The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015099	Glaesserella parasuis strain SC1401 chromosome, complete genome	2277540	9887	17064	2277540		Mannheimia_phage(16.67%)	6	NA	NA
WP_005712614.1|9887_10166_+	peptidase	NA	A0A0M3LQB1	Mannheimia_phage	50.0	5.3e-18
WP_005712616.1|10176_10449_+	HigA family addiction module antidote protein	NA	A0A2P1MXE5	Escherichia_phage	42.5	2.2e-08
WP_021112303.1|10512_11733_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.9	1.7e-39
WP_062923800.1|11742_13230_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.6	1.5e-82
WP_021115958.1|13390_13933_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	56.2	1.9e-43
WP_062923801.1|14235_17064_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	2.9e-305
>prophage 2
NZ_CP015099	Glaesserella parasuis strain SC1401 chromosome, complete genome	2277540	92598	99584	2277540	tail	Mannheimia_phage(75.0%)	8	NA	NA
WP_062923828.1|92598_93123_-	hypothetical protein	NA	Q9FZU3	Neisseria_meningitidis_phage	45.5	1.6e-20
WP_062924483.1|93176_93680_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	49.4	1.5e-31
WP_062924482.1|93709_94471_-	C40 family peptidase	NA	A0A0M3LQI5	Mannheimia_phage	48.8	1.1e-65
WP_021113607.1|94556_94733_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M3LQ86	Mannheimia_phage	63.2	8.5e-14
WP_021113608.1|94779_95193_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PH90	Moraxella_phage	53.7	7.1e-35
WP_062923829.1|95189_95927_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	54.1	3.0e-68
WP_062923830.1|95936_98516_-	hypothetical protein	NA	A0A0M3LS69	Mannheimia_phage	50.0	6.7e-06
WP_081120179.1|98546_99584_-	tape measure protein	NA	A0A0M3LQV7	Mannheimia_phage	70.9	7.4e-81
>prophage 3
NZ_CP015099	Glaesserella parasuis strain SC1401 chromosome, complete genome	2277540	601289	645107	2277540	transposase,tRNA,protease	Bacillus_phage(27.27%)	40	NA	NA
WP_021118670.1|601289_602504_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_021111697.1|602506_603394_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_021114545.1|603677_604976_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	37.0	6.4e-74
WP_021114544.1|605140_606358_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_021111694.1|606434_606809_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_062923966.1|608532_609972_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062923967.1|610810_611149_+	toxin	NA	NA	NA	NA	NA
WP_021117805.1|611152_611461_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010786053.1|611661_612822_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_005710402.1|612921_613503_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_005710401.1|613563_614499_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	37.4	4.0e-41
WP_005710400.1|614498_614987_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_005710399.1|615514_616813_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_010786060.1|616899_617433_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	32.3	2.6e-21
WP_021112014.1|617521_618160_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_005710396.1|618172_618973_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.9	3.9e-13
WP_005710395.1|619145_620225_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_021119409.1|620329_621505_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_035492319.1|621743_623132_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_010786065.1|623296_623491_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_005710391.1|623499_624240_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_021112009.1|624286_624949_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_062923968.1|624958_625585_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	NA	NA	NA	NA
WP_021113223.1|625585_626296_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_021113230.1|626387_627071_-	nicotinamide riboside transporter PnuC	NA	U5J9C5	Bacillus_phage	38.2	7.9e-39
WP_021113241.1|627214_628996_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	32.4	1.0e-66
WP_021119405.1|629213_631079_+	signal peptide peptidase SppA	NA	A0A2H4UUF9	Bodo_saltans_virus	21.8	8.5e-11
