The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	113480	163562	2172287	tRNA,transposase	Bacillus_phage(50.0%)	47	NA	NA
WP_062903768.1|113480_114752_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_046871806.1|114865_117187_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.7	7.4e-81
WP_046871805.1|117228_117741_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_046871804.1|117972_118818_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_081196365.1|118967_120038_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_046871802.1|120131_120491_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_081196312.1|120559_121657_+	lactonase family protein	NA	NA	NA	NA	NA
WP_046871837.1|121690_122329_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_046871800.1|122389_123742_-	magnesium transporter	NA	NA	NA	NA	NA
WP_046871799.1|123760_124666_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_062909579.1|124655_125462_-	NAD kinase	NA	NA	NA	NA	NA
WP_145912963.1|125468_126116_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_046871796.1|126393_127008_+	DsbA family protein	NA	NA	NA	NA	NA
WP_046871795.1|127085_128888_-	oligoendopeptidase F	NA	NA	NA	NA	NA
WP_145974380.1|128932_130099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056986055.1|130149_130866_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_056986056.1|130991_131390_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_046871792.1|131721_132462_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_056986581.1|132689_133199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871790.1|133279_135298_-	copper-translocating P-type ATPase	NA	M1HN09	Paramecium_bursaria_Chlorella_virus	22.9	2.5e-24
WP_046871789.1|135294_135723_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_062903774.1|135861_136122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046872486.1|142902_143298_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046872485.1|143411_144056_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_062909580.1|144138_144762_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_046872483.1|144766_145537_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_046872482.1|145547_146150_-	YutD family protein	NA	NA	NA	NA	NA
WP_046872481.1|146189_146798_-	metallophosphoesterase family protein	NA	A0A288TXW7	Enterococcus_phage	35.6	1.3e-29
WP_046872480.1|146933_148310_-	amino acid permease	NA	NA	NA	NA	NA
WP_046872479.1|148400_149348_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_145912922.1|149475_149730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046872477.1|149764_150175_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_158509308.1|150167_150338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017866964.1|150432_150690_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
WP_145912937.1|150674_151559_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	48.3	1.7e-65
WP_056986372.1|151679_152117_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_046872474.1|152125_152434_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_063510372.1|152430_153387_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_062903779.1|153418_154405_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_062903780.1|154511_155246_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_080945536.1|155527_156346_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_100078183.1|156851_157448_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_046871679.1|158434_159733_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_046871678.1|159752_160925_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_017866964.1|161197_161455_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
WP_145912924.1|161439_162324_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	47.9	8.3e-65
WP_081196315.1|162440_163562_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.7	4.8e-09
>prophage 2
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	176640	218982	2172287	head,transposase,portal,integrase,tail,terminase,capsid,bacteriocin	Lactobacillus_phage(27.78%)	45	170648:170664	224108:224124
170648:170664	attL	CTCACTTAATATTTTTG	NA	NA	NA	NA
WP_062904280.1|176640_177888_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.7	5.3e-09
WP_062903784.1|178021_178444_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_046872494.1|178457_179870_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_046872493.1|179896_180844_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_062903785.1|180882_182415_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_046872491.1|182444_182987_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_062903786.1|182973_183498_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_046872489.1|183548_183761_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_062903787.1|183787_184507_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_046872235.1|184884_185514_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_062909582.1|185586_186825_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	51.0	5.3e-94
WP_062903789.1|186837_187860_-	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	39.0	3.9e-50
WP_046872232.1|187849_188728_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_046872231.1|188720_189803_-	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_062909583.1|189802_190393_-	thymidine kinase	NA	E0YIP8	Lactococcus_phage	51.6	2.6e-46
WP_046872229.1|190609_191956_+	Mur ligase family protein	NA	NA	NA	NA	NA
WP_046872228.1|191956_192661_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_062903791.1|192721_193693_-	mannose-6-phosphate isomerase, class I	NA	NA	NA	NA	NA
WP_046872226.1|193798_194812_-	serine hydrolase	NA	NA	NA	NA	NA
WP_046872225.1|194930_196814_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	33.5	8.8e-64
WP_062903792.1|196806_198549_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.5	3.1e-39
WP_046870796.1|198549_199212_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046870797.1|199403_200057_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.3	1.9e-26
WP_046870798.1|200058_200769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903793.1|200752_201403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903794.1|201463_202264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052694459.1|202337_202766_-	DUF2712 domain-containing protein	NA	NA	NA	NA	NA
WP_046870802.1|203202_203538_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_062904282.1|203701_204949_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.3	1.5e-08
WP_062903795.1|205494_205776_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6J1Y1	Lactobacillus_phage	36.6	2.5e-07
WP_062903796.1|205842_207396_-|capsid	phage major capsid protein	capsid	I7B7B0	Enterococcus_phage	34.1	5.4e-35
WP_062903797.1|207392_208571_-|portal	phage portal protein	portal	A0A1W6JPW5	Staphylococcus_phage	35.6	9.4e-56
WP_057773520.1|208573_208753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081196366.1|208718_210341_-|terminase	terminase large subunit	terminase	E9LUI0	Lactobacillus_phage	41.3	1.5e-112
WP_100078221.1|210476_211545_+|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	6.3e-35
WP_158509309.1|211603_212074_-|terminase	phage terminase small subunit P27 family	terminase	M1PKP2	Streptococcus_phage	28.0	3.4e-09
WP_081196367.1|212242_212608_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	41.7	3.1e-18
WP_062909585.1|212616_212952_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_062903801.1|212980_213259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903802.1|213600_215982_-	hypothetical protein	NA	Q9T0Y1	Lactobacillus_phage	32.5	1.1e-106
WP_062903803.1|216044_216353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903804.1|216547_216820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903805.1|216819_217008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063510394.1|217158_217773_+	helix-turn-helix domain-containing protein	NA	Q20DG0	Lactobacillus_phage	54.7	1.9e-12
WP_062903806.1|217830_218982_+|integrase	site-specific integrase	integrase	U3PCM7	Lactobacillus_phage	33.6	3.2e-40
224108:224124	attR	CTCACTTAATATTTTTG	NA	NA	NA	NA
>prophage 3
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	225281	285952	2172287	tRNA,transposase,protease	Streptococcus_phage(17.65%)	57	NA	NA
WP_046872291.1|225281_226649_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_046870809.1|227038_227905_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_062904285.1|227964_229410_-	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	28.1	1.2e-15
WP_046870810.1|229418_230144_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	2.1e-34
WP_046870811.1|230360_230549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155386934.1|230587_230755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046870812.1|231006_232701_-	oleate hydratase	NA	NA	NA	NA	NA
WP_062903809.1|232849_232978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046870814.1|233313_233586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046870815.1|233633_233996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046870816.1|234308_234575_+	membrane protein	NA	NA	NA	NA	NA
WP_162841290.1|235116_235266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100078369.1|235478_235643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046870817.1|235710_236523_+	LicD family protein	NA	A0A1V0SD50	Indivirus	36.7	8.5e-08
WP_062909586.1|236576_238238_-	oleate hydratase	NA	NA	NA	NA	NA
WP_046870819.1|238330_238663_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046870820.1|238801_239701_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_062903811.1|239744_240362_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_046870822.1|240599_241412_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_046870823.1|241614_242295_+	YxeA family protein	NA	NA	NA	NA	NA
WP_046870824.1|242307_243009_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_056986073.1|243283_244660_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	2.0e-12
WP_046870826.1|245049_245355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080945482.1|245769_245949_-	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_062903812.1|245917_247054_-	glucosaminidase domain-containing protein	NA	H7BVI1	unidentified_phage	32.9	1.3e-06
WP_046870827.1|247299_249120_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	39.6	9.9e-105
WP_046870828.1|249345_250710_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_062903813.1|250734_251595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062909587.1|251591_252443_-	TIGR00159 family protein	NA	NA	NA	NA	NA
WP_046870831.1|252663_253320_+	DUF1361 domain-containing protein	NA	NA	NA	NA	NA
WP_062909588.1|253388_254774_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.2	5.1e-29
WP_046871552.1|255260_256208_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_046871553.1|256292_257207_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_046871554.1|257311_257848_+	3'-5' exonuclease	NA	A0A0A8WJ41	Clostridium_phage	25.6	3.6e-07
WP_046871555.1|257840_258350_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046871556.1|258346_258817_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_046871557.1|258820_259543_-	uracil-DNA glycosylase	NA	E2IUG8	Saimiriine_herpesvirus	43.2	2.3e-41
