The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014996	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 chromosome, complete genome	5047093	615298	671845	5047093	head,capsid,tRNA,plate,portal,holin,integrase,tail,terminase	Cronobacter_phage(62.5%)	61	624501:624518	674155:674172
WP_000785626.1|615298_615697_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000031219.1|615699_616005_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000877297.1|616046_616415_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000917516.1|616559_616943_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000422141.1|616946_617609_-	DedA family protein	NA	NA	NA	NA	NA
WP_000235363.1|618058_619303_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_001098833.1|619557_620526_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	5.0e-39
WP_000617678.1|620796_621795_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000951045.1|621883_622576_-	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_000202966.1|622726_623224_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000019989.1|623309_624446_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
624501:624518	attL	AAGCGCAGCGCCATCAGG	NA	NA	NA	NA
WP_000121517.1|624526_626545_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001520281.1|626715_628095_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_000094639.1|628524_630045_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_000478471.1|630432_631998_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
WP_000983434.1|631994_632642_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213761.1|632873_633641_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_057521324.1|633880_634669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057521323.1|634665_635688_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.7	5.5e-121
WP_021293714.1|635691_636258_-	PH domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	32.2	7.5e-19
WP_021293715.1|636274_636856_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	37.8	4.8e-29
WP_021293716.1|636997_637219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057521322.1|637249_637753_+	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	71.9	1.3e-59
WP_071925516.1|637762_637990_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_057521321.1|637979_638408_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	54.9	6.7e-28
WP_057521320.1|638407_638809_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	69.2	1.2e-50
WP_057521319.1|638876_639110_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_057521318.1|639666_639996_+	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	44.2	9.7e-11
WP_057521317.1|639985_640846_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	83.1	1.3e-131
WP_057521316.1|640842_642870_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.1	1.4e-296
WP_001748628.1|642989_643196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|643169_643493_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038208.1|643489_644551_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	77.1	2.3e-162
WP_023199748.1|644547_646323_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.3	2.6e-291
WP_057521315.1|646483_647287_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	1.2e-78
WP_000550496.1|647348_648371_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.2	1.1e-158
WP_001218537.1|648374_649076_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_001680743.1|649172_649625_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	1.6e-64
WP_000084221.1|649621_650128_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.5e-63
WP_000560083.1|650124_650832_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.9	6.8e-102
WP_057521314.1|650828_651956_+	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	83.7	8.6e-176
WP_000166743.1|651952_652408_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|652417_652711_+|holin	phage holin family protein	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|652707_653049_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376375.1|653048_653381_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	71.8	6.7e-36
WP_057521313.1|653527_653785_+|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	63.4	2.8e-21
WP_057521312.1|653972_655940_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	4.6e-273
WP_001002797.1|655936_656266_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_057521311.1|656262_657447_+|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	78.4	3.9e-179
WP_057521310.1|657439_658027_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	2.9e-90
WP_062945526.1|658035_660276_+|tail	phage tail protein	tail	A0A192Y7M1	Salmonella_phage	82.7	6.5e-207
WP_094198672.1|660245_660851_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	94.1	4.4e-102
WP_057521330.1|660840_661566_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	56.0	6.6e-68
WP_057521331.1|661537_662083_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.5	1.4e-59
WP_020845287.1|662082_663786_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	7.6e-224
WP_000340945.1|665154_665457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000237776.1|665780_666287_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|666410_668258_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918869.1|668407_670153_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	6.2e-72
WP_001144069.1|670388_670604_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264389.1|670831_671845_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.2e-109
674155:674172	attR	AAGCGCAGCGCCATCAGG	NA	NA	NA	NA
>prophage 2
NZ_CP014996	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 chromosome, complete genome	5047093	1144975	1244072	5047093	tRNA,lysis,head,plate,capsid,portal,transposase,holin,integrase,tail,terminase	Salmonella_phage(49.06%)	90	1179526:1179542	1210953:1210969
WP_000081842.1|1144975_1146178_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_000190912.1|1146798_1147371_-	flagellar phase variation DNA invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.6	8.8e-68
WP_000079789.1|1147462_1148965_+	flagellin FliC	NA	NA	NA	NA	NA
WP_000388873.1|1149032_1149572_+	phase 1 flagellin gene repressor FljA	NA	NA	NA	NA	NA
WP_000342601.1|1150529_1151693_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196141.1|1151700_1153881_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533868.1|1153877_1155287_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_001535045.1|1155351_1166826_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1167445_1167928_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1168077_1168554_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1168543_1168834_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1168999_1169338_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1169486_1171148_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1171233_1172112_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1172235_1172826_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287924.1|1172860_1173466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130559217.1|1173586_1174873_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1174892_1175684_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1175849_1177211_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1177524_1177773_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1177791_1178340_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469811.1|1178384_1179152_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1179192_1179540_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
1179526:1179542	attL	GAGCGTCTTAACTAAGA	NA	NA	NA	NA
WP_000972010.1|1179684_1179903_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
WP_000627819.1|1179978_1181148_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	99.0	4.1e-213
WP_000978862.1|1181144_1181630_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	100.0	3.6e-86
WP_057515790.1|1181644_1184089_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	94.1	0.0e+00