WP_021114535.1|631213_632254_+	DUF4115 domain-containing protein	NA	NA	NA	NA	NA
WP_021112005.1|632255_633365_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_021117792.1|634472_635300_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_062923969.1|635502_636144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021112000.1|636143_637127_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_062923970.1|637144_637819_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_021117791.1|637840_638737_-	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	30.5	3.2e-24
WP_062923971.1|639158_640115_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_062923972.1|640735_641689_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_005713507.1|641774_642635_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_021118421.1|643959_644283_+|transposase	transposase	transposase	Q716C1	Shigella_phage	44.9	3.7e-15
WP_071610673.1|644321_644747_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.8	8.4e-07
WP_106379859.1|644801_645107_+|transposase	transposase	transposase	Q716C2	Shigella_phage	57.7	4.0e-27
>prophage 4
NZ_CP015099	Glaesserella parasuis strain SC1401 chromosome, complete genome	2277540	1626856	1693347	2277540	terminase,integrase,tail,tRNA,capsid,transposase	Mannheimia_phage(60.87%)	78	1632826:1632854	1699920:1699948
WP_062924251.1|1626856_1627312_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_062924252.1|1627367_1628033_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_062924253.1|1628032_1628626_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_062924254.1|1628625_1629876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021118751.1|1630060_1631155_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_021112912.1|1631222_1631678_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_062924255.1|1631759_1632812_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
1632826:1632854	attL	TTGTAGGGACACACTGCGTGTGTCCGTTA	NA	NA	NA	NA
WP_062924256.1|1632906_1634193_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_021112913.1|1634468_1635365_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_035522471.1|1635705_1636563_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	37.3	6.4e-54
WP_021111166.1|1637148_1637823_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	58.2	2.3e-59
WP_021112950.1|1637942_1638749_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_035497322.1|1639273_1639534_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_021112925.1|1639563_1640028_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_021117448.1|1640048_1640666_-	VOC family protein	NA	NA	NA	NA	NA
WP_062924257.1|1640702_1642430_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	34.8	6.1e-88
WP_062924260.1|1644143_1646321_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_005713131.1|1646324_1646804_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_062924262.1|1648172_1648586_-	DUF2251 domain-containing protein	NA	NA	NA	NA	NA
WP_062924263.1|1648659_1649955_-	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_062924264.1|1650021_1650624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021119057.1|1650780_1651122_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021116146.1|1651291_1652728_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_021111730.1|1653026_1653452_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_062924266.1|1654468_1657747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043896063.1|1657823_1658204_-	YacL family protein	NA	NA	NA	NA	NA
WP_157876242.1|1658502_1659201_-	hypothetical protein	NA	A0A0M3LQ61	Mannheimia_phage	51.8	4.9e-52
WP_016527932.1|1659880_1660159_+	plasmid maintenance protein ParE	NA	A0A0M3LQB1	Mannheimia_phage	50.0	4.0e-18
WP_005714478.1|1660170_1660452_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	36.6	2.3e-08
WP_062924267.1|1660448_1661186_-|tail	phage minor tail protein L	tail	A0A0M3LSQ5	Mannheimia_phage	54.1	3.0e-68
WP_062924268.1|1661195_1664456_-	tape measure protein	NA	A0A0M3LS69	Mannheimia_phage	36.4	8.4e-155
WP_062924269.1|1664580_1665105_-	hypothetical protein	NA	A5VW78	Enterobacteria_phage	43.9	5.1e-30
