP_000080195.1|4680860_4682474_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|4682504_4682855_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|4682851_4683277_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_085949154.1|4684288_4685436_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_001531630.1|4685599_4685797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343920.1|4687671_4690329_-	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_001531628.1|4691325_4692723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949154.1|4693111_4694259_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_001000136.1|4694552_4695407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000658784.1|4695494_4695962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001095671.1|4695963_4696161_-	AlpA family phage regulatory protein	NA	A0A1V0E888	Vibrio_phage	43.9	7.3e-06
WP_000580009.1|4696383_4696998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023141324.1|4696984_4697914_-|integrase	site-specific integrase	integrase	A0A1B1P7C7	Bacillus_phage	28.5	4.4e-08
4699057:4699071	attR	GATTGCCAGAGTTCA	NA	NA	NA	NA
>prophage 12
NZ_CP015138	Escherichia coli strain Ecol_732 chromosome, complete genome	5009900	4759344	4805053	5009900	terminase,tRNA,holin,lysis,capsid,tail,portal,integrase,head	Enterobacteria_phage(56.0%)	58	4778128:4778142	4806722:4806736
WP_000654172.1|4759344_4759623_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290538.1|4759619_4761641_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_001531667.1|4761699_4765182_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023149564.1|4765242_4765845_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_023146277.1|4765781_4766525_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152626.1|4766529_4767228_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847375.1|4767227_4767557_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_000840216.1|4767553_4770115_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459457.1|4770107_4770542_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|4770523_4770946_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|4770961_4771702_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|4771709_4772105_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|4772101_4772680_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000753018.1|4772691_4773045_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158908.1|4773056_4773455_-	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063293.1|4773496_4774522_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_001295978.1|4774577_4774910_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|4774919_4776239_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|4776219_4777821_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|4777817_4778024_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027261.1|4778020_4779946_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
4778128:4778142	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453620.1|4779920_4780466_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|4781029_4781212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|4781418_4781745_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|4782225_4782519_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|4782609_4782792_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|4783008_4783485_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|4783471_4783777_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|4784098_4784788_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|4784784_4784925_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|4784921_4785284_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|4785280_4785571_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|4785563_4785734_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|4785733_4786189_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072147164.1|4786185_4786287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|4786636_4787680_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022645049.1|4787716_4791982_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000788794.1|4792231_4792933_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_001435464.1|4792929_4793859_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_001182900.1|4793945_4794485_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001067458.1|4794554_4794785_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|4794823_4795579_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000233576.1|4796174_4796381_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995418.1|4796456_4796753_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000100847.1|4796758_4797544_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|4797540_4798221_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|4798217_4798400_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|4798372_4798564_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|4798574_4798856_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|4798954_4799176_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|4799175_4799502_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|4799485_4799725_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|4799864_4800101_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|4800090_4801233_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|4801346_4802597_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|4802768_4803422_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|4803431_4803893_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|4803946_4805053_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
4806722:4806736	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 1
NZ_CP015140	Escherichia coli strain Ecol_732 plasmid pEC732_2, complete sequence	129154	3060	69097	129154	transposase,integrase	Escherichia_phage(45.45%)	55	NA	NA
WP_001067855.1|3060_3765_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|3886_4792_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001137892.1|6025_6610_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|7102_7867_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|8093_8399_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|8409_9615_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|9770_9974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|10101_10941_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|10934_11282_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|11487_12276_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|12406_12880_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000449408.1|15991_16150_+	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_000949452.1|16139_16646_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_012372823.1|16828_17644_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|17990_19877_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|19917_20445_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|20548_21928_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|21930_23214_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729218.1|23203_24334_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|24338_25034_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267176.1|25020_25506_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|25530_26016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001189106.1|26920_27409_-|transposase	transposase	transposase	A0A077SK28	Escherichia_phage	93.2	6.7e-24
WP_000371882.1|28922_29183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194542.1|29179_29689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142452.1|29708_30056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080732.1|30184_30520_+	colicin transporter	NA	NA	NA	NA	NA