WP_085984508.1|1184081_1184237_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|1184233_1184569_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207675.1|1184631_1185150_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001279033.1|1185165_1186353_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.5	9.9e-223
WP_000122993.1|1186487_1187036_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	98.9	3.8e-100
WP_000104700.1|1187048_1189025_-|tail	tail fiber protein	tail	S4TP62	Salmonella_phage	97.4	0.0e+00
WP_001000069.1|1189035_1189566_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	99.4	5.4e-104
WP_000246671.1|1189558_1190467_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	99.3	5.4e-160
WP_000127177.1|1190473_1190821_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	98.3	7.2e-57
WP_001094748.1|1190817_1191459_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.7	3.2e-111
WP_001293096.1|1191527_1191977_-	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	99.3	4.2e-73
WP_001169074.1|1191969_1192437_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_015633067.1|1192399_1192573_-	hypothetical protein	NA	S4TNY4	Salmonella_phage	96.5	1.1e-24
WP_000866103.1|1192544_1192958_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0M4R2N5	Salmonella_phage	94.2	8.4e-44
WP_001144116.1|1192954_1193452_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_000134659.1|1193438_1193735_-|holin	phage holin family protein	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_000870102.1|1193738_1193942_-|tail	tail protein X	tail	S4TTA0	Salmonella_phage	97.0	8.8e-31
WP_000214255.1|1193941_1194448_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_000203475.1|1194541_1195291_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	96.8	6.4e-127
WP_086011253.1|1195457_1196712_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
WP_001085932.1|1197753_1198608_-|capsid	capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	100.0	9.9e-148
WP_000156055.1|1198773_1200543_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	100.0	0.0e+00
WP_000517959.1|1200542_1201589_+|portal	phage portal protein	portal	A0A0M4S6E8	Salmonella_phage	100.0	4.0e-191
WP_001222153.1|1202596_1202830_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	100.0	2.1e-36
WP_000232650.1|1202833_1203016_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	100.0	4.1e-27
WP_000556267.1|1203133_1205362_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	96.9	0.0e+00
WP_000058625.1|1205354_1205636_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	98.9	6.1e-46
WP_031624535.1|1205632_1206226_-	3'-5' exonuclease	NA	A0A218M4G8	Erwinia_phage	99.0	6.0e-112
WP_000752600.1|1206341_1206563_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	100.0	3.8e-35
WP_001246237.1|1206562_1206790_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
WP_000963464.1|1206857_1207196_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.9	6.8e-52
WP_000916539.1|1207159_1207360_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	98.5	2.1e-32
WP_000459331.1|1207367_1207877_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	100.0	3.3e-90
WP_001278194.1|1207909_1208281_-	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	99.2	1.4e-61
WP_000997320.1|1208394_1209237_+	phage repressor protein CI	NA	A0A0M4RE65	Salmonella_phage	70.8	3.9e-112
WP_000382813.1|1209236_1209800_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000218686.1|1209821_1210871_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	99.7	3.3e-206
WP_001030985.1|1211123_1212344_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
1210953:1210969	attR	GAGCGTCTTAACTAAGA	NA	NA	NA	NA
WP_001212379.1|1212336_1212855_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1213294_1214365_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_000225191.1|1214374_1215496_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000210993.1|1215553_1216462_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200078.1|1216422_1217583_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1217682_1217730_-	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000178449.1|1217833_1218172_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1218443_1219181_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1219312_1220293_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992643.1|1220289_1221021_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|1221150_1223724_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_000985658.1|1229871_1230327_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	8.6e-34
WP_000807803.1|1230430_1231732_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	4.5e-43
WP_001264475.1|1231728_1232052_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949287.1|1232096_1233452_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082657.1|1233566_1236227_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000183637.1|1236280_1236961_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|1237033_1237453_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1237656_1238694_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1238809_1239499_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1239817_1240201_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188415.1|1240262_1240850_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001535061.1|1240952_1241852_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1241869_1243204_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083345.1|1243334_1244072_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP014996	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 chromosome, complete genome	5047093	1714634	1723805	5047093	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1714634_1715582_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1715565_1716297_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1716277_1716385_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1716444_1717176_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1717398_1719084_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1719080_1719800_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950422.1|1719846_1720314_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	1.1e-73
WP_001265351.1|1720370_1720901_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1721072_1721531_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195334.1|1721771_1723805_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP014996	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 chromosome, complete genome	5047093	1797116	1803413	5047093		Enterobacteria_phage(50.0%)	6	NA	NA
WP_001111837.1|1797116_1798520_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981469.1|1798697_1799591_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1799967_1801053_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_001023657.1|1801052_1801952_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	7.9e-31
WP_000857532.1|1801999_1802878_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.7e-107
WP_001100807.1|1802882_1803413_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	3.7e-52
>prophage 5
NZ_CP014996	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 chromosome, complete genome	5047093	1831267	1862663	5047093	integrase,terminase,holin	Salmonella_phage(55.88%)	43	1824736:1824750	1863420:1863434
1824736:1824750	attL	CATGGTCTTTACTCC	NA	NA	NA	NA
WP_001007943.1|1831267_1832449_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	99.5	1.3e-227
WP_001754984.1|1832812_1833052_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	96.2	9.7e-37
WP_000148481.1|1833057_1833927_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4R347	Salmonella_phage	94.5	3.7e-158
WP_000187056.1|1833923_1834604_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	98.7	3.9e-131
WP_001648679.1|1834600_1835386_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	99.2	1.4e-148
WP_000995351.1|1835391_1835688_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	99.0	5.2e-48
WP_000565272.1|1835768_1835918_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_000687096.1|1835910_1836183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001009036.1|1836557_1836962_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	7.1e-72