WP_046871559.1|260580_261153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871560.1|261165_261732_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046871561.1|261862_263290_+	APC family permease	NA	NA	NA	NA	NA
WP_046871562.1|263353_263827_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	59.1	4.3e-44
WP_062903816.1|263840_266213_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.6	3.5e-86
WP_046871564.1|266285_266522_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_062903817.1|268327_269761_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_046871567.1|270122_271442_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	68.0	1.2e-171
WP_046871568.1|271513_272269_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_046871569.1|272351_273554_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_062909590.1|273679_274702_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_056986068.1|274768_275797_-	SorC family transcriptional regulator	NA	NA	NA	NA	NA
WP_062903741.1|276028_277396_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_046871573.1|277557_278892_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_046871572.1|279471_280068_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	53.8	6.8e-55
WP_062904280.1|280185_281433_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.7	5.3e-09
WP_062903818.1|281587_282517_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.1	7.9e-50
WP_062909591.1|282554_283565_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	55.6	2.0e-94
WP_046871918.1|283561_284455_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.8	5.0e-09
WP_062903819.1|284584_285952_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	329772	458832	2172287	head,transposase,portal,integrase,tail,protease,terminase,capsid,tRNA	Streptococcus_phage(12.82%)	119	321803:321820	449703:449720
321803:321820	attL	TATTTTTATGGAAATTAA	NA	NA	NA	NA
WP_062903807.1|329772_331044_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_046871064.1|331091_332087_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	40.0	2.5e-54
WP_062903831.1|332150_332909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080945500.1|333063_333981_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	58.4	1.2e-85
WP_046871061.1|333967_334312_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_046871060.1|334350_335358_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_062903832.1|335381_335711_-	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_046871059.1|335716_336370_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	49.5	7.2e-50
WP_046871058.1|336434_337034_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_062909594.1|337049_337364_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_046871056.1|337383_339171_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	43.6	7.0e-55
WP_046871055.1|339361_339880_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	39.7	5.1e-06
WP_046871054.1|340792_341023_+	redoxin NrdH	NA	X2KRY7	Enterococcus_phage	44.0	1.2e-12
WP_062903833.1|341132_343298_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	60.9	8.6e-257
WP_046871069.1|343323_344343_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	60.4	1.8e-111
WP_062903834.1|344406_344985_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	35.7	7.6e-19
WP_046871051.1|345046_346294_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_046871050.1|346404_347247_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_046871049.1|347825_348194_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_046871048.1|348230_348737_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_062903836.1|348935_349625_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_046871046.1|349713_350139_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_046871045.1|350295_350844_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_046871044.1|350987_351155_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_080945499.1|351168_351318_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_046872025.1|351441_352038_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_062903837.1|352185_352974_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_046872023.1|352960_353380_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_046872022.1|353383_354790_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	31.1	1.8e-50
WP_046872021.1|354949_356437_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L0I5	Tupanvirus	33.6	7.5e-10
WP_056986242.1|356559_357702_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_046872019.1|358046_359417_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_046872018.1|359503_360040_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	52.3	3.9e-41
WP_052694540.1|360231_360576_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_046872017.1|360562_361249_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_046872016.1|361302_362685_+	C1 family peptidase	NA	A0A2H4UTL8	Bodo_saltans_virus	28.0	1.6e-43
WP_046872014.1|363982_365026_-	DMT family transporter	NA	NA	NA	NA	NA
WP_056986256.1|365115_366069_-	AEC family transporter	NA	NA	NA	NA	NA
WP_080945559.1|366250_367336_+	LCP family protein	NA	NA	NA	NA	NA
WP_062903838.1|367385_368165_-	carboxyltransferase	NA	NA	NA	NA	NA
WP_062903839.1|368157_368955_-	acetyl-CoA carboxyl transferase	NA	NA	NA	NA	NA
WP_062903840.1|368938_370282_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_100078167.1|370274_370628_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_062904287.1|370686_371667_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_046872007.1|371868_372369_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_046872006.1|372371_372785_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_046872005.1|372815_373187_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_062903841.1|373206_373620_-	DUF956 family protein	NA	NA	NA	NA	NA
WP_062903842.1|373777_374722_-	PTS mannose/fructose/sorbose transporter family subunit IID	NA	NA	NA	NA	NA
WP_046872002.1|374738_375563_-	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_046872001.1|375593_376565_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_081212591.1|376794_379347_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_081212593.1|379400_379691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046871999.1|379905_381078_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_062904280.1|381242_382490_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.7	5.3e-09
WP_057773514.1|383034_383316_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6J1Y1	Lactobacillus_phage	37.6	6.5e-08
WP_062903844.1|383381_384929_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	23.9	7.0e-35
WP_062903845.1|384928_386107_-|portal	phage portal protein	portal	A0A2H4JA65	uncultured_Caudovirales_phage	35.1	1.1e-53
WP_062903846.1|386110_386293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903847.1|386258_387971_-|terminase	terminase large subunit	terminase	A0A1Q1PVU8	Staphylococcus_phage	35.2	2.4e-100
WP_062903848.1|387960_388419_-|terminase	phage terminase small subunit P27 family	terminase	A0A0A7S0C4	Clostridium_phage	31.5	2.6e-06
WP_062903849.1|388620_389013_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	38.8	1.3e-17
WP_062903850.1|389009_389345_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_057773525.1|389363_389564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903851.1|389556_389760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903852.1|390030_391524_-	hypothetical protein	NA	A0A1W6JQD6	Staphylococcus_phage	37.7	1.3e-65
WP_062909595.1|391507_392344_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_062903854.1|392340_392694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903855.1|392929_393199_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062903856.1|393200_393395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903857.1|393590_394163_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JQE6	Staphylococcus_phage	27.9	6.4e-10
WP_062903858.1|394214_395366_+|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	34.4	1.5e-58
WP_062909596.1|395650_396112_-	SprT family protein	NA	NA	NA	NA	NA
WP_046871997.1|396120_398292_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_046871996.1|399043_399481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903859.1|399499_402160_-	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.7	7.7e-66
WP_062909597.1|402438_403260_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	55.8	1.4e-71
WP_062903860.1|403266_404745_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	43.4	5.4e-101
WP_062903861.1|404859_405585_+	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_046871991.1|405655_406357_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046871990.1|406410_407556_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_056986318.1|407992_408727_+	SDR family oxidoreductase	NA	A0A2P0VP75	Tetraselmis_virus	29.1	1.7e-10
WP_046871988.1|408726_409110_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056986621.1|409524_410754_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.7	6.7e-81
WP_046872056.1|410944_411742_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.3	4.4e-33
WP_056986385.1|412036_413914_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	32.2	7.2e-34
WP_080945560.1|413829_415140_+	aspartate kinase	NA	NA	NA	NA	NA
WP_062909598.1|415159_416653_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_062903862.1|417156_417969_+	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_046872291.1|417965_419333_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_056986386.1|420054_420876_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_081196318.1|421008_422469_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	36.2	1.3e-70
WP_046871926.1|428434_429928_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	37.7	4.3e-90
WP_046871927.1|430001_431009_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_062909599.1|431142_432027_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_062903865.1|432149_434327_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	I3UL75	Ostreococcus_lucimarinus_virus	48.8	1.5e-104
WP_046871930.1|434423_434966_-	hypoxanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_052694536.1|434965_436363_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A0N7G7K4	Chrysochromulina_ericina_virus	28.7	1.1e-10
WP_046871931.1|436445_436937_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_080945556.1|437093_437366_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_046871932.1|437677_437947_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_080945531.1|438538_440104_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_046871619.1|440150_443657_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_046871618.1|443678_444236_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_046871617.1|444563_445526_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_062903867.1|445709_447101_+	peptidoglycan binding domain-containing protein	NA	NA	NA	NA	NA
WP_046871615.1|447233_447881_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_046871614.1|448258_448768_-	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	32.7	2.2e-09