WP_001224623.1|32970_33846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000981091.1|33853_34630_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_001100763.1|34798_37060_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001020413.1|37128_38304_+	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_001189113.1|40569_42078_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000839179.1|42579_42984_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|42980_43328_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001310017.1|44407_45430_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_077881882.1|45429_45990_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	100.0	2.9e-92
WP_000080195.1|45993_47607_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|47637_47988_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|47984_48410_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000977394.1|49487_50279_-	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001298664.1|50285_52256_-	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_001322642.1|53498_53771_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001072358.1|54617_55787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001309252.1|56153_56342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066941.1|56462_57203_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000361610.1|57487_58465_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_000081352.1|61807_62740_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001373486.1|62726_64130_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_012372828.1|64337_65354_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001513659.1|65581_65899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513660.1|66185_66545_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|66572_66752_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|66756_67137_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|67136_67358_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001617892.1|67540_69097_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
>prophage 1
NZ_CP015139	Escherichia coli strain Ecol_732 plasmid pEC732_IMP14, complete sequence	186826	5353	49902	186826	integrase,transposase	Salmonella_phage(23.08%)	45	NA	NA
WP_000427623.1|5353_6358_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_100245271.1|6663_6900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000219391.1|7963_8869_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|8865_10104_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|10103_10688_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|11180_11945_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|12171_12477_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|12487_13693_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000427623.1|13920_14925_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004883563.1|15106_15379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|15506_16346_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|16339_16687_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_058677881.1|16885_18109_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	33.0	4.4e-32
WP_001209508.1|18688_19480_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000846390.1|19496_20297_-	oxacillin-hydrolyzing class D beta-lactamase OXA-10	NA	NA	NA	NA	NA
WP_012300772.1|20561_21821_-	chloramphenicol efflux MFS transporter CmlA5	NA	S4TR35	Salmonella_phage	31.7	1.7e-26
WP_000237816.1|22141_22594_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-2	NA	NA	NA	NA	NA
WP_000381802.1|22678_23212_-	aminoglycoside nucleotidyltransferase ANT(2'')-Ia	NA	NA	NA	NA	NA
WP_015059047.1|23285_23618_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_000845039.1|23868_24882_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001162012.1|25187_25745_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_001138073.1|25747_28720_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_000427619.1|28798_29803_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000714163.1|29984_30206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268337.1|30278_30557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122922.1|30543_32271_-	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_001077336.1|32448_32835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001032043.1|32941_33088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|33293_34145_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_000064432.1|34219_34777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|34850_35069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000184110.1|35082_35352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|35344_35950_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000050847.1|36021_36225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063112484.1|36980_37661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087759866.1|37710_38830_+|transposase	IS3-like element ISKpn34 family transposase	transposase	S5WIU1	Leptospira_phage	43.3	1.1e-50
WP_063112485.1|38883_39132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063112486.1|39259_41425_-	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	23.9	2.3e-39
WP_063112487.1|41421_41859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063112488.1|41858_42536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063112489.1|42535_45205_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_063112497.1|46519_46813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209093.1|46890_47235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063112490.1|47560_48316_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.4	4.0e-52
WP_063112491.1|48339_49902_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.8	1.1e-123
>prophage 2
NZ_CP015139	Escherichia coli strain Ecol_732 plasmid pEC732_IMP14, complete sequence	186826	154612	180501	186826	integrase,transposase	Salmonella_phage(28.57%)	26	151251:151264	178115:178128
151251:151264	attL	CCTTTTTGCTCCTC	NA	NA	NA	NA
WP_000543934.1|154612_155623_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000949433.1|155625_156162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|156460_156742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|157003_157606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|157621_158074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326394.1|158244_158685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257735.1|158656_162910_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.6	1.1e-18
WP_032410269.1|162864_163068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988731.1|163042_163768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000868820.1|163881_164256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338626.1|164376_164493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|164898_165903_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_034064681.1|165981_168948_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	97.1	0.0e+00
WP_034064682.1|168951_169512_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	96.8	8.1e-58
WP_003159187.1|169892_170429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003159186.1|170440_170836_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003108276.1|170832_171084_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003159185.1|171265_171832_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	54.3	7.9e-45
WP_000845039.1|172180_173194_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_039819893.1|173346_174087_+	subclass B1 metallo-beta-lactamase IMP-14	NA	NA	NA	NA	NA
WP_052285801.1|174232_174673_+	aminoglycoside 6'-N-acetyltransferase AacA34	NA	NA	NA	NA	NA
WP_000679427.1|174790_175138_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|175131_175971_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|176375_177917_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_024160765.1|178682_179291_+	hypothetical protein	NA	NA	NA	NA	NA
178115:178128	attR	GAGGAGCAAAAAGG	NA	NA	NA	NA
WP_063112495.1|179556_180501_+|transposase	IS1595-like element ISEc70 family transposase	transposase	NA	NA	NA	NA