WP_000869364.1|1837091_1837328_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_076735768.1|1837293_1837668_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.5e-63
WP_000024043.1|1837759_1838596_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.4	7.6e-52
WP_000801765.1|1838592_1839288_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.9	2.5e-56
WP_000025838.1|1839301_1839559_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	90.6	4.7e-37
WP_062945530.1|1839555_1840170_+	hypothetical protein	NA	M1F3E2	Salmonella_phage	65.8	2.2e-72
WP_012218646.1|1840166_1840640_+	ead/Ea22-like family protein	NA	A0A1R3Y5T1	Salmonella_virus	71.2	5.6e-36
WP_167980740.1|1841074_1841548_+	DUF550 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	71.3	1.2e-38
WP_000662461.1|1841544_1842102_+	DUF551 domain-containing protein	NA	A0A220NQT9	Salmonella_phage	92.8	1.7e-95
WP_001217670.1|1842622_1842862_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_001804676.1|1842917_1843157_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	100.0	5.9e-42
WP_000929790.1|1843196_1843799_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096548.1|1844007_1844619_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	9.3e-92
WP_000801757.1|1844615_1844756_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097243.1|1844752_1845442_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.2	5.3e-59
WP_162264800.1|1845642_1845984_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.4	9.6e-46
WP_001005896.1|1845986_1846613_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	80.2	2.1e-94
WP_001050815.1|1846609_1847158_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000877751.1|1847184_1847742_-	YfbU family protein	NA	NA	NA	NA	NA
WP_001118134.1|1847829_1848582_+	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	34.1	1.6e-16
WP_000763785.1|1848583_1849915_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	59.7	6.4e-154
WP_001001270.1|1849926_1851348_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.7	3.1e-90
WP_001091611.1|1851344_1852169_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	42.7	1.4e-53
WP_000964073.1|1852181_1853801_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000002317.1|1853816_1854677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719055.1|1854693_1855725_+	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	46.9	7.1e-76
WP_000780868.1|1855793_1856276_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	36.1	1.4e-10
WP_062945531.1|1856272_1856701_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.9	2.7e-21
WP_000627557.1|1856697_1857132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001139601.1|1857115_1858057_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.1	8.5e-52
WP_001018953.1|1858062_1859457_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	37.0	9.3e-71
WP_001133547.1|1859460_1859898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000268743.1|1859897_1860485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729223.1|1860608_1862663_+	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	35.8	2.9e-20
1863420:1863434	attR	CATGGTCTTTACTCC	NA	NA	NA	NA
>prophage 6
NZ_CP014996	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 chromosome, complete genome	5047093	1865732	1873480	5047093	plate,tail	Salmonella_phage(44.44%)	10	NA	NA
WP_001281712.1|1865732_1866959_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	63.4	1.1e-147
WP_000729406.1|1866942_1867569_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000583379.1|1867565_1869617_+	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	82.7	5.7e-210
WP_095062477.1|1869586_1870192_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	93.6	2.2e-101
WP_000267959.1|1870181_1870355_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	65.1	1.7e-11
WP_001259328.1|1870430_1871564_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	33.0	7.2e-37
WP_000532385.1|1871615_1871990_+	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	35.0	9.0e-13
WP_001530989.1|1872463_1872898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343069.1|1873006_1873198_+	DUF2767 family protein	NA	A0A0M4R5C3	Salmonella_phage	97.7	5.8e-16
WP_000798891.1|1873213_1873480_-	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	89.8	4.0e-39
>prophage 7
NZ_CP014996	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 chromosome, complete genome	5047093	2035874	2108258	5047093	tRNA,head,capsid,portal,transposase,holin,integrase,tail,terminase	Salmonella_phage(32.08%)	83	2038895:2038910	2047191:2047206
WP_000004540.1|2035874_2036981_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476064.1|2037034_2037496_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000825956.1|2037507_2037837_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001249415.1|2037833_2038499_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444507.1|2038670_2039921_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.1e-19
2038895:2038910	attL	ACAGGTTTACGGCCAG	NA	NA	NA	NA
WP_000741325.1|2040034_2041177_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	80.3	8.2e-174
WP_000089142.1|2041166_2041403_-	excisionase	NA	NA	NA	NA	NA
WP_000008350.1|2041546_2042086_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	98.9	6.5e-97
WP_000080410.1|2042222_2043050_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	98.9	1.1e-151
WP_000997190.1|2043107_2043479_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000883481.1|2044017_2044215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001020636.1|2044549_2045245_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|2045342_2045567_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|2045595_2046150_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001087399.1|2046146_2047289_+	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	93.4	2.5e-194
2047191:2047206	attR	CTGGCCGTAAACCTGT	NA	NA	NA	NA
WP_000620702.1|2047285_2047510_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000104923.1|2047506_2048466_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	83.4	3.2e-123
WP_001669427.1|2048467_2048950_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	6.0e-86
WP_000066940.1|2048949_2049843_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.9	7.3e-162
WP_000767086.1|2049839_2050229_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_001061461.1|2050245_2051106_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	2.3e-160
WP_024134153.1|2051113_2052103_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	7.1e-190
WP_000595052.1|2052117_2052390_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	77.6	9.4e-28
WP_001534776.1|2052386_2053223_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	77.4	3.5e-121
WP_000057291.1|2053525_2054221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658036.1|2054524_2054713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294875.1|2054802_2055192_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.8	8.1e-41
WP_000226307.1|2055178_2055460_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001075992.1|2055459_2056074_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.2	6.7e-106
WP_086011248.1|2056202_2057457_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	9.8e-19
WP_062945532.1|2057445_2057928_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_001252725.1|2058030_2058534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|2058792_2059338_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_001534812.1|2059309_2061241_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	2.8e-259
WP_000201415.1|2061224_2061428_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|2061424_2063005_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|2062994_2064491_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011258.1|2064503_2064851_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	4.1e-20
WP_057515266.1|2064905_2065934_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.8	5.0e-114
WP_000235459.1|2065991_2066351_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083295.1|2066361_2066739_+|tail	tail attachment protein	tail	K7PHD8	Enterobacteria_phage	54.7	3.4e-28
WP_000677089.1|2066725_2067304_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_043991247.1|2067352_2068483_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	99.7	4.5e-217