WP_046871613.1|448862_449351_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046871612.1|449347_449713_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_046871611.1|449797_450169_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	37.9	1.7e-11
449703:449720	attR	TTAATTTCCATAAAAATA	NA	NA	NA	NA
WP_141306217.1|450187_450460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903868.1|450537_451665_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	31.5	1.8e-35
WP_046871608.1|451671_452031_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_062904290.1|452428_453676_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.6	1.2e-08
WP_046871607.1|453781_455344_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.7	1.3e-68
WP_046871606.1|455521_456898_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_062903869.1|457078_457861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046871604.1|457932_458832_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 5
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	465504	523270	2172287	transposase,protease	Pseudomonas_phage(20.0%)	49	NA	NA
WP_056986623.1|465504_466881_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062903870.1|467140_468742_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-147
WP_046872291.1|468975_470343_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062903871.1|470475_471060_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_062903872.1|471105_471546_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_062903873.1|471773_473150_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.7	1.3e-27
WP_062903874.1|473146_473953_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_046870767.1|474043_475429_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.2	6.7e-29
WP_046871592.1|475911_476274_-	DUF3899 domain-containing protein	NA	NA	NA	NA	NA
WP_046871591.1|476308_477199_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_056986062.1|477430_477931_+	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_062909601.1|477973_479167_+	CotH kinase family protein	NA	NA	NA	NA	NA
WP_056986064.1|479431_480415_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_062909602.1|480417_481428_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_046872291.1|483691_485059_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062909603.1|485436_487440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158509311.1|487468_487636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909604.1|487676_489461_-	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_046871185.1|489886_490504_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	25.6	2.5e-07
WP_052694479.1|490761_491835_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_062909605.1|491861_492590_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_144010372.1|492977_493343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046871182.1|493358_494864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903875.1|495077_496613_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046871146.1|496789_497335_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_046871141.1|497411_497606_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_062903876.1|497616_498186_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_046871143.1|498199_498469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052694475.1|498651_499566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903877.1|499603_500623_-	YdcF family protein	NA	NA	NA	NA	NA
WP_062903878.1|500850_501618_+	nicotinamide mononucleotide transporter	NA	A0A291I9N1	Lactobacillus_phage	70.6	8.1e-93
WP_046871585.1|502071_502326_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_046871584.1|502818_503661_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.9	7.6e-52
WP_046871583.1|503745_504609_-	DegV family protein	NA	NA	NA	NA	NA
WP_046871582.1|504906_505899_+	ROK family protein	NA	NA	NA	NA	NA
WP_046871581.1|506053_506881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046870767.1|506972_508358_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.2	6.7e-29
WP_046871580.1|508844_509369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903879.1|509465_511127_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_052694509.1|511231_511906_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_046871578.1|512167_513175_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_056986321.1|513287_513947_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_062903880.1|513948_516210_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_062903881.1|516321_517425_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.3	1.3e-22
WP_046871587.1|517494_519135_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_145912964.1|519151_519796_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_100078221.1|519962_521031_+|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	6.3e-35
WP_081196319.1|521028_521598_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_056986621.1|522040_523270_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.7	6.7e-81
>prophage 6
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	543071	577099	2172287	transposase	Bacillus_phage(62.5%)	29	NA	NA
WP_046872291.1|543071_544439_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062903891.1|544773_545490_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_062903892.1|545663_547319_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062909606.1|549375_551232_+	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_062909607.1|551615_552128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046872285.1|552262_552877_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	28.3	2.1e-06
WP_046872286.1|552946_553780_-	YitT family protein	NA	NA	NA	NA	NA
WP_046872287.1|553926_554247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056986615.1|554394_556104_-	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_062904288.1|556438_557644_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.3	1.6e-90
WP_046872288.1|557930_558533_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_046872289.1|558672_559035_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_081036107.1|559671_560145_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_105782191.1|560392_561277_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	48.3	2.2e-65
WP_017866964.1|561261_561519_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
WP_046872078.1|561630_562704_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_046872079.1|562766_563360_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_017866964.1|564138_564396_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
WP_105782191.1|564380_565265_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	48.3	2.2e-65
WP_062903893.1|565261_565549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046870622.1|565607_566081_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062903894.1|566247_567726_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_046870624.1|567725_568469_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_062909608.1|568558_569593_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_100078221.1|569760_570829_+|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	6.3e-35
WP_081196320.1|570826_573358_-	YfhO family protein	NA	NA	NA	NA	NA
WP_046872458.1|573657_574746_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.0	2.1e-17
WP_046872457.1|574767_575583_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046872291.1|575731_577099_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	665208	727714	2172287	holin,transposase	Bacillus_phage(23.08%)	55	NA	NA
WP_081036081.1|665208_665367_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_046872452.1|665801_667187_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_046872450.1|667281_668688_+	C69 family dipeptidase	NA	NA	NA	NA	NA
WP_046872451.1|668896_669139_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_046872449.1|669135_669486_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1S5SEX8	Streptococcus_phage	36.8	6.7e-10
WP_056986189.1|670268_671225_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_062903924.1|671241_672249_+	amidohydrolase	NA	NA	NA	NA	NA
WP_081196370.1|672295_674494_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_046871883.1|674574_674991_-	PTS N-acetylglucosamine transporter subunit IIBC	NA	NA	NA	NA	NA
WP_046870767.1|675095_676481_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.2	6.7e-29
WP_046871882.1|676970_677831_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_046871881.1|677823_678627_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_046871880.1|678650_679124_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_046871879.1|679141_679639_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_062903926.1|679725_682515_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_056986190.1|682769_683288_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046871876.1|683418_684048_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_062903741.1|684393_685761_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_046871874.1|686461_687160_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.2	5.4e-35
WP_062903927.1|687203_688562_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	23.1	1.3e-08
WP_046871872.1|688778_689450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871871.1|689466_690126_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_046871870.1|690112_690733_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_046871869.1|690766_691708_+	glycosyltransferase family 2 protein	NA	I1TED8	Salmonella_phage	37.5	2.3e-49
WP_145974381.1|691714_693685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871867.1|693706_694150_+	GtrA family protein	NA	NA	NA	NA	NA
WP_046870767.1|694245_695631_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.2	6.7e-29
WP_046871742.1|696121_696895_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046871743.1|696908_697814_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.4	1.4e-35
WP_062904290.1|698060_699308_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.6	1.2e-08
WP_046871744.1|699431_700253_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_046871745.1|700669_701269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046871746.1|701291_702044_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_062903928.1|702122_703106_-	amidohydrolase	NA	NA	NA	NA	NA
WP_158231695.1|703150_703771_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_062903929.1|703796_706148_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	36.6	2.2e-32
WP_062903930.1|706279_706741_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046871751.1|707059_707617_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046871752.1|707723_708671_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_062903931.1|708698_709553_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_062903932.1|710224_711883_-	Ig-like domain-containing protein	NA	A0A140XG62	Salmonella_phage	33.5	3.9e-07
WP_046871755.1|712145_713204_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.5	4.8e-19
WP_046871756.1|713196_714108_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_062909611.1|714104_714926_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_046871758.1|714931_716191_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017866964.1|716418_716676_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
