The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012743	Klebsiella pneumoniae subsp. pneumoniae strain TGH8 chromosome, complete genome	5439720	51634	89310	5439720	holin,terminase,transposase	Enterobacteria_phage(26.09%)	28	NA	NA
WP_039110586.1|51634_52747_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.1	2.5e-111
WP_008807834.1|52730_54131_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	9.2e-127
WP_004190663.1|54130_55438_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_008807832.1|55415_56408_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	35.3	1.3e-29
WP_004218558.1|57270_57516_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_023313108.1|58474_58750_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.8	4.7e-11
WP_039110584.1|58746_59094_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	69.6	1.6e-35
WP_023301209.1|59090_59630_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	7.4e-101
WP_031281240.1|59626_59926_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.9e-45
WP_049001106.1|60538_60985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805457.1|60890_61148_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	96.5	5.4e-41
WP_023287514.1|61482_62304_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.5	1.1e-98
WP_020804605.1|62419_62776_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.2	3.3e-41
WP_020804598.1|62772_63069_-	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	74.5	1.7e-35
WP_020804595.1|63277_63874_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	2.2e-90
WP_004184503.1|64252_64486_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_062920371.1|67009_67303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050442686.1|67386_67587_+	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_145915637.1|68479_70486_+	transketolase	NA	U5P0U6	Shigella_phage	100.0	1.4e-11
WP_000422741.1|70962_71388_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|71384_71735_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|71765_73379_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_004197500.1|75516_78879_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_004197497.1|78878_82019_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	28.2	3.6e-30
WP_001568064.1|82073_85037_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	51.8	4.6e-277
WP_001568063.1|85023_85269_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_094686393.1|85536_86683_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	91.5	1.6e-145
WP_085949440.1|87940_89310_-|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
>prophage 2
NZ_CP012743	Klebsiella pneumoniae subsp. pneumoniae strain TGH8 chromosome, complete genome	5439720	684262	724073	5439720	terminase,plate,tail,lysis,integrase,tRNA,capsid,portal,holin,head	Escherichia_phage(27.5%)	48	684136:684176	717888:717928
684136:684176	attL	GGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_032454123.1|684262_685300_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	64.7	2.7e-123
WP_032454122.1|685306_685891_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	38.7	1.0e-31
WP_004195891.1|686010_686232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032454121.1|686262_686772_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	93.5	4.6e-84
WP_032454120.1|686779_686980_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	93.9	1.1e-30
WP_032454119.1|686943_687282_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	92.0	8.0e-53
WP_062920432.1|687350_687578_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	73.3	1.0e-19
WP_062920433.1|687577_687799_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	86.3	1.2e-28
WP_047718529.1|687799_688081_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	91.4	3.7e-43
WP_074177509.1|688229_690302_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	90.2	0.0e+00
WP_062920435.1|690443_690629_+	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	73.8	1.3e-17
WP_062920436.1|691074_691560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920437.1|691573_692665_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_191720740.1|693034_693235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032454110.1|693529_694573_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.4	4.0e-167
WP_032454109.1|694572_696342_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.8	1.8e-305
WP_032454108.1|696507_697362_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	80.6	4.8e-126
WP_062920439.1|697435_698494_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.2	8.4e-165
WP_074177506.1|698521_699241_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.2	8.1e-95
WP_009309691.1|699337_699844_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_019725382.1|699843_700047_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_019725381.1|700051_700342_+|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	79.6	5.0e-35
WP_032454106.1|700328_700826_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	87.7	8.7e-80
WP_032454105.1|700822_701254_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	6.2e-42
WP_032454104.1|701228_701387_+	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	74.0	4.9e-13
WP_032454103.1|701349_701817_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	2.0e-62
WP_032454101.1|701809_702259_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	70.1	6.5e-50
WP_062920440.1|702609_703713_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_015959011.1|703972_704614_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	2.0e-92
WP_014343405.1|704610_704958_+	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_032433553.1|704962_705871_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	5.2e-115
WP_050442664.1|706465_708730_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	41.0	5.3e-108
WP_032454098.1|708735_709464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032454097.1|709475_710552_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	43.9	2.8e-30