WP_023184817.1|2068591_2068993_+|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	98.0	1.2e-50
WP_000971954.1|2069000_2069747_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|2069797_2070193_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077905125.1|2070189_2070528_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	63.6	3.5e-32
WP_057515769.1|2070499_2073541_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	64.7	9.8e-291
WP_000447369.1|2073543_2073873_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_057515768.1|2074588_2075326_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	5.7e-128
WP_057524907.1|2075223_2075871_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.0e-88
WP_057516412.1|2075933_2079296_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_000178849.1|2079334_2079577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057525099.1|2079630_2082072_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.1	7.3e-87
WP_000593428.1|2082068_2082893_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	94.9	4.9e-152
WP_000143155.1|2082882_2083458_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	86.9	1.0e-92
WP_000711200.1|2084107_2084665_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	32.8	3.9e-20
WP_057515787.1|2084955_2085156_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_071587004.1|2085335_2085497_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.5e-09
WP_043991223.1|2085617_2086289_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	4.0e-80
WP_001521673.1|2086540_2086753_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.5e-20
WP_000917260.1|2087199_2088324_+	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_001033398.1|2089313_2090102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497448.1|2090591_2090831_-	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.5	2.5e-32
WP_001534683.1|2091021_2091543_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_001537306.1|2091960_2092173_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_024134152.1|2092304_2092568_-	virulence protein PagD	NA	NA	NA	NA	NA
WP_000789472.1|2093372_2093930_+	virulence membrane protein PagC	NA	Q9LA63	Enterobacterial_phage	33.0	2.2e-15
WP_000977722.1|2095167_2095512_-	c-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_077905118.1|2096214_2096445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218118.1|2096639_2097107_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_062945534.1|2097445_2098489_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_000929974.1|2098571_2099102_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	70.5	2.8e-36
WP_000182479.1|2099250_2099565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000946087.1|2100246_2101881_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001520270.1|2101880_2102855_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000966636.1|2102844_2103657_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000950206.1|2103650_2104448_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	4.7e-11
WP_000947455.1|2104441_2105032_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000456065.1|2105113_2106247_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001183697.1|2106440_2106767_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_001537483.1|2106963_2107611_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000502119.1|2107799_2108258_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
>prophage 8
NZ_CP014996	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 chromosome, complete genome	5047093	2715152	2786721	5047093	head,lysis,plate,protease,holin,integrase,tail	Edwardsiella_phage(17.02%)	78	2741926:2741966	2786836:2786876
WP_000984498.1|2715152_2716034_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091236.1|2716227_2718276_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.2	8.8e-86
WP_000431404.1|2718295_2718982_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|2719079_2719577_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207298.1|2719705_2720989_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001534368.1|2720957_2723591_+	PqiB family protein	NA	NA	NA	NA	NA
WP_024134140.1|2723668_2725108_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131167.1|2725225_2725462_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457838.1|2725572_2725764_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986176.1|2725782_2726433_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_001134857.1|2726655_2726820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182070.1|2727104_2727827_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422887.1|2728511_2728907_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	7.0e-16
WP_000030939.1|2729235_2729712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354401.1|2730099_2730519_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_031607778.1|2731322_2731463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233453.1|2734603_2735518_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2735650_2735809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848065.1|2735818_2736433_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_001237397.1|2736841_2738821_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	2.5e-162
WP_000529516.1|2739216_2740347_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000089420.1|2740633_2741029_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.3	3.7e-17
2741926:2741966	attL	ATTTATAAGAAAAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_043991138.1|2742833_2743634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000161704.1|2744113_2744836_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143174.1|2745043_2745619_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	91.0	1.5e-96
WP_001534305.1|2745618_2747073_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	68.2	1.5e-39
WP_001181747.1|2747062_2747665_-	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.9	3.3e-33
WP_001534351.1|2747666_2748908_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	7.0e-102
WP_001191865.1|2748904_2749261_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_001534334.1|2749273_2749951_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	35.5	2.7e-31
WP_000122818.1|2749931_2750801_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_001534376.1|2750797_2751100_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	1.2e-23
WP_001525483.1|2751099_2751810_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	5.0e-28
WP_001534380.1|2751806_2753978_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	70.2	4.1e-49
WP_000228830.1|2753961_2754144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534365.1|2754185_2754590_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	2.4e-19
WP_000016414.1|2754589_2755036_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_001534340.1|2755036_2756521_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	5.2e-96
WP_000094504.1|2756501_2757047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001048639.1|2757031_2757397_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
WP_001534354.1|2757393_2757978_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	5.5e-17
WP_000537613.1|2757971_2758427_-	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	46.0	9.6e-17
WP_001534319.1|2758433_2758781_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	1.3e-10
WP_001031913.1|2758784_2759813_-	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_001534373.1|2759812_2760295_-	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	6.4e-27
WP_001534359.1|2760296_2761643_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.5	7.1e-68
WP_000552021.1|2761639_2762329_-|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.4	1.5e-58
WP_001534366.1|2762369_2763890_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.7	3.1e-104
WP_001534342.1|2763889_2765509_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	81.4	7.3e-261
WP_001534358.1|2765511_2766141_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	97.6	1.6e-107