WP_105782191.1|716660_717545_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	48.3	2.2e-65
WP_062903934.1|717541_718507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903935.1|718692_719373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046871760.1|719466_720096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062916598.1|720120_720996_-	SH3-like domain-containing protein	NA	NA	NA	NA	NA
WP_056986503.1|721173_721959_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_062903936.1|722506_726007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080945490.1|725990_726122_-	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_046872291.1|726346_727714_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	770173	839710	2172287	tRNA,transposase	Paramecium_bursaria_Chlorella_virus(11.11%)	46	NA	NA
WP_046872291.1|770173_771541_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062903945.1|771902_772703_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062903946.1|772802_779153_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_056985974.1|779368_779929_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046872169.1|783369_784356_-	choloylglycine hydrolase family protein	NA	M1HS66	Paramecium_bursaria_Chlorella_virus	37.9	3.7e-29
WP_046872291.1|784868_786236_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_052694549.1|786675_787878_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_062903947.1|788150_788861_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_046872167.1|789122_789608_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	29.7	1.9e-07
WP_062903948.1|789718_790924_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_046872165.1|791071_791839_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_062903949.1|793658_794909_-	KxYKxGKxW signal peptide domain-containing protein	NA	NA	NA	NA	NA
WP_062903950.1|795045_796215_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_046872128.1|796233_797565_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046872127.1|797592_798564_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	1.3e-23
WP_046872126.1|798560_800090_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_046872125.1|800247_801483_-	cytosine deaminase	NA	NA	NA	NA	NA
WP_046872124.1|801512_802889_-	cytosine permease	NA	NA	NA	NA	NA
WP_062903951.1|808579_809773_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_062903952.1|809902_810808_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062903741.1|811527_812895_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062903953.1|812920_813973_-|transposase	IS1380 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	56.3	3.8e-109
WP_046872053.1|814448_815702_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.9	4.6e-85
WP_046872052.1|816019_816346_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_046872051.1|816330_817041_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_046872050.1|817137_817635_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_046872049.1|817631_818084_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_046872048.1|818233_819280_+	tagatose 1,6-diphosphate aldolase	NA	NA	NA	NA	NA
WP_046872047.1|819401_819995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046872046.1|820081_820609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046872045.1|820674_821478_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_100078172.1|821623_821827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903954.1|822065_823331_-	HAMP domain-containing histidine kinase	NA	B5LWN0	Feldmannia_species_virus	28.9	6.6e-15
WP_046872042.1|823330_824017_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.4	1.9e-29
WP_062903955.1|824116_824773_-	ABC transporter ATP-binding protein	NA	A7K9T9	Acanthocystis_turfacea_chlorella_virus	24.6	1.1e-08
WP_056986292.1|824842_826288_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046872040.1|826990_827395_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_046872055.1|827487_828066_-	elongation factor P	NA	NA	NA	NA	NA
WP_046872039.1|828364_829012_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_062903956.1|829121_830774_-	glycosyl hydrolase 53 family protein	NA	NA	NA	NA	NA
WP_062903741.1|831104_832472_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062909613.1|832686_834072_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.4	2.3e-29
WP_046872326.1|834556_835999_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_046872325.1|836013_837963_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_081212596.1|838054_838339_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_046872291.1|838342_839710_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	848995	896797	2172287	transposase,protease	Bacillus_phage(41.67%)	54	NA	NA
WP_046872319.1|848995_849712_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_158509312.1|849806_850256_+	helix-turn-helix domain-containing protein	NA	A0A0A7AQV8	Bacillus_phage	44.9	5.8e-06
WP_105782191.1|850252_851137_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	48.3	2.2e-65
WP_017866964.1|851121_851379_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
WP_062909617.1|851398_851719_-	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_046871357.1|852043_852493_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_046871356.1|852572_853745_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_062909618.1|853744_854611_-	DUF3737 family protein	NA	NA	NA	NA	NA
WP_062909619.1|854673_854997_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_062909620.1|855000_855414_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_046871352.1|856007_856751_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_081212600.1|856734_857280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046872392.1|857427_858015_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_046872391.1|858015_858903_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056986036.1|859033_860614_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.4	7.4e-24
WP_145974382.1|860619_861168_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046872389.1|861570_862155_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_046872388.1|862172_863930_-	DUF262 domain-containing protein	NA	U3PFK3	Vibrio_phage	34.9	8.6e-05
WP_062909623.1|863981_864749_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_052694564.1|864953_865391_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046872386.1|865403_865724_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_056986037.1|865800_866550_+	sulfite exporter TauE/SafE family protein	NA	Q6EVM7	Oenoccocus_phage	50.8	1.1e-54
WP_158509313.1|866645_866840_-	DUF3923 family protein	NA	NA	NA	NA	NA
WP_052694497.1|866887_867427_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052694498.1|867516_867951_-	GNAT family N-acetyltransferase	NA	A0A1X9I6I8	Streptococcus_phage	34.6	4.0e-20
WP_046871407.1|867965_868292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_181407251.1|868386_869058_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_062909624.1|869180_870167_-	2-hydroxyacid dehydrogenase family protein	NA	A0A2R8FCS0	Cedratvirus	34.3	2.1e-32
WP_046872291.1|870262_871630_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_046871410.1|871813_872215_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046871411.1|872344_872926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155386973.1|872978_873140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056986039.1|873199_873931_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_046871412.1|873977_874697_-	carboxymethylenebutenolidase	NA	NA	NA	NA	NA
WP_046871413.1|874738_876094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046871414.1|876111_877599_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_052694499.1|877766_878300_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062909625.1|878388_879417_+	amidohydrolase	NA	NA	NA	NA	NA
WP_062909626.1|879506_880238_-	methyltransferase domain-containing protein	NA	A0A1X9I6N4	Streptococcus_phage	60.5	5.4e-86
WP_046871417.1|880253_881132_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_046871418.1|881305_881638_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046871419.1|881652_881976_-	plasmid maintenance system killer protein	NA	NA	NA	NA	NA
WP_046871420.1|882170_882626_-	DNA topology modulation protein FlaR	NA	A0A097BYE2	Leuconostoc_phage	35.0	1.3e-10
WP_062909627.1|882812_884378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046871423.1|887725_889369_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046871424.1|889575_890025_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100212790.1|890148_891588_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_017866964.1|891763_892021_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
WP_145912924.1|892005_892890_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	47.9	8.3e-65
WP_193394618.1|893062_893905_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_062909629.1|893943_894234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046871427.1|894233_894506_-	DUF2089 family protein	NA	NA	NA	NA	NA
WP_046871428.1|894891_895236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903741.1|895429_896797_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	926776	1003254	2172287	tRNA,transposase	Bacillus_phage(23.53%)	60	NA	NA
WP_046872291.1|926776_928144_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_145974387.1|928325_930860_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.6	1.4e-109
WP_062903967.1|930901_932881_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	47.1	7.9e-148
WP_062903968.1|933108_934227_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_046870947.1|934229_934460_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_046870948.1|934775_935915_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	35.0	7.7e-15
WP_046870949.1|936089_937436_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_080945492.1|937993_938128_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_046870950.1|938248_938608_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_046870951.1|938608_939445_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_046870952.1|939518_940328_+	protein jag	NA	NA	NA	NA	NA
WP_062909634.1|940492_941884_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_062909635.1|941956_943864_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_046870956.1|946539_947433_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_046870957.1|947578_948229_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_062903970.1|948371_949658_-	MFS transporter	NA	NA	NA	NA	NA
WP_046870959.1|949714_950455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046870960.1|950460_950907_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080945493.1|951211_952045_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_056986017.1|952200_953610_+	MFS transporter	NA	NA	NA	NA	NA
WP_046870961.1|953706_954312_+	signal peptidase I	NA	NA	NA	NA	NA
WP_062909636.1|954970_956287_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	32.8	1.1e-65
