The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007590	Mycoplasma bovis strain HB0801-P150, complete genome	977304	77390	88751	977304	tRNA	Bodo_saltans_virus(28.57%)	8	NA	NA
WP_013954527.1|77390_78371_+	lipoyltransferase	NA	A0A2H4UVX5	Bodo_saltans_virus	27.1	3.9e-15
WP_013954528.1|78374_79196_+	alpha/beta hydrolase	NA	G9E3U1	Emiliania_huxleyi_virus	32.5	2.3e-08
WP_013954529.1|79279_80044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954530.1|80036_81017_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	40.6	8.1e-53
WP_013954531.1|81141_85518_+	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	31.8	6.2e-12
WP_013954532.1|85923_87147_+	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	35.1	1.5e-61
WP_013456569.1|87136_88102_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	40.9	3.6e-29
WP_013954533.1|88091_88751_+	uracil-DNA glycosylase	NA	A0A068EP41	Falconid_herpesvirus	36.4	1.6e-28
>prophage 2
NZ_CP007590	Mycoplasma bovis strain HB0801-P150, complete genome	977304	147598	157204	977304	transposase	Mycoplasma_phage(57.14%)	7	NA	NA
WP_013455927.1|147598_148615_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
WP_014829869.1|148942_150784_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	19.1	2.7e-17
WP_062931844.1|151044_152457_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	68.7	1.6e-81
WP_013954582.1|152440_153277_+	ABC transporter permease	NA	Q6GZ02	Mycoplasma_phage	62.0	1.5e-87
WP_013954583.1|153269_154163_+	spermidine/putrescine ABC transporter permease	NA	Q6GZ01	Mycoplasma_phage	62.1	2.1e-92
WP_013954584.1|154149_156051_+	membrane protein	NA	Q6GZ00	Mycoplasma_phage	34.7	1.8e-80
WP_013455927.1|156187_157204_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.6	8.4e-37
>prophage 3
NZ_CP007590	Mycoplasma bovis strain HB0801-P150, complete genome	977304	257123	352636	977304	integrase,tRNA,transposase	Streptococcus_phage(14.29%)	60	276283:276331	285114:285162
WP_014829889.1|257123_258674_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	35.7	1.9e-80
WP_013456627.1|259481_261671_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	1.0e-71
WP_013456572.1|261673_261916_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_013456283.1|262258_262846_+	guanylate kinase	NA	A0A0M5KCK5	Mollivirus	38.6	1.2e-08
WP_013456579.1|262851_263604_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_013456514.1|263621_264620_+	serine/threonine protein kinase	NA	Q85453	Moloney_murine_sarcoma_virus	32.2	4.3e-17
WP_013456585.1|264631_265477_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_013455939.1|265463_266126_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_041309168.1|268248_268449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456112.1|270987_272421_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_013954662.1|272893_273937_+	ATPase AAA	NA	A0A2H4UTU5	Bodo_saltans_virus	29.0	9.9e-09
276283:276331	attL	ATAATTATGTTTTCTTGTTTTATGCTTAAACTGGGAAACGTAGGAAAAT	NA	NA	NA	NA
WP_013954664.1|276437_279578_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	24.8	2.3e-24
WP_013954665.1|279579_281220_+	SAM-dependent DNA methyltransferase	NA	NA	NA	NA	NA
WP_013954666.1|281206_281758_+	C-terminal truncated type I restriction modification DNA specificity domain-containing protein	NA	NA	NA	NA	NA
WP_013954667.1|281754_282447_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954668.1|282625_283801_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_013954669.1|283874_284843_+|integrase	integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	29.2	3.8e-31
WP_078086164.1|285207_286809_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
285114:285162	attR	ATTTTCCTACGTTTCCCAGTTTAAGCATAAAACAAGAAAACATAATTAT	NA	NA	NA	NA
WP_081124781.1|287333_288113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954672.1|288105_289263_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013954673.1|290208_291828_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	39.8	5.9e-109
WP_013954674.1|292067_294734_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	27.3	4.2e-80
WP_013954675.1|294746_295457_+	signal peptidase II	NA	NA	NA	NA	NA
WP_078086167.1|295717_297319_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_013954660.1|298077_299466_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_013456429.1|299506_301366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954676.1|302315_302912_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_013456191.1|302892_303855_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	26.5	1.5e-06
WP_013456399.1|303891_306258_+	membrane protein	NA	NA	NA	NA	NA
WP_013456468.1|306328_307195_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_013456636.1|307187_308030_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_013456459.1|308061_308949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456065.1|309039_309306_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_013455955.1|309459_310251_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_013456385.1|311627_312602_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_013456634.1|312588_313413_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_013954681.1|313561_315331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954682.1|315370_316438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954683.1|316727_318728_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_013954684.1|318708_319164_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_013954685.1|319153_320629_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	33.5	6.0e-52
WP_013456244.1|320628_321921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954686.1|322279_323299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829901.1|323708_324083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014829902.1|324309_324723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013954689.1|324731_325493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013456216.1|328930_330280_+	NADH oxidase	NA	A0A2K5B2C5	Erysipelothrix_phage	24.0	1.0e-13
WP_013954692.1|330272_331883_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_013954693.1|331947_333387_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_013954694.1|333498_335586_-	peptidase S41	NA	NA	NA	NA	NA
WP_013954695.1|335549_336941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954696.1|336943_339253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954697.1|339571_340933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013954698.1|341452_342286_+	DNA adenine methylase	NA	A0A1S5PRR3	Streptococcus_phage	45.7	3.6e-54
WP_013954699.1|342592_343546_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_013954700.1|343595_344492_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_013954701.1|344525_346400_-	peptidase S41	NA	NA	NA	NA	NA
WP_013954702.1|346423_346927_-	hypothetical protein	NA	S6AVW3	Thermus_phage	32.8	5.6e-10
WP_013954704.1|349215_350580_-	NADH oxidase	NA	NA	NA	NA	NA
WP_078086169.1|351034_352636_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