WP_001113128.1|2766211_2766394_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001534346.1|2766619_2767084_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	82.4	1.3e-56
WP_001534313.1|2767184_2767724_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.8	3.4e-77
WP_001525456.1|2767701_2768004_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_001534381.1|2768207_2768396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534362.1|2768637_2769192_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	2.8e-55
WP_001534385.1|2769462_2770017_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	64.8	1.1e-62
WP_000861020.1|2770013_2770295_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
WP_021000145.1|2770291_2770486_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_001534379.1|2770482_2771082_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	1.2e-96
WP_079902958.1|2771145_2771394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2772081_2774061_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_043991141.1|2774456_2775587_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001534353.1|2775873_2776269_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
WP_157872077.1|2776281_2776824_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_000729544.1|2776735_2777743_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.8	6.2e-125
WP_001534383.1|2777786_2778281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033911.1|2778267_2778522_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001574209.1|2778620_2779019_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_001669535.1|2779459_2779774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613374.1|2780205_2780490_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_000799627.1|2780564_2780900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057515593.1|2781040_2783746_+	exodeoxyribonuclease VIII	NA	A0A088CD28	Shigella_phage	56.8	2.3e-158
WP_001534364.1|2783738_2784569_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001534356.1|2784615_2784801_+	DUF1187 family protein	NA	NA	NA	NA	NA
WP_043991144.1|2784899_2785316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031617245.1|2785388_2785661_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	4.0e-10
WP_001534378.1|2785641_2786721_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.8	9.7e-100
2786836:2786876	attR	ATTTATAAGAAAAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 9
NZ_CP014996	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 chromosome, complete genome	5047093	2900411	2922292	5047093	plate,transposase	Shigella_phage(40.0%)	15	NA	NA
WP_086011254.1|2900411_2901574_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.5	3.4e-50
WP_000739390.1|2901767_2902733_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000449478.1|2902800_2903097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086011251.1|2903232_2904394_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	6.2e-52
WP_000081842.1|2904509_2905712_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_174372246.1|2905791_2906334_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	47.7	1.4e-17
WP_130559205.1|2906420_2906882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534622.1|2908708_2908921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103450.1|2913192_2915334_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	2.6e-24
WP_001142967.1|2915556_2916075_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000031252.1|2916702_2917206_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000058003.1|2917496_2918969_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611700.1|2918965_2919382_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393864.1|2919386_2921240_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000509050.1|2921203_2922292_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 10
NZ_CP014996	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 chromosome, complete genome	5047093	2987545	3074798	5047093	lysis,tRNA,portal,protease,transposase,holin,tail,terminase	Salmonella_phage(40.74%)	91	NA	NA
WP_086011251.1|2987545_2988708_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	6.2e-52
WP_000374046.1|2989804_2990464_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2990550_2990880_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2990876_2991158_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2991206_2991986_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859417.1|2992011_2992560_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2992774_2993986_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2994043_2994361_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2994405_2994819_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2994992_2995655_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2995749_2996208_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420523.1|2996243_2998298_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	6.5e-20
WP_001261222.1|2998421_2998868_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2998886_3001040_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|3001026_3001632_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|3001848_3002358_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|3002714_3003767_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|3003838_3004291_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156452.1|3004476_3006237_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|3006305_3006824_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|3006923_3007091_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759137.1|3007346_3007910_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|3007906_3009547_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333145.1|3009551_3010805_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|3010819_3012727_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|3012739_3014848_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224074.1|3014946_3016056_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|3016052_3016595_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|3016760_3017771_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193770.1|3017978_3020591_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000497441.1|3021017_3021209_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_086011251.1|3021688_3022851_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	6.2e-52
WP_031603423.1|3023132_3023432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|3023500_3024127_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001534738.1|3024774_3025743_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.1	1.1e-192
WP_000421115.1|3026854_3027373_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
WP_001534724.1|3027387_3030066_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1B0VFW4	Salmonella_phage	64.4	3.0e-150
WP_000178826.1|3030119_3030362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077905120.1|3030400_3031276_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	79.7	1.5e-50
WP_001576012.1|3033822_3034527_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606354.1|3034424_3035162_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	6.1e-114
WP_001152416.1|3035171_3035867_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|3035956_3036490_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|3036606_3037104_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978295.1|3037202_3037535_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_010989010.1|3037531_3040519_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|3040598_3040928_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|3040924_3041323_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|3041368_3042118_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196703.1|3042129_3042531_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000453192.1|3042527_3043094_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000774239.1|3043074_3043374_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107907.1|3043366_3043690_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	1.3e-28
WP_077945123.1|3043780_3045862_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.2	3.5e-263