WP_062903971.1|956456_957782_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_046872291.1|957886_959254_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062903972.1|959364_961767_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_046870964.1|961895_962288_+	HIT family protein	NA	D7NW73	Streptomyces_phage	32.6	2.0e-07
WP_052694467.1|962372_962909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046870965.1|962921_963380_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046870966.1|963782_965240_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_062904280.1|965599_966847_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.7	5.3e-09
WP_062903973.1|967132_968551_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_062903974.1|968592_969594_-	hypothetical protein	NA	C7T1Z9	Lactococcus_virus	30.0	7.0e-36
WP_046870969.1|969618_970194_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_062903975.1|970607_971675_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.5	1.2e-30
WP_062903976.1|971674_972322_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_056986014.1|972430_973282_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062903977.1|973729_974203_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_141306420.1|974285_975230_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.1	9.5e-43
WP_002331365.1|975181_975715_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	26.9	1.1e-08
WP_100078169.1|975817_977062_-	purine permease	NA	Q9KX94	Enterobacteria_phage	29.8	1.1e-30
WP_062903978.1|977495_978788_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	27.2	3.0e-23
WP_046870976.1|978892_979483_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_062903979.1|979643_983240_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_145912965.1|983220_986985_+	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	22.7	4.0e-15
WP_056986012.1|986990_987518_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	33.3	5.3e-19
WP_046870980.1|987662_987860_-	CsbD family protein	NA	NA	NA	NA	NA
WP_046870981.1|988043_988688_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_046870982.1|988903_989137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046870983.1|989139_989685_-	CvpA family protein	NA	NA	NA	NA	NA
WP_056986010.1|989821_990409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046870985.1|990473_990791_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	37.6	1.7e-12
WP_062903981.1|990951_991929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100078221.1|992056_993125_+|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	6.3e-35
WP_062903982.1|993109_993658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046870987.1|993763_994783_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	47.0	1.4e-79
WP_155386953.1|994918_995080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903983.1|995503_998137_-	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_062903984.1|998286_1000266_-	Cna B-type domain-containing protein	NA	NA	NA	NA	NA
WP_046870988.1|1000592_1001534_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_046872291.1|1001886_1003254_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	1014321	1033688	2172287	bacteriocin,transposase	Bacillus_phage(80.0%)	32	NA	NA
WP_046870999.1|1014321_1014654_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_046871000.1|1014864_1015128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871001.1|1015188_1015458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871002.1|1015566_1015755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871003.1|1015843_1016194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062903989.1|1016368_1017715_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_062903990.1|1017715_1018006_+	response regulator	NA	NA	NA	NA	NA
WP_017866964.1|1018068_1018326_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
WP_145912937.1|1018310_1019195_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	48.3	1.7e-65
WP_062903992.1|1019277_1019700_+	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_052694472.1|1019882_1020665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871007.1|1020664_1020862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871008.1|1020994_1021222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871009.1|1021891_1022404_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_062903994.1|1022393_1023164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145912937.1|1023152_1024037_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	48.3	1.7e-65
WP_017866964.1|1024021_1024279_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
WP_062909637.1|1024318_1024732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871011.1|1024784_1025186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062903996.1|1025257_1026070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141306314.1|1026053_1026722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145912941.1|1026869_1027412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062904296.1|1027465_1028062_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.2	4.0e-23
WP_046871015.1|1028039_1028555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871016.1|1028892_1029207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105782191.1|1029419_1030304_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	48.3	2.2e-65
WP_017866964.1|1030288_1030546_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
WP_105782191.1|1030624_1031509_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	48.3	2.2e-65
WP_017866964.1|1031493_1031751_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
WP_145912943.1|1031846_1032575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062903998.1|1032555_1033080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871019.1|1033076_1033688_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.0	1.6e-22
>prophage 12
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	1115449	1158912	2172287	tRNA,transposase	Bacillus_phage(60.0%)	36	NA	NA
WP_046872291.1|1115449_1116817_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_046872189.1|1116992_1118582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046872188.1|1118683_1119553_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056986107.1|1119709_1120399_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_062904015.1|1120504_1121038_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_062904016.1|1121639_1122359_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_046872183.1|1122669_1123263_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_158509315.1|1123358_1123700_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_100078221.1|1123715_1124785_-|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	6.3e-35
WP_062904018.1|1124865_1126743_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_046871626.1|1126735_1127194_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_046871625.1|1127206_1127521_+	PTS fructose transporter subunit IIB	NA	NA	NA	NA	NA
WP_062904019.1|1127541_1128585_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_062904020.1|1128588_1131201_+	alpha-mannosidase	NA	NA	NA	NA	NA
WP_062903741.1|1131509_1132877_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_046872466.1|1135038_1136058_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062904021.1|1136689_1137613_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_062904022.1|1137680_1138946_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_062909639.1|1138938_1139895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063510371.1|1140093_1140327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062904024.1|1141192_1142071_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062904025.1|1142115_1142520_-	HicB family protein	NA	M1PG28	Streptococcus_phage	30.8	6.8e-06
WP_046871937.1|1142538_1142727_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_046871938.1|1142987_1144616_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_056986090.1|1144699_1146082_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_062904026.1|1146151_1147117_+	AEC family transporter	NA	NA	NA	NA	NA
WP_062904027.1|1147599_1148448_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_046872291.1|1148590_1149958_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062904028.1|1150339_1152370_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.2	2.2e-89
WP_062904030.1|1152677_1153463_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_046871945.1|1153449_1154001_+	ribonuclease M5	NA	NA	NA	NA	NA
WP_046871946.1|1154015_1154891_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_141306420.1|1155287_1156232_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.1	9.5e-43
WP_002331365.1|1156183_1156717_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	26.9	1.1e-08
WP_046871947.1|1156861_1157422_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062903741.1|1157544_1158912_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	1264274	1376824	2172287	head,transposase,portal,integrase,tail,protease,terminase,capsid,tRNA	Lactobacillus_phage(52.63%)	116	1290322:1290381	1376892:1378443
WP_046872291.1|1264274_1265642_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062904045.1|1265921_1267388_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_046872293.1|1267389_1267908_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_046872294.1|1268056_1269613_+	amino acid permease	NA	NA	NA	NA	NA
WP_062904046.1|1270357_1271359_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_046871347.1|1271348_1272743_-	aspartate kinase	NA	NA	NA	NA	NA
WP_062904047.1|1273197_1274505_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_046871345.1|1274612_1275323_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-acetyltransferase	NA	NA	NA	NA	NA
WP_046871344.1|1275327_1276494_+	N-acetyldiaminopimelate deacetylase	NA	NA	NA	NA	NA
WP_062904048.1|1276522_1277446_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_046871342.1|1277438_1278221_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_062904049.1|1278241_1279441_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_056986215.1|1279469_1280537_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_046871339.1|1280880_1282302_-	MFS transporter	NA	NA	NA	NA	NA
WP_062909642.1|1282926_1283277_-	DsrE family protein	NA	NA	NA	NA	NA
WP_100078182.1|1283287_1284064_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_052694489.1|1284253_1284943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056986216.1|1285217_1285418_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	1.9e-17
WP_062904050.1|1285636_1285900_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046871336.1|1285942_1286182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046871335.1|1286291_1287026_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_046871334.1|1287036_1288044_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_046871333.1|1288040_1288805_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_046871332.1|1288776_1289073_-	thiamine-binding protein	NA	NA	NA	NA	NA
WP_046871331.1|1289511_1290222_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
1290322:1290381	attL	GTGTTAGTGTAAGGTTTTCCTAGATGGTCAATAAAATTCTAGGAATATTCATTTTGAGTT	NA	NA	NA	NA
WP_062903741.1|1290448_1291816_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_056986260.1|1292025_1293225_+	acetate kinase	NA	NA	NA	NA	NA