WP_032454096.1|710662_711844_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.9	7.9e-196
WP_014343412.1|711857_712373_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_062920441.1|712433_712709_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	76.1	1.2e-30
WP_074177498.1|712741_712861_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	89.7	4.4e-14
WP_062920443.1|712853_715292_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	71.6	4.2e-292
WP_032454094.1|715308_715788_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.1	4.5e-65
WP_062920444.1|715787_716948_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.2	2.4e-173
WP_071891073.1|716996_717404_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.4	5.9e-26
WP_032454093.1|717496_717715_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	84.7	1.0e-32
WP_002917636.1|718083_718590_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
717888:717928	attR	GGCCCCTGTTGGGTTTGAACCAACGACCAAGCGATTATGAG	NA	NA	NA	NA
WP_004174339.1|718689_720531_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_004149864.1|720749_722495_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|722606_722822_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_040215074.1|723059_724073_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.1e-108
>prophage 3
NZ_CP012743	Klebsiella pneumoniae subsp. pneumoniae strain TGH8 chromosome, complete genome	5439720	1115282	1123645	5439720	integrase	uncultured_Caudovirales_phage(42.86%)	12	NA	NA
WP_062920489.1|1115282_1115570_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	47.8	2.8e-14
WP_062920490.1|1115562_1116441_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_062920491.1|1116433_1116613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920492.1|1116609_1116873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920493.1|1116887_1117091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071891076.1|1117096_1117315_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_062920494.1|1117311_1119654_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	39.7	8.7e-146
WP_062920495.1|1120634_1121243_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	62.3	8.2e-56
WP_062920496.1|1121243_1121549_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	58.3	1.4e-27
WP_062920497.1|1121551_1122631_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	52.0	2.0e-97
WP_062920498.1|1122634_1122976_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	55.8	8.5e-18
WP_062920499.1|1122985_1123645_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	51.1	8.9e-56
>prophage 4
NZ_CP012743	Klebsiella pneumoniae subsp. pneumoniae strain TGH8 chromosome, complete genome	5439720	1466138	1504009	5439720	integrase,terminase,tail	Salmonella_phage(41.46%)	50	1461734:1461749	1474915:1474930
1461734:1461749	attL	ATGAAACTTGATCGCG	NA	NA	NA	NA
WP_004151980.1|1466138_1467605_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1467672_1469250_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_040025481.1|1469441_1470692_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.6	1.3e-204
WP_040025484.1|1470708_1470900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040025485.1|1470896_1471490_-	adenine methylase	NA	T1SA14	Salmonella_phage	90.4	1.8e-108
WP_040025486.1|1471486_1472137_-	hypothetical protein	NA	R9VWB9	Serratia_phage	47.8	1.7e-51
WP_040025488.1|1472133_1472292_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.0	5.6e-17
WP_040025490.1|1472284_1472578_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	70.1	8.9e-32
WP_004144294.1|1472687_1472936_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_040025492.1|1472984_1473920_-	recombinase RecT	NA	A0A193GYL3	Enterobacter_phage	76.7	2.0e-141
WP_040025495.1|1473916_1474738_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	80.6	5.6e-132
WP_040025497.1|1474734_1475034_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	55.6	9.4e-21
1474915:1474930	attR	ATGAAACTTGATCGCG	NA	NA	NA	NA
WP_004164037.1|1475030_1475180_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_040025499.1|1475400_1475982_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	3.5e-64
WP_004152538.1|1476136_1476370_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1476516_1476726_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1476725_1477493_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_052915161.1|1477489_1478275_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.0	1.2e-131
WP_062920554.1|1478394_1478739_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	5.3e-52
WP_064144943.1|1478931_1479378_+	hypothetical protein	NA	K7P858	Enterobacteria_phage	41.8	1.1e-17
WP_062920556.1|1479374_1479581_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	97.1	5.3e-31
WP_062921080.1|1479697_1480081_+	hypothetical protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	77.5	7.0e-37
WP_062920557.1|1480081_1480462_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.4	1.8e-64
WP_062920559.1|1481108_1481360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064144922.1|1481356_1481551_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	76.7	2.2e-10
WP_062920561.1|1481918_1482257_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.9	4.7e-45
WP_032418540.1|1482331_1482589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032457429.1|1482666_1483251_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	89.1	5.8e-91
WP_062920562.1|1483247_1484723_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.4	7.1e-279
WP_004152473.1|1484766_1485288_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004152472.1|1485993_1486197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152471.1|1486200_1487880_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152470.1|1487876_1488182_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_019404949.1|1488184_1488862_+	peptidase	NA	T1SAP9	Salmonella_phage	63.6	2.0e-50