WP_001009206.1|3045785_3047333_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|3047329_3047536_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|3047532_3049671_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|3049627_3050161_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001534723.1|3050368_3050848_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.7	5.0e-56
WP_000984585.1|3050865_3051318_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.4e-79
WP_001574216.1|3051301_3051631_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|3051906_3052593_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|3052953_3053403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|3053538_3053664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|3053837_3054155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047632.1|3054221_3055019_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	8.9e-151
WP_001617856.1|3055008_3055155_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096550.1|3055151_3055763_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929805.1|3055971_3056574_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|3056656_3056878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|3056989_3057223_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|3057514_3057805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|3057882_3058194_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|3058190_3058538_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|3058548_3059298_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|3059300_3060284_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|3060368_3060743_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|3060708_3060948_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|3061067_3061478_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_010989055.1|3061527_3061788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551856.1|3061780_3061951_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	51.0	8.8e-08
WP_001534728.1|3062091_3065019_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	94.1	0.0e+00
WP_077905121.1|3064981_3066139_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	1.0e-216
WP_001237031.1|3066181_3066421_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3066461_3066710_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|3066754_3068047_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000191409.1|3068241_3069444_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893191.1|3069524_3070958_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544858.1|3071203_3072418_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|3072735_3073197_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117867.1|3073397_3074798_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
>prophage 11
NZ_CP014996	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 chromosome, complete genome	5047093	3122520	3209378	5047093	tRNA,lysis,portal,protease,transposase,tail,terminase	Enterobacteria_phage(31.67%)	91	NA	NA
WP_000886697.1|3122520_3123813_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
WP_000067785.1|3124071_3125415_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
WP_001519746.1|3125424_3126036_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_001535019.1|3126178_3130318_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.9e-88
WP_000228469.1|3130452_3130947_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537406.1|3131493_3132462_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
WP_001044534.1|3132575_3134342_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.6	9.2e-23
WP_001202257.1|3134342_3136064_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.5	6.4e-13
WP_001241650.1|3136108_3136813_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001539595.1|3136813_3137197_+	membrane protein	NA	NA	NA	NA	NA
WP_001040187.1|3137124_3137343_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000597932.1|3137433_3138345_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000809969.1|3138453_3139314_+	pirin family protein	NA	NA	NA	NA	NA
WP_000097893.1|3139333_3140011_+	hydrolase	NA	NA	NA	NA	NA
WP_001117984.1|3141714_3141912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3142122_3144399_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3144429_3144750_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3145073_3145295_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125895.1|3145424_3147371_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001201754.1|3147367_3148486_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_001519667.1|3148631_3149582_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599770.1|3149578_3151237_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000491118.1|3151438_3152338_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_000458776.1|3152481_3154134_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178698.1|3154145_3155114_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815313.1|3155271_3156990_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	1.7e-29
WP_000566346.1|3157028_3158030_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000079019.1|3158040_3159474_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000866904.1|3159569_3160583_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001202294.1|3160579_3161410_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	2.3e-08
WP_001160725.1|3161406_3161730_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_057515227.1|3162059_3162299_+	DinI family protein	NA	K7PKR6	Enterobacteria_phage	87.3	5.5e-32
WP_057515228.1|3162510_3162675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057515232.1|3163172_3163991_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	50.4	1.9e-63
WP_001277616.1|3164063_3164441_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_057515229.1|3164589_3165132_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	66.5	2.3e-70
WP_057515230.1|3165323_3166052_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.0	1.0e-60
WP_057515231.1|3166068_3166482_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	3.2e-19
WP_057517999.1|3167255_3167777_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
WP_057527320.1|3167791_3170470_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1B0VFW4	Salmonella_phage	64.4	3.0e-150
WP_000178849.1|3170523_3170766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057516412.1|3170804_3174167_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.9	0.0e+00
WP_057524907.1|3174229_3174877_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.0e-88
WP_057515768.1|3174774_3175512_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	5.7e-128
WP_001152689.1|3175518_3176217_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|3176226_3176556_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_057515769.1|3176558_3179600_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	64.7	9.8e-291
WP_077905125.1|3179571_3179910_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	63.6	3.5e-32
WP_000479607.1|3179906_3180302_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|3180352_3181099_-	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_057516608.1|3181106_3181508_-|tail	phage tail protein	tail	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
WP_043991247.1|3181616_3182747_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	99.7	4.5e-217
WP_057518682.1|3182795_3183374_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	78.1	1.5e-78
WP_023227232.1|3183383_3183659_-	hypothetical protein	NA	K7PH43	Enterobacteria_phage	42.9	6.0e-14
WP_001107911.1|3183651_3183975_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	63.2	1.0e-28
WP_105937046.1|3184063_3186178_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	K7PGT6	Enterobacteria_phage	71.7	1.2e-274
WP_057516644.1|3186095_3187631_-|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	62.7	6.2e-177
WP_000196423.1|3187627_3187834_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	48.6	1.1e-07
WP_057516645.1|3187830_3189939_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	70.7	4.3e-293