WP_056986261.1|1293268_1294246_+	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_046870692.1|1294667_1295576_+	dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_046870691.1|1295650_1296103_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_056986259.1|1296290_1297703_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_062909643.1|1297738_1298827_-|integrase	site-specific integrase	integrase	Q9ZXG6	Leuconostoc_phage	34.1	4.4e-44
WP_145974388.1|1298849_1299245_-	ImmA/IrrE family metallo-endopeptidase	NA	E3W8B8	Leuconostoc_phage	51.6	5.0e-30
WP_062909645.1|1299237_1299582_-	helix-turn-helix transcriptional regulator	NA	E3W8B9	Leuconostoc_phage	50.0	2.3e-23
WP_062909646.1|1299840_1300047_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062909647.1|1300062_1300305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158509316.1|1300308_1300476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909648.1|1300555_1300852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909649.1|1300831_1301119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158509317.1|1301270_1301447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909650.1|1301427_1301619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909651.1|1301611_1302076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909652.1|1302072_1302798_+	AAA family ATPase	NA	A8ATF0	Listeria_phage	52.2	5.4e-62
WP_062909653.1|1302751_1304104_+	DEAD/DEAH box helicase	NA	A0A0P0ID30	Lactobacillus_phage	64.1	5.3e-164
WP_062909654.1|1304108_1304624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909655.1|1304642_1305194_+	DUF669 domain-containing protein	NA	Q9T0Y2	Lactobacillus_phage	60.0	1.3e-55
WP_062909656.1|1305212_1307513_+	DNA primase	NA	A0A0P0IX98	Lactobacillus_phage	61.7	2.1e-285
WP_062909657.1|1307774_1308095_+	VRR-NUC domain-containing protein	NA	A0A2H4JBA0	uncultured_Caudovirales_phage	57.7	3.8e-28
WP_145974389.1|1308170_1308857_+	SAM-dependent DNA methyltransferase	NA	D6PSV0	Lactobacillus_phage	83.8	2.1e-92
WP_145974384.1|1308891_1309434_+	hypothetical protein	NA	A0A2K9VD98	Lactobacillus_phage	44.4	1.3e-28
WP_193394615.1|1309600_1309777_+	hypothetical protein	NA	E9LUP2	Lactobacillus_phage	67.2	4.5e-15
WP_062909660.1|1309769_1310141_+	hypothetical protein	NA	A0A1I9KKG9	Lactobacillus_phage	31.4	1.9e-07
WP_062909661.1|1310169_1310409_+	DUF3310 domain-containing protein	NA	A0A0S2MYA1	Enterococcus_phage	50.7	7.5e-13
WP_158509318.1|1310401_1310725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909663.1|1310928_1311828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100078221.1|1311870_1312939_+|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	6.3e-35
WP_062909664.1|1312980_1313463_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_062909665.1|1313580_1314138_+|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	29.0	8.4e-15
WP_062909666.1|1314137_1316006_+|terminase	terminase large subunit	terminase	A8YQI8	Lactobacillus_phage	41.1	4.8e-131
WP_062909667.1|1316284_1317439_+|portal	phage portal protein	portal	Q6J1Y4	Lactobacillus_phage	54.2	1.8e-107
WP_062909668.1|1317416_1318100_+|protease	Clp protease ClpP	protease	E9LUQ2	Lactobacillus_phage	43.8	1.1e-40
WP_081212619.1|1318110_1319229_+|capsid	phage major capsid protein	capsid	Q6J1Y2	Lactobacillus_phage	54.5	8.8e-104
WP_062909670.1|1319330_1319639_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6J1Y1	Lactobacillus_phage	40.2	3.1e-11
WP_062909671.1|1319628_1319973_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_062909672.1|1319965_1320397_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_062909673.1|1320396_1320765_+	DUF806 family protein	NA	NA	NA	NA	NA
WP_062909674.1|1320768_1321365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909675.1|1321500_1321818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158509319.1|1321844_1322018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909676.1|1322081_1327097_+|tail	phage tail tape measure protein	tail	Q9AZS0	Lactococcus_phage	38.9	1.0e-111
WP_062909677.1|1327108_1328875_+|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	38.0	7.9e-99
WP_062909678.1|1328938_1331389_+	hypothetical protein	NA	E9LUR3	Lactobacillus_phage	35.0	1.1e-109
WP_062909679.1|1331406_1334136_+	hypothetical protein	NA	K4I0E3	Lactobacillus_phage	36.0	3.3e-112
WP_062909680.1|1334132_1334372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_193394616.1|1334371_1334533_+	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	92.5	5.7e-17
WP_081212611.1|1334516_1336499_+	collagen-like protein	NA	A0A2P0ZLF6	Lactobacillus_phage	84.2	1.7e-54
WP_062909681.1|1336495_1336747_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	75.4	6.4e-15
WP_062909682.1|1336810_1337245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909683.1|1337250_1337526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909684.1|1337518_1337764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909685.1|1337763_1338813_+	hypothetical protein	NA	A0A2P0ZLG2	Lactobacillus_phage	54.4	7.8e-62
WP_063510301.1|1339205_1340147_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_046870648.1|1340198_1340642_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056986257.1|1341036_1342005_-	GMP reductase	NA	G3MBI2	Bacillus_virus	71.6	5.6e-131
WP_046870647.1|1342030_1343320_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	35.1	4.0e-68
WP_062904051.1|1343564_1344860_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	6.5e-18
WP_046870645.1|1345586_1346819_-	MFS transporter	NA	NA	NA	NA	NA
WP_062904052.1|1346936_1347296_-	type II toxin-antitoxin system HicB family antitoxin	NA	I3NLB2	Bifidobacterium_phage	32.3	2.4e-07
WP_062904053.1|1347388_1347850_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_062904054.1|1348060_1348831_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_062904055.1|1348842_1349709_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_052694465.1|1349699_1350947_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.6	1.5e-08
WP_062904056.1|1351015_1351273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046872436.1|1351747_1352158_+	transcriptional regulator Spx	NA	G3MAU4	Bacillus_virus	31.0	3.6e-07
WP_062904057.1|1352251_1352536_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_052694465.1|1352587_1353835_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.6	1.5e-08
WP_062904058.1|1353820_1354654_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_046872434.1|1354684_1355476_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_046872433.1|1355561_1356218_-	membrane protein	NA	NA	NA	NA	NA
WP_046872432.1|1356554_1357415_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.1	2.8e-57
WP_046872431.1|1357477_1357957_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_193394619.1|1358143_1358935_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_046872429.1|1359208_1360594_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_056986457.1|1363654_1364038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062904059.1|1364281_1364710_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_062909687.1|1364770_1365301_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046872425.1|1365398_1366472_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.8	3.7e-43
WP_145912950.1|1366825_1367803_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_046872422.1|1367973_1368540_-	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_046872421.1|1368549_1368885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046872420.1|1369036_1369573_+	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_052694568.1|1370062_1371463_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_046872419.1|1371609_1373169_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_046872418.1|1373169_1374699_+	accessory Sec system glycosyltransferase Asp1	NA	NA	NA	NA	NA
WP_080945589.1|1374828_1375332_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_062903741.1|1375456_1376824_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
1376892:1378443	attR	AACTCAAAATGAATATTCCTAGAATTTTATTGACCATCTAGGAAAACCTTACACTAACACTATTGGGATATGCTATAATTTAAGGTATAAATTAATGGCATGACTGAAAGGTGGGAATAAATTGGCTGATTTGTTGTATAAAACGATTTTAAAAGATTTGGAAAAACGAATCTTCAATAATGAATTCCCTGCTAAAAAATTGCCAGACGAACGAATGTTGACTAGTCAATATGGGGTAAGTCGCAGCTCGATTAAACGCGCGTTGAGTGTATTAGCAGACGAAGGAATTGTGTTTAAGAAACGCGGTTCTGGGACTTTTGTGAATCCACTATACTTAAAAAATCGTTCGCTGTTTACCTATGAAGGTTCTAACTTGGGCGTGACAGATAGTATGCGCGCTGACGGACGAAAACCGGGAATTAAAGTGTTAGATTTTTCTGTAATTCCAGCAACAAAAGAAATGCAGACGGATTTATTCCTTGAAGCAGAAGATTTCGTTTATCAGATTCGGCGACTGCGATTGTTGGATGATCAGCCAGTGATGATTGAAACGGGCTATATTCCAATTAAAATTGTGCCAGAGTTATCACGTACAATTGTATCAAAATCAATTTTTAATTATCTGGAAGATAAAAAGAATCAGACGGTCACAAAATCCTTTTTATCGATTGAAGCTCAGCCTTCGACAAAGGAAGACCAAGAGCTTTTAAATTTGACGCCCCAAGAACCAGTGGGGGTCATGTCTGGAATCTTCTTTTTGGATGATGGCACACCATTTGAGCTATCTAACATGCGGCTTCATTACAAGTATATGAAATATAATGCGGTGGTCGAATTAAAATAGTAAGAGGAAGTAGTTAACTAAAATATAGCTAACTGCTTTTTTTGTGGGTTGCATGATGTAGCGGGCTATCAGTGAATGTAATAGGAGAAAAATTGTAATTATTTAGCAATTAATTTGTTCTAATTAAATTGGACCGTATCAATTTTCAAATTAGTTGACCATGACAAAATATCGGGTTATTATTATGGTGTATTCGGTAACAAAGCTAAGAAGCTAAATGCTTGAAGGGAGCAATACAATGGCAACTGATTATTCATCAAAAACCTATTTTGAAAATCTTGATAAATTTTGGCGGGCAGCAAATTACCTGTCAGTTGGGCAACTTTATTTAAAAGATAACCCATTATTAAAACGTCCATTGAAAAACGATGATGTAAAGGTCCATCCAATTGGACATTGGGGAACAATTCCTGGTCAAAATTACATTTATGCTCATTTAAATCGAGTTATTAATAAATATAACGTCAATATGTTTTACATTGAAGGTCCTGGTCATGGTGGCCAAGTTATGGTTTCAAATTCTTATTTGGACGGCAGTTATACCGAAGTTTATCCAGAAATTACTCAGGATGAATCAGGAATGCAGAAACTATTTAAACAGTTCTCTTGGCCTGGTGGTGTGGCATCACATGCTGCTCCAGTGACTCCTGGATCAATTCATGAGGGTGGCGAGCTTGGCTATTCCCTTTCGCATGGAACAGGTGCTAT	NA	NA	NA	NA
>prophage 14
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	1395579	1441079	2172287	transposase	Streptococcus_phage(41.67%)	40	NA	NA
WP_145912937.1|1395579_1396464_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	48.3	1.7e-65
WP_017866964.1|1396448_1396706_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
WP_046870742.1|1396815_1397259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046870741.1|1397261_1398245_+	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K9L162	Tupanvirus	25.2	1.3e-15
WP_062904066.1|1398322_1400482_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	47.8	4.2e-171
WP_046870739.1|1400669_1401098_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_100077854.1|1401142_1402261_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_046870737.1|1402257_1403022_+	YibE/F family protein	NA	NA	NA	NA	NA
WP_062904288.1|1403632_1404838_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.3	1.6e-90
WP_046870736.1|1405353_1408029_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_062904067.1|1408172_1409093_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_046872291.1|1409318_1410686_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_080945475.1|1410894_1411554_+	TerC family protein	NA	A0A068EP98	Bacillus_phage	47.0	6.0e-36
WP_046870734.1|1411700_1412021_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	42.7	1.2e-21
WP_046870733.1|1412025_1412901_+	DegV family protein	NA	NA	NA	NA	NA
WP_046870732.1|1412972_1413788_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_062904068.1|1413980_1415357_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_046872218.1|1415696_1416527_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.6	2.4e-42
WP_062904069.1|1416523_1417771_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.4	1.5e-104