WP_021118484.1|1665239_1665500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062924270.1|1665553_1665880_-|tail	phage tail protein	tail	A0A0M3LQW6	Mannheimia_phage	65.4	3.7e-39
WP_062924271.1|1665881_1666217_-	hypothetical protein	NA	A0A0M3LQT0	Mannheimia_phage	64.8	3.5e-32
WP_062924272.1|1666225_1666630_-	hypothetical protein	NA	A0A0M3LPJ3	Mannheimia_phage	61.9	1.9e-40
WP_062924273.1|1666645_1667650_-	hypothetical protein	NA	A0A0M3LQ19	Mannheimia_phage	71.9	2.1e-133
WP_062924274.1|1667652_1668054_-	hypothetical protein	NA	A0A0M3LQB6	Mannheimia_phage	50.0	8.4e-33
WP_021109525.1|1668053_1668467_-	HK97 gp10 family phage protein	NA	A0A0M3LPJ5	Mannheimia_phage	61.0	2.1e-42
WP_062924503.1|1668468_1668840_-	hypothetical protein	NA	A0A0M3LT14	Mannheimia_phage	48.4	6.6e-24
WP_035519592.1|1668848_1669310_-	hypothetical protein	NA	A0A0M3LSP7	Mannheimia_phage	57.9	2.7e-35
WP_016527890.1|1669284_1669626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062924275.1|1669711_1670650_-	Ig domain-containing protein	NA	A0A0D4DBM4	Acinetobacter_phage	63.8	1.0e-113
WP_062924276.1|1670661_1671420_-	hypothetical protein	NA	A0A0M3LQV7	Mannheimia_phage	73.9	6.2e-77
WP_021112316.1|1671542_1671962_-	HD domain-containing protein	NA	D0UIJ3	Aggregatibacter_phage	62.5	9.7e-40
WP_021111144.1|1671961_1672180_-	hypothetical protein	NA	A0A0M3LPI7	Mannheimia_phage	75.0	1.9e-26
WP_062924277.1|1672179_1673829_-|capsid	minor capsid protein	capsid	A0A0M3LQ07	Mannheimia_phage	64.2	2.1e-199
WP_062924278.1|1673785_1675183_-	DUF4055 domain-containing protein	NA	A0A0M3LQA1	Mannheimia_phage	64.8	5.0e-165
WP_062924279.1|1675192_1676428_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0M3LTA2	Mannheimia_phage	79.2	8.5e-193
WP_062924280.1|1676411_1676927_-|terminase	terminase small subunit	terminase	A0A0M3LPC3	Mannheimia_phage	69.0	3.8e-54
WP_062924281.1|1677491_1677836_-	DUF2570 domain-containing protein	NA	A0A0M3LSP1	Mannheimia_phage	60.7	1.7e-05
WP_062924282.1|1677808_1678354_-	lysozyme	NA	Q19UR6	Mannheimia_phage	49.7	4.2e-43
WP_062924504.1|1678328_1678616_-	hypothetical protein	NA	A0A0M3LR95	Mannheimia_phage	53.3	2.0e-12
WP_062924283.1|1678885_1679347_-	antitermination protein	NA	A0A0M3LPW4	Mannheimia_phage	37.7	3.9e-18
WP_062924284.1|1679336_1679915_-	recombination protein NinG	NA	A0A0U4KL68	Pseudomonas_phage	55.6	4.4e-51
WP_005715063.1|1680162_1680345_+	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	74.6	4.5e-18
WP_021113997.1|1680371_1680785_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	55.5	1.4e-38
WP_081120202.1|1680818_1681268_-	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	61.4	1.4e-44
WP_081120203.1|1681502_1681949_-	hypothetical protein	NA	A0A0M3LS65	Mannheimia_phage	40.9	5.1e-23
WP_062924286.1|1681896_1682115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075593099.1|1682114_1682900_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	71.3	2.7e-27
WP_062924506.1|1682896_1683583_-	antirepressor	NA	D0UIL6	Aggregatibacter_phage	57.4	7.1e-64
WP_021118902.1|1683622_1683868_-	bacteriophage CII family protein	NA	A0A0M3LTF5	Mannheimia_phage	62.5	9.7e-16
WP_021113991.1|1683888_1684104_-	helix-turn-helix domain-containing protein	NA	Q19UN8	Mannheimia_phage	55.6	5.0e-08
WP_021113990.1|1684246_1684915_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PHY1	Moraxella_phage	27.1	2.4e-16
WP_062924287.1|1685018_1685906_+	hypothetical protein	NA	Q7Y5W6	Haemophilus_phage	32.1	5.8e-26
WP_021118903.1|1685915_1686350_+	hypothetical protein	NA	Q7Y5W7	Haemophilus_phage	60.4	2.5e-38
WP_021112699.1|1686378_1686585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021112693.1|1686967_1687114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021113986.1|1687316_1687553_+	hypothetical protein	NA	A0A0M3LPU3	Mannheimia_phage	41.0	2.4e-11
WP_021112128.1|1687549_1687816_-	CRISPR associated Cas2 family protein	NA	NA	NA	NA	NA
WP_157834279.1|1688041_1688209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012621817.1|1688501_1688720_-	hypothetical protein	NA	A0A0M3LQV3	Mannheimia_phage	77.8	5.2e-21
WP_021113984.1|1689287_1690088_+	kilA-N domain protein	NA	A0A0P0ZCS0	Stx2-converting_phage	46.3	5.6e-12