WP_057516646.1|3189925_3190417_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	57.5	7.6e-44
WP_000744510.1|3190768_3190960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057516647.1|3191014_3191518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057516648.1|3191697_3192180_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.5	8.0e-54
WP_057516649.1|3192176_3192791_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	86.3	6.1e-99
WP_057516650.1|3193419_3193845_-	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
WP_071846998.1|3193771_3194326_-	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	63.9	2.0e-48
WP_057516612.1|3194582_3195776_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	65.0	8.4e-145
WP_057516611.1|3195931_3196747_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	73.1	4.0e-114
WP_057515165.1|3196743_3197067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057515164.1|3197069_3198941_-	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	61.1	4.4e-225
WP_057515163.1|3199041_3199953_-	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	74.1	1.7e-52
WP_032652465.1|3200076_3200403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071846997.1|3200524_3200767_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	45.2	1.1e-14
WP_057515161.1|3200850_3201300_+	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	30.9	1.1e-09
WP_057515160.1|3201441_3201858_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	47.7	3.0e-09
WP_057515169.1|3201959_3202154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023228515.1|3202150_3202336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000267316.1|3202523_3202733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077910712.1|3202695_3203073_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	54.8	5.0e-27
WP_057515159.1|3203072_3203309_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	75.3	2.0e-26
WP_057515158.1|3203298_3203694_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	74.6	1.2e-50
WP_077945176.1|3203648_3204503_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	68.9	2.3e-48
WP_077945177.1|3204532_3204910_+	Lar family restriction alleviation protein	NA	NA	NA	NA	NA
WP_057515156.1|3204899_3205325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057515155.1|3205321_3205546_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	69.4	2.9e-19
WP_057515154.1|3205542_3205851_+	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	82.7	4.2e-16
WP_020844552.1|3206062_3206209_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	81.2	1.8e-17
WP_001193375.1|3206218_3206458_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	68.0	2.5e-24
WP_072142541.1|3206483_3207809_+	DUF3596 domain-containing protein	NA	Q20GI2	Phage_258-320	64.0	1.9e-166
WP_001270724.1|3207904_3208420_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027181.1|3208649_3209378_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	6.7e-28
>prophage 12
NZ_CP014996	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 chromosome, complete genome	5047093	3559639	3599517	5047093	head,lysis,portal,protease,transposase,holin,integrase,tail,terminase	Salmonella_phage(59.26%)	56	3559050:3559096	3599531:3599577
3559050:3559096	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_057515762.1|3559639_3561562_+	acyltransferase	NA	C6ZR20	Salmonella_phage	99.2	0.0e+00
WP_072141682.1|3561907_3564025_-|tail	phage tail protein	tail	C6ZR19	Salmonella_phage	99.1	0.0e+00
WP_057515761.1|3564180_3566151_-	hypothetical protein	NA	C6ZR18	Salmonella_phage	99.4	0.0e+00
WP_162847479.1|3566150_3567506_-	phage DNA ejection protein	NA	C6ZR17	Salmonella_phage	97.6	4.1e-241
WP_023206221.1|3567515_3568205_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	99.6	2.3e-102
WP_015995284.1|3568207_3568663_-	DUF2824 family protein	NA	C6ZR15	Salmonella_phage	100.0	2.3e-87
WP_057515760.1|3568662_3569364_-	hypothetical protein	NA	I1TEJ2	Salmonella_phage	99.1	6.1e-71
WP_057515759.1|3569367_3570786_-	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	93.9	3.3e-265
WP_001531195.1|3570794_3571277_-	packaged DNA stabilization gp4 family protein	NA	Q716G8	Shigella_phage	80.5	3.2e-71
WP_001531190.1|3571251_3571437_-	hypothetical protein	NA	Q716G9	Shigella_phage	82.0	7.5e-21
WP_057515758.1|3571476_3572754_-|head	head protein	head	Q9AYZ7	Salmonella_phage	94.5	1.2e-226
WP_057515757.1|3572764_3573649_-	hypothetical protein	NA	Q716H1	Shigella_phage	71.6	2.8e-89
WP_057515756.1|3573662_3575789_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	91.2	0.0e+00
WP_057515755.1|3575791_3577204_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.8	1.5e-278
WP_057515754.1|3577200_3577641_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	99.3	7.7e-80
WP_057515753.1|3577643_3577886_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	3.7e-36
WP_057515752.1|3577989_3578370_-	hypothetical protein	NA	Q716B1	Shigella_phage	98.4	4.2e-66
WP_057515751.1|3578604_3578862_-	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	90.6	2.0e-35
WP_057515750.1|3578858_3579356_-	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	94.5	1.1e-90
WP_057515764.1|3579551_3579989_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.9	3.2e-70
WP_057515763.1|3580077_3580575_-	lysozyme	NA	A0A192Y6U3	Salmonella_phage	98.2	7.1e-90
WP_000286100.1|3580552_3580756_-|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000027545.1|3581247_3581736_-	DUF1133 family protein	NA	I6S672	Salmonella_phage	87.0	3.0e-77
WP_057515749.1|3581732_3581915_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	90.0	1.0e-22
WP_057515747.1|3582353_3582590_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	96.2	8.7e-38
WP_057515746.1|3582582_3582759_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	96.6	9.7e-26
WP_057515745.1|3582751_3583093_-	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	99.1	1.0e-63
WP_000113767.1|3583095_3583272_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	98.3	7.9e-28
WP_071846983.1|3583238_3583412_-	protein ninD	NA	C6ZR56	Salmonella_phage	96.5	9.8e-31
WP_057515744.1|3583408_3583936_-	phage N-6-adenine-methyltransferase	NA	Q9MCP3	Enterobacteria_phage	95.4	3.7e-97
WP_057515743.1|3583932_3584355_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	93.6	7.9e-74
WP_057515742.1|3584357_3584558_-	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	86.4	4.2e-25
WP_057515741.1|3584560_3584833_-	hypothetical protein	NA	H6WZI5	Escherichia_phage	84.3	1.7e-37
WP_057515740.1|3584903_3585209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077945146.1|3585205_3586051_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	72.8	8.1e-110
WP_057515738.1|3586053_3586896_-	replication protein	NA	K7PGT1	Enterobacteria_phage	94.2	8.5e-128
WP_057515737.1|3586882_3587527_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_001103492.1|3587561_3587843_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000067726.1|3587953_3588169_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_023135942.1|3588287_3588950_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	100.0	1.7e-126
WP_057515736.1|3589304_3589607_+	hypothetical protein	NA	I6S5Z3	Salmonella_phage	96.0	7.0e-48
WP_071925521.1|3589685_3590858_+	hypothetical protein	NA	A0A0M4REI4	Salmonella_phage	92.6	9.9e-66
WP_001539177.1|3590926_3591127_+	hypothetical protein	NA	A0A2H4FQS9	Salmonella_phage	100.0	1.6e-32
WP_071846982.1|3591327_3591468_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	82.6	1.0e-17
WP_000361564.1|3591460_3591574_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_057515782.1|3591767_3592475_+	recombinase	NA	C6ZR37	Salmonella_phage	98.3	2.0e-122
WP_000081842.1|3592881_3594084_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_057515780.1|3594293_3594842_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	96.2	2.8e-103
WP_057515779.1|3594855_3595149_+	DUF2856 family protein	NA	I6R984	Salmonella_phage	95.9	2.3e-48
WP_057515778.1|3595159_3595537_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	78.1	5.3e-45
WP_057515777.1|3595541_3596039_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	74.8	3.4e-76
WP_057515776.1|3596035_3596707_+	DUF550 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	64.9	1.5e-90