WP_062904070.1|1417830_1418208_-	VOC family protein	NA	NA	NA	NA	NA
WP_046872560.1|1418349_1419897_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	28.4	1.2e-42
WP_046872561.1|1419961_1420870_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_046872562.1|1420923_1421478_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_062904288.1|1422022_1423228_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.3	1.6e-90
WP_081196341.1|1423951_1424722_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_062904073.1|1424742_1427181_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_046872504.1|1427278_1428682_-	amino acid permease	NA	NA	NA	NA	NA
WP_052694576.1|1429455_1430289_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_046872505.1|1430293_1430857_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_046871436.1|1432737_1432917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172793931.1|1433171_1433744_+	guanylate kinase	NA	NA	NA	NA	NA
WP_062904074.1|1433819_1434257_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_046871439.1|1434419_1434902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871440.1|1434921_1435779_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_172793932.1|1436099_1436834_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.6	3.0e-36
WP_046871442.1|1436846_1437683_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046871443.1|1437679_1438318_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_046871444.1|1438331_1438985_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_062904076.1|1439221_1439686_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_062904077.1|1439711_1441079_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	1548815	1595469	2172287	transposase	Streptococcus_phage(15.38%)	46	NA	NA
WP_062904110.1|1548815_1550045_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.7	2.0e-80
WP_046872542.1|1550416_1550938_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_052694581.1|1551045_1551438_-	toxin-antitoxin system, antitoxin component, HicB family protein	NA	A0A090DBV2	Clostridium_phage	35.6	1.6e-12
WP_046872543.1|1551466_1551859_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CYJ8	Paenibacillus_phage	30.5	1.2e-12
WP_046872544.1|1551905_1552094_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_046872545.1|1552321_1553344_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_046872546.1|1553451_1553871_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046872547.1|1553939_1555733_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.6	7.1e-23
WP_046872548.1|1556049_1557375_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.1	1.1e-23
WP_046872549.1|1557586_1558144_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	28.4	2.5e-11
WP_046872550.1|1558294_1558750_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_062904113.1|1559076_1559901_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_046872552.1|1559893_1560601_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	3.1e-30
WP_062904114.1|1560593_1561817_+	acyltransferase	NA	NA	NA	NA	NA
WP_046872553.1|1561834_1563376_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	24.0	2.1e-15
WP_046872554.1|1564431_1565424_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_062903819.1|1565639_1567007_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_046872555.1|1567160_1567697_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062904115.1|1567730_1569506_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.8	1.6e-99
WP_080945513.1|1569532_1570432_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_046871255.1|1570534_1571128_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	40.5	4.7e-24
WP_046871256.1|1571201_1571513_+	MazG-like protein	NA	NA	NA	NA	NA
WP_080945506.1|1571667_1571883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080945507.1|1571923_1572091_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_046871258.1|1572191_1572581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062903819.1|1572722_1574090_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062904116.1|1574312_1576097_+	DNA helicase RecQ	NA	A0A2K9L021	Tupanvirus	37.5	2.5e-76
WP_100077832.1|1576219_1576342_+	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_046871260.1|1576346_1576616_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_046871261.1|1576883_1578269_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_100077831.1|1578731_1578878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046871262.1|1579084_1579627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871263.1|1579767_1580400_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_046871264.1|1580413_1581292_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_062904288.1|1582228_1583434_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	45.3	1.6e-90
WP_062909692.1|1583965_1584565_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046871267.1|1584707_1585154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062904117.1|1585169_1586144_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_056985958.1|1586610_1588158_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_046871270.1|1588160_1588826_+	HD domain-containing protein	NA	S4W232	Pandoravirus	29.5	3.2e-13
WP_046871271.1|1588838_1589519_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_062909693.1|1589578_1590040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062904118.1|1590247_1591810_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_046872291.1|1591977_1593345_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062904119.1|1593469_1593997_+	cation transporter	NA	NA	NA	NA	NA
WP_046872291.1|1594101_1595469_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	1642543	1702913	2172287	tRNA,transposase	Bacillus_phage(21.05%)	57	NA	NA
WP_046871323.1|1642543_1643311_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_046871324.1|1643432_1643876_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_046871325.1|1643890_1644283_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_056986156.1|1644433_1644970_-	phenolic acid decarboxylase	NA	NA	NA	NA	NA
WP_056986157.1|1645065_1645602_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046870727.1|1645691_1647113_+	amino acid permease	NA	NA	NA	NA	NA
WP_056986158.1|1647181_1648135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062909698.1|1648252_1648876_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_062909699.1|1648894_1649530_+	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	51.0	2.7e-33
WP_046870724.1|1649554_1650133_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_062904132.1|1650257_1651427_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_062904300.1|1651604_1653866_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.3	7.6e-131
WP_062904301.1|1654034_1655147_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_046870721.1|1655469_1655787_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_062904133.1|1655787_1657251_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_046870719.1|1657250_1658678_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_062904135.1|1658834_1659854_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	28.6	2.1e-19
WP_062904136.1|1659974_1661345_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	53.0	2.4e-135
WP_046870716.1|1661521_1661812_+	type II toxin-antitoxin system MqsR family toxin	NA	Q9AZG1	Lactococcus_phage	46.1	5.0e-11
WP_046870715.1|1661830_1662757_+	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	38.1	3.0e-49
WP_062904137.1|1662926_1663172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062904138.1|1663171_1663885_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_046870714.1|1663955_1665293_-	amino acid permease	NA	NA	NA	NA	NA
WP_052694452.1|1665441_1666224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145912954.1|1666267_1666414_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002331365.1|1666457_1666991_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	26.9	1.1e-08
WP_141306420.1|1666942_1667887_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.1	9.5e-43
WP_062904139.1|1667903_1668173_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_046870712.1|1668351_1669362_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_046870711.1|1669371_1670733_+	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	26.9	5.8e-25
WP_046870710.1|1670735_1671560_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_062904140.1|1671786_1672488_+	UPF0236 family protein	NA	NA	NA	NA	NA
WP_100078221.1|1672538_1673607_+|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	6.3e-35
WP_046872383.1|1674110_1674653_-	VanZ family protein	NA	NA	NA	NA	NA
WP_062909700.1|1674868_1675282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062909701.1|1677794_1679162_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_158231710.1|1679517_1680390_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	32.8	5.7e-10
WP_046872509.1|1680405_1680636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062904302.1|1681057_1682929_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.5	1.1e-101
WP_046872508.1|1683034_1683268_+	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_080945592.1|1683521_1684901_+	purine permease	NA	NA	NA	NA	NA
WP_056986623.1|1685127_1686504_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062904144.1|1686846_1687809_+	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_056986404.1|1687812_1689189_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.3	7.3e-44
WP_046872064.1|1689437_1692077_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.8	1.1e-64
WP_062904145.1|1692196_1692496_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_046872066.1|1692492_1692933_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_062904146.1|1692942_1693251_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_046872074.1|1693405_1695763_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	56.1	1.8e-26
WP_046872068.1|1695848_1696160_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.0	2.1e-15
WP_062904280.1|1696393_1697641_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.7	5.3e-09
WP_046871401.1|1697852_1698086_+	DUF1146 domain-containing protein	NA	NA	NA	NA	NA
WP_046871400.1|1698100_1699390_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_046871399.1|1699555_1699816_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	58.0	3.8e-18
WP_046871398.1|1699833_1700052_+	DUF2969 domain-containing protein	NA	NA	NA	NA	NA
WP_081196373.1|1700158_1701286_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_062904280.1|1701665_1702913_-|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	24.7	5.3e-09
>prophage 17
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	1718117	1790392	2172287	tRNA,transposase,protease	Streptococcus_phage(25.0%)	59	NA	NA
WP_046872291.1|1718117_1719485_-|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062904154.1|1719624_1719930_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_046871382.1|1719992_1720466_-	universal stress protein	NA	NA	NA	NA	NA
WP_046871381.1|1720548_1720830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046871380.1|1721157_1722432_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	48.2	1.1e-97