WP_062924288.1|1690292_1690508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071610308.1|1690825_1691131_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062924289.1|1691034_1692090_+|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	36.8	2.1e-59
WP_005712159.1|1692492_1693347_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.5	1.8e-32
1699920:1699948	attR	TTGTAGGGACACACTGCGTGTGTCCGTTA	NA	NA	NA	NA
>prophage 5
NZ_CP015099	Glaesserella parasuis strain SC1401 chromosome, complete genome	2277540	1696519	1704949	2277540		Staphylococcus_phage(50.0%)	7	NA	NA
WP_062924291.1|1696519_1697311_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.0	1.4e-10
WP_042905789.1|1697422_1697884_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	58.8	1.3e-42
WP_005712143.1|1697976_1699176_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.7	2.6e-98
WP_062924292.1|1699264_1699909_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.2	5.5e-42
WP_021113973.1|1700000_1701104_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	39.1	1.0e-51
WP_021113972.1|1701572_1703447_-	PPIC-type PPIASE domain protein	NA	NA	NA	NA	NA
WP_042905784.1|1703629_1704949_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	34.8	2.6e-30
>prophage 6
NZ_CP015099	Glaesserella parasuis strain SC1401 chromosome, complete genome	2277540	2031109	2040874	2277540	tRNA	Mollivirus(12.5%)	9	NA	NA
WP_012621871.1|2031109_2032624_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.2	4.1e-80
WP_005710639.1|2032754_2033339_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	40.5	2.2e-29
WP_021113657.1|2033355_2034009_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.0	1.1e-34
WP_021113656.1|2034198_2034711_-	lipoprotein spr	NA	A0A0K2SUC1	Clostridium_phage	40.0	4.1e-16
WP_021113655.1|2034762_2035059_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	41.1	1.2e-12
WP_021119133.1|2035075_2037463_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	8.1e-06
WP_021112442.1|2037618_2038602_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	7.1e-33
WP_005714552.1|2038911_2039592_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_021112462.1|2039611_2040874_+	inorganic phosphate transporter	NA	E5ES24	Ostreococcus_lucimarinus_virus	35.3	3.3e-59
>prophage 7
NZ_CP015099	Glaesserella parasuis strain SC1401 chromosome, complete genome	2277540	2084583	2196429	2277540	integrase,terminase,portal,plate,tail,head,tRNA,capsid,transposase,protease	Mannheimia_phage(46.34%)	111	2107901:2107925	2187463:2187487
WP_062924406.1|2084583_2085501_+|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_062924513.1|2085510_2086593_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_021119113.1|2086602_2087421_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	37.6	1.0e-08
WP_062924408.1|2089011_2090226_+	amino acid permease	NA	NA	NA	NA	NA
WP_062924409.1|2090373_2091591_+	tyrosine transporter	NA	NA	NA	NA	NA
WP_005714346.1|2091732_2092263_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_062924410.1|2092349_2093294_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_021109591.1|2093408_2094431_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	33.8	3.5e-35
WP_021110885.1|2094441_2095038_+	DedA family protein	NA	NA	NA	NA	NA
WP_062924411.1|2095220_2096312_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_062924412.1|2096421_2098401_-	exoribonuclease II	NA	NA	NA	NA	NA
WP_062924413.1|2098615_2098960_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_012621770.1|2098962_2099259_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071610276.1|2099384_2100449_-	DUF3944 domain-containing protein	NA	NA	NA	NA	NA
WP_043894462.1|2100595_2101018_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005714049.1|2101134_2101923_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062924414.1|2102235_2102862_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_062924514.1|2102935_2104864_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	43.2	9.1e-117
WP_016527818.1|2104826_2105075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062924415.1|2105195_2107109_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.8	1.2e-68