WP_057515783.1|3596742_3597186_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	82.7	9.0e-44
WP_000509169.1|3597262_3597529_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
WP_001281207.1|3597773_3598124_+	hypothetical protein	NA	I6R980	Salmonella_phage	99.1	5.4e-60
WP_057515775.1|3598353_3599517_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	97.2	9.7e-223
3599531:3599577	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 13
NZ_CP014996	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 chromosome, complete genome	5047093	4303082	4345948	5047093	tRNA,transposase,portal	uncultured_virus(33.33%)	30	NA	NA
WP_000749992.1|4303082_4304048_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	8.2e-66
WP_001188918.1|4304526_4305768_+	multidrug efflux MFS transporter MdtM	NA	NA	NA	NA	NA
WP_001033037.1|4305854_4307126_+	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_000233263.1|4307345_4308530_+	MFS transporter	NA	NA	NA	NA	NA
WP_000068752.1|4309402_4310074_+	YjiH family protein	NA	NA	NA	NA	NA
WP_000211979.1|4310070_4310532_+	membrane protein	NA	NA	NA	NA	NA
WP_001113058.1|4310544_4311717_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_000383513.1|4311835_4312744_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000683248.1|4312749_4313484_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_000907667.1|4313722_4314253_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001094612.1|4314970_4315984_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000841654.1|4315984_4316758_-	Uxu operon transcriptional regulator	NA	NA	NA	NA	NA
WP_000588699.1|4317107_4317782_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_001654330.1|4317778_4318240_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_086011251.1|4318673_4319836_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	6.2e-52
WP_000864865.1|4320971_4321580_-	DUF1062 domain-containing protein	NA	NA	NA	NA	NA
WP_001054380.1|4322068_4322326_+	YjhX family toxin	NA	NA	NA	NA	NA
WP_000979791.1|4322330_4323962_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000532937.1|4324582_4325299_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000081842.1|4325599_4326802_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_000199885.1|4327081_4327957_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_000422448.1|4328034_4328229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062945539.1|4329012_4330215_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_015632990.1|4330306_4333141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000213428.1|4333153_4339474_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	22.0	4.7e-45
WP_001023050.1|4339973_4340993_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001199743.1|4342149_4342458_-	CcdB family protein	NA	NA	NA	NA	NA
WP_000016244.1|4342460_4342700_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_000254752.1|4342812_4343061_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000369883.1|4344922_4345948_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	88.2	6.0e-168
>prophage 1
NZ_CP014997	Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 plasmid unnamed, complete sequence	81966	0	79654	81966	integrase,transposase	Shigella_phage(25.0%)	59	35601:35625	53794:53818
WP_000493752.1|694_1453_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_000537154.1|1610_1895_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	46.0	8.1e-14
WP_077905131.1|1891_2746_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	5.2e-80
WP_000750479.1|2819_3269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000406363.1|3652_4135_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001195099.1|4125_4410_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000929810.1|4721_4982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000145248.1|4978_5941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000534855.1|5925_6204_-	cloacin	NA	NA	NA	NA	NA
WP_001534988.1|7137_8187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000057510.1|8383_10150_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000120481.1|10134_10287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015633273.1|10940_11564_+|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	62.1	1.7e-72
WP_138009944.1|11618_11903_+|transposase	transposase	transposase	S5FM71	Shigella_phage	60.3	3.2e-10
WP_001247111.1|11961_12930_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000792037.1|13896_14112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001004831.1|14101_14353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001064756.1|14429_14657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031011.1|14857_15163_-	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	49.5	9.3e-16
WP_001808376.1|15444_16170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015633268.1|17213_18095_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001541552.1|18075_18153_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_001576653.1|18402_18669_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001068034.1|19521_20253_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	38.1	1.6e-05
WP_000493830.1|20249_20816_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000949140.1|20834_26138_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000056179.1|26137_28372_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_000682256.1|28522_29260_-	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_000081842.1|29928_31131_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.5	4.4e-77
WP_000502119.1|31286_31745_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	D9CGB6	Hyperthermophilic_Archaeal_Virus_2	35.3	5.9e-14
WP_043991282.1|31921_32452_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001135896.1|33021_33855_-	SAM-dependent DNA methyltransferase	NA	H7BVT3	unidentified_phage	37.4	4.5e-12
WP_001159046.1|33901_34048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000550116.1|34142_34490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534946.1|34546_34951_-	hypothetical protein	NA	NA	NA	NA	NA
35601:35625	attL	TTGACATCCTCCACGCCCTGAAGGA	NA	NA	NA	NA
WP_000826380.1|35643_36852_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	91.0	4.7e-204
WP_000872089.1|36942_37296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611690.1|37292_38021_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_077905130.1|38017_38452_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117156.1|38492_40526_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_000203395.1|40595_40838_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000218311.1|40890_41445_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.0	3.3e-51
WP_015633296.1|41679_41961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001534950.1|42137_42455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761849.1|42935_43127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000108572.1|43169_43676_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	28.9	1.1e-08
WP_001158476.1|44081_44861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000274511.1|44915_45335_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104890.1|45345_45567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271045.1|47876_49151_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.2	5.0e-156
WP_000064273.1|49232_50207_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	52.9	2.0e-83
WP_000427674.1|50206_51412_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	1.4e-163
WP_000728920.1|51837_52779_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.0	1.4e-73
WP_000083588.1|52929_53712_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	3.5e-51
WP_001159862.1|54020_54326_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
53794:53818	attR	TTGACATCCTCCACGCCCTGAAGGA	NA	NA	NA	NA
WP_000813644.1|54327_54546_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_086011258.1|55231_56436_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	70.8	1.1e-115
WP_024134209.1|57968_66350_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	28.6	1.9e-190
WP_015633278.1|66349_79654_+	hybrid non-ribosomal peptide synthetase/type I polyketide synthase	NA	A0A2K9KZV5	Tupanvirus	27.6	4.7e-95