WP_046871379.1|1722441_1722906_-	YueI family protein	NA	NA	NA	NA	NA
WP_052694494.1|1723009_1723600_+	DUF1054 family protein	NA	NA	NA	NA	NA
WP_046871378.1|1723655_1724264_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_046871377.1|1724457_1724928_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_062904155.1|1725091_1726801_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_062903741.1|1727721_1729089_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_081196352.1|1729142_1729730_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_062909702.1|1729760_1730978_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_046871373.1|1731072_1731579_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_062904156.1|1731852_1734516_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.6	1.9e-160
WP_080945520.1|1734561_1735941_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_046871402.1|1736030_1736645_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_056986083.1|1736798_1737644_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_062909703.1|1737668_1738214_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_062904157.1|1738667_1739318_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_046870897.1|1739330_1739966_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.1	4.3e-23
WP_062909704.1|1741008_1742280_+	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	32.3	3.2e-54
WP_046870900.1|1742272_1743577_+	insulinase family protein	NA	NA	NA	NA	NA
WP_046870901.1|1743573_1744299_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062904159.1|1744368_1745247_+	DUF4115 domain-containing protein	NA	NA	NA	NA	NA
WP_062904160.1|1745261_1745846_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_046870904.1|1745951_1747175_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_046870904.1|1747644_1748868_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_062904162.1|1748957_1750082_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.9	2.3e-120
WP_062904163.1|1750303_1751863_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_062904165.1|1754675_1756631_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.8	1.6e-60
WP_062904166.1|1756698_1757292_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_046870910.1|1757309_1758329_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	29.7	2.8e-08
WP_046870911.1|1758404_1759547_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.8	2.3e-83
WP_062904303.1|1759606_1760029_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_062909705.1|1760158_1761652_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	33.3	2.7e-68
WP_162261346.1|1761874_1762966_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_056986623.1|1763079_1764456_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_046872082.1|1764761_1765886_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	27.2	1.4e-24
WP_046872083.1|1765892_1766312_+	GtrA family protein	NA	NA	NA	NA	NA
WP_046872084.1|1766342_1766804_-	flavodoxin	NA	NA	NA	NA	NA
WP_056986459.1|1767060_1767882_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_052694544.1|1767905_1769105_+	serine hydrolase	NA	NA	NA	NA	NA
WP_046872086.1|1769252_1769810_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_062904168.1|1770113_1771220_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_046872088.1|1771329_1771740_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	7.3e-16
WP_056986621.1|1771963_1773193_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.7	6.7e-81
WP_062904169.1|1773542_1774235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081196374.1|1774870_1776418_+	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_046871848.1|1776428_1778006_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	26.3	3.7e-31
WP_062904170.1|1778239_1780372_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	45.4	2.7e-146
WP_062904171.1|1780468_1782712_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	38.5	1.3e-122
WP_046871845.1|1782960_1783158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046871844.1|1783318_1783585_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_062904172.1|1783584_1785306_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	30.2	1.4e-15
WP_062904173.1|1785526_1786702_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_100078153.1|1786732_1787740_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_062904174.1|1787744_1788776_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_062903741.1|1789024_1790392_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	1926859	1991410	2172287	tRNA,transposase	Bacillus_phage(33.33%)	55	NA	NA
WP_046872156.1|1926859_1927810_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.1	3.0e-12
WP_046872157.1|1927806_1929138_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_046872158.1|1929144_1929888_+	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	R4ZGL0	Mythimna_separata_entomopoxvirus	26.8	3.3e-06
WP_046872159.1|1929888_1931379_+	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	S4VYI4	Pandoravirus	34.2	6.6e-22
WP_046872160.1|1931394_1932312_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_046872161.1|1932314_1932971_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_046872162.1|1932970_1933615_+	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_046870836.1|1933666_1933852_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_046872291.1|1934312_1935680_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_046870837.1|1935827_1936190_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_062904308.1|1936268_1937903_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_046870838.1|1937963_1940018_+	ATP-dependent DNA helicase RecG	NA	A0A0C5KL28	Enterococcus_phage	28.8	2.6e-05
WP_062904212.1|1940040_1941057_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_046870840.1|1941128_1941377_+	acyl carrier protein	NA	A0A1L2CUN7	Pectobacterium_phage	37.8	7.8e-05
WP_062904309.1|1941501_1942203_+	ribonuclease III	NA	A0A1V0SDK0	Indivirus	36.5	6.9e-22
WP_062904213.1|1942221_1945770_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_081196360.1|1945787_1946921_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_046870843.1|1946936_1947278_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_062904214.1|1947295_1948729_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_046870845.1|1948987_1950055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_056986148.1|1950162_1950987_-	serine/threonine protein phosphatase	NA	A0A060ALG7	Listeria_phage	27.2	3.6e-14
WP_046870597.1|1951316_1952309_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_046870596.1|1952315_1953812_-	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	24.6	2.2e-17
WP_046870595.1|1953993_1955667_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_046870594.1|1955670_1957611_+	PTS sugar transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_056986147.1|1957792_1958917_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062909718.1|1959194_1960424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158509322.1|1960452_1961316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100078221.1|1961331_1962401_-|transposase	IS3-like element IS1163 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	33.2	6.3e-35
WP_062909720.1|1962758_1963550_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_056986583.1|1963671_1964598_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_062904219.1|1964618_1966589_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_193394620.1|1966712_1967213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_193394617.1|1967227_1967899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062904220.1|1968074_1969262_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_062904221.1|1970638_1971313_+	DUF969 domain-containing protein	NA	NA	NA	NA	NA
WP_056986542.1|1971305_1972229_+	DUF979 domain-containing protein	NA	NA	NA	NA	NA
WP_046870592.1|1972246_1972894_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_046870591.1|1972953_1974057_-	acyltransferase	NA	NA	NA	NA	NA
WP_063510297.1|1974234_1974996_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_046870590.1|1975101_1975971_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046870589.1|1976100_1977018_+	acyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_062909721.1|1977138_1978782_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_062904224.1|1978803_1979619_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_046870587.1|1979620_1979920_+	malonate decarboxylase subunit delta	NA	NA	NA	NA	NA
WP_046870586.1|1979909_1981577_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_052694438.1|1981579_1982203_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_046870584.1|1982275_1983070_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_105782191.1|1983451_1984336_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	48.3	2.2e-65
WP_017866964.1|1984320_1984578_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.1	1.0e-15
WP_046872291.1|1984876_1986244_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
WP_062904225.1|1986513_1987752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046870582.1|1987978_1988530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046870581.1|1988791_1989796_+	3'-5' exonuclease	NA	A0A0A7RWA3	Clostridium_phage	30.0	8.6e-18
WP_046872291.1|1990042_1991410_+|transposase	ISLre2 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	2060247	2070154	2172287	tRNA	Staphylococcus_phage(28.57%)	10	NA	NA
WP_062904244.1|2060247_2061678_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	32.8	1.6e-25
WP_046871118.1|2061689_2061920_-	YozE family protein	NA	NA	NA	NA	NA
WP_046871117.1|2061930_2062536_-	YpmS family protein	NA	NA	NA	NA	NA
WP_046871116.1|2062541_2063480_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_062904245.1|2063584_2064430_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	33.6	8.9e-16
WP_046871114.1|2064499_2065015_-	dihydrofolate reductase	NA	S5M436	Bacillus_phage	42.8	3.5e-23
WP_062904246.1|2065033_2065984_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	62.1	2.5e-115
WP_062909725.1|2066002_2067904_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.5	1.8e-53
WP_062904247.1|2067910_2069134_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	G3MAR3	Bacillus_virus	38.6	2.7e-37
WP_046871138.1|2069278_2070154_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	38.5	1.3e-54
>prophage 20
NZ_CP012283	Pediococcus damnosus strain TMW 2.1534 chromosome, complete genome	2172287	2158514	2166280	2172287	transposase	Bacillus_phage(66.67%)	8	NA	NA
WP_062904275.1|2158514_2160311_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.9	9.3e-47
WP_046871203.1|2160300_2162064_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	26.9	8.0e-43
WP_046871204.1|2162175_2162403_-	YneF family protein	NA	NA	NA	NA	NA
WP_046871205.1|2162562_2162817_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_046871206.1|2162954_2163584_+	transcriptional repressor LexA	NA	A0A0N9RTK0	Paenibacillus_phage	33.8	1.2e-06
WP_002331365.1|2163663_2164197_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	26.9	1.1e-08
WP_141306420.1|2164148_2165093_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.1	9.5e-43
WP_046871207.1|2165155_2166280_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	33.0	1.5e-34