WP_012621765.1|2107188_2107812_+	MarC family protein	NA	NA	NA	NA	NA
2107901:2107925	attL	GCGGACACACGCAGTGTGTCCCTAC	NA	NA	NA	NA
WP_062924416.1|2107947_2109180_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_021110873.1|2109625_2110843_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	34.5	4.6e-58
WP_157876238.1|2110880_2111141_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_062924418.1|2111106_2111403_-	hypothetical protein	NA	Q19US5	Mannheimia_phage	58.3	4.6e-20
WP_062924419.1|2111421_2111613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062924420.1|2111621_2113937_-	replication endonuclease	NA	Q19US8	Mannheimia_phage	46.0	3.1e-188
WP_042905896.1|2113929_2114208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021113133.1|2114197_2114479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021113116.1|2114489_2114711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062924421.1|2114857_2115283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062924422.1|2115292_2115613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157876239.1|2115688_2115835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021115793.1|2116154_2116547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062924423.1|2116664_2116967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062924424.1|2116983_2117301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062924425.1|2117395_2117791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021113042.1|2117765_2117915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021113068.1|2117951_2118146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021113122.1|2118274_2118736_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062924426.1|2118744_2119896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062924427.1|2119939_2120728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062924428.1|2120724_2121075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062924429.1|2121096_2121546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062924430.1|2121545_2121998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062924431.1|2122176_2122533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062924432.1|2122734_2123517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062924433.1|2123550_2123775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062924434.1|2123791_2124934_-	phage late control D family protein	NA	R9QBT3	Mannheimia_phage	66.9	1.7e-142
WP_021113040.1|2124930_2125368_-|tail	phage tail protein	tail	A0A0M3LQ18	Mannheimia_phage	62.1	1.0e-47
WP_071610269.1|2125444_2125564_-|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	61.5	1.3e-05
WP_075592820.1|2125572_2125908_-|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	46.7	7.6e-11
WP_021113117.1|2125959_2126469_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	53.5	1.0e-43
WP_062924435.1|2126524_2127694_-|tail	phage tail sheath protein	tail	E5E3Q3	Burkholderia_phage	56.7	1.2e-127
WP_021113064.1|2127797_2128067_-	hypothetical protein	NA	A0A0M3LNN9	Mannheimia_phage	83.5	9.9e-38
WP_062924436.1|2128053_2128617_-	DUF4376 domain-containing protein	NA	F6MIL9	Haemophilus_phage	92.9	4.9e-95
WP_021110846.1|2131253_2131793_-|tail	phage tail protein I	tail	Q19UQ4	Mannheimia_phage	55.8	3.7e-52
WP_062924437.1|2131782_2132697_-|plate	baseplate assembly protein	plate	Q19UQ5	Mannheimia_phage	66.4	3.0e-110
WP_021117005.1|2132693_2133035_-	lysozyme family protein	NA	A0A0M3LQ08	Mannheimia_phage	66.7	1.4e-28
WP_075592822.1|2133034_2133607_-|plate	phage baseplate assembly protein V	plate	A0A0M3LPY9	Mannheimia_phage	60.6	2.4e-41
WP_021115814.1|2133732_2133930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021110841.1|2134043_2134418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021113101.1|2134398_2134596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062924439.1|2134690_2137459_-|tail	phage tail tape measure protein	tail	V5YUN9	Pseudomonas_phage	31.6	4.6e-77
WP_021118212.1|2137496_2137751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062924440.1|2137776_2138238_-	phage virion morphogenesis protein	NA	Q19UR2	Mannheimia_phage	62.0	1.0e-42
WP_035522656.1|2138237_2138714_-|tail	phage tail protein	tail	Q19UR3	Mannheimia_phage	52.9	2.5e-39
WP_021115818.1|2138710_2138929_-	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	71.2	3.1e-21
WP_062924441.1|2139044_2139497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062924442.1|2139850_2140318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021118207.1|2140302_2140827_-	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	57.9	6.9e-51
WP_043895751.1|2140810_2141032_-	hypothetical protein	NA	Q19UR7	Mannheimia_phage	43.9	3.7e-06
WP_021116997.1|2141037_2141244_-	phage Tail protein X family protein	NA	A0A0M3LPY0	Mannheimia_phage	59.7	1.4e-12
WP_062924443.1|2141243_2141720_-|head	head completion/stabilization protein	head	A0A0M3LNL8	Mannheimia_phage	53.9	7.1e-39
WP_021113131.1|2141835_2142489_-|terminase	phage small terminase subunit	terminase	A4JWP8	Burkholderia_virus	42.5	3.4e-39
WP_062924444.1|2142488_2143538_-|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	51.3	1.5e-92
WP_010786756.1|2143550_2144366_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3LSA0	Mannheimia_phage	44.1	1.1e-50
WP_062924445.1|2144533_2146312_+|terminase	terminase	terminase	A0A0M3LRV4	Mannheimia_phage	66.1	1.5e-219
WP_062924446.1|2146319_2147291_+|portal	phage portal protein	portal	Q19UT6	Mannheimia_phage	61.0	1.1e-115
WP_021114907.1|2147872_2148643_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_062924447.1|2148769_2150773_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_062924448.1|2151301_2152450_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.5	1.2e-129
WP_062924449.1|2152982_2158517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711610.1|2158849_2159560_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_005711608.1|2159627_2160137_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	32.5	4.0e-11
WP_062924450.1|2160230_2161325_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_010786882.1|2161444_2162410_-	asparaginase	NA	NA	NA	NA	NA
WP_062924451.1|2162410_2162905_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_062924452.1|2163286_2165944_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_062924453.1|2166093_2167998_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_010786886.1|2168115_2169540_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.5	3.2e-42
WP_062924454.1|2169670_2171980_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_062924455.1|2172161_2172431_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_016527721.1|2172596_2173583_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	32.7	7.4e-22
WP_021118971.1|2173872_2174232_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_021113580.1|2174482_2175376_+	DMT family transporter	NA	NA	NA	NA	NA
WP_062924515.1|2175379_2176087_+	DUF218 domain-containing protein	NA	NA	NA	NA	NA
WP_021113578.1|2176184_2176757_+	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_021110807.1|2176762_2177212_+	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_062924456.1|2177214_2178582_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_062924457.1|2178649_2180983_+	LPS assembly protein LptD	NA	NA	NA	NA	NA
WP_035494749.1|2181068_2183303_+	response regulator	NA	A0A1V0SGX0	Hokovirus	30.0	2.5e-41
WP_021110803.1|2183461_2183824_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_021113574.1|2183870_2185517_+	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_043896688.1|2187641_2189435_+	ABC transporter ATP-binding protein/permease	NA	A0A1V0SE00	Indivirus	26.2	7.2e-07
2187463:2187487	attR	GTAGGGACACACTGCGTGTGTCCGC	NA	NA	NA	NA
WP_021112352.1|2189458_2189776_-	XRE family transcriptional regulator	NA	A0A1S5R3V5	Pseudomonas_phage	44.7	2.3e-09
WP_021116971.1|2189772_2190114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021113569.1|2190450_2192580_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_021118187.1|2192653_2193580_+	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_021118186.1|2193962_2195795_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	34.0	1.9e-55
WP_043894448.1|2195892_2196429_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	32.0	3.1e-06