WP_004197367.1|1488874_1489882_+	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_004152466.1|1489891_1490284_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152465.1|1490276_1490555_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004153043.1|1490603_1491215_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152463.1|1491214_1493692_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004152462.1|1493693_1494164_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152461.1|1494156_1494654_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004152460.1|1494666_1497411_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	9.1e-94
WP_004152459.1|1497410_1500800_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152458.1|1500809_1501424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|1501698_1502097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152456.1|1502101_1502284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152455.1|1502474_1503170_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_157833602.1|1503253_1503442_-	ash family protein	NA	NA	NA	NA	NA
WP_004152454.1|1503550_1503748_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152453.1|1503751_1504009_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
>prophage 5
NZ_CP012743	Klebsiella pneumoniae subsp. pneumoniae strain TGH8 chromosome, complete genome	5439720	2092226	2148493	5439720	protease,plate,transposase	Staphylococcus_phage(18.18%)	56	NA	NA
WP_032425077.1|2092226_2092973_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_032425076.1|2093411_2094398_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004145488.1|2095229_2095352_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_004219597.1|2095649_2095793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023286625.1|2095969_2096911_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2097004_2097994_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2098019_2099351_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_032425074.1|2099378_2100587_+	propionate kinase	NA	NA	NA	NA	NA
WP_032425474.1|2100615_2102910_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	7.4e-158
WP_004225356.1|2102961_2103108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189329.1|2103397_2104456_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|2104565_2105480_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060614333.1|2105489_2106776_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_032425073.1|2106772_2107648_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004175491.1|2107644_2108364_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|2108369_2109263_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|2109546_2111190_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|2111239_2111716_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020801827.1|2111814_2112741_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032425072.1|2113044_2114340_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	7.4e-62
WP_004145468.1|2114351_2115161_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020801945.1|2115135_2116035_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2116144_2116627_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004197491.1|2116817_2117516_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|2117541_2118081_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2118195_2118525_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899025.1|2119093_2120434_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004184632.1|2120430_2121084_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032425071.1|2121087_2122785_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032425070.1|2123243_2125730_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_062920637.1|2125753_2127085_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_072198477.1|2127129_2128098_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.9e-172
WP_032425068.1|2128174_2128684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2128680_2129187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2129281_2129434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032423970.1|2129423_2129933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425067.1|2130226_2131582_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_004200304.1|2131582_2132092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958632.1|2132088_2132595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160538917.1|2132670_2132862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072198474.1|2133056_2134085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958629.1|2134108_2134414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614315.1|2134435_2135329_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.1e-13
WP_032410376.1|2135374_2135491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946122.1|2135512_2136406_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2136431_2136560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184615.1|2136581_2137475_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.2e-12
WP_162487910.1|2137770_2138004_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_014343198.1|2137967_2138540_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	33.3	3.9e-07
WP_072093174.1|2139277_2139463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2139760_2140027_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032411808.1|2141176_2144587_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_032411805.1|2144720_2146484_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_074442384.1|2146513_2147530_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_020806091.1|2147510_2148047_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004175538.1|2148049_2148493_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 6
NZ_CP012743	Klebsiella pneumoniae subsp. pneumoniae strain TGH8 chromosome, complete genome	5439720	2835334	2845250	5439720		Escherichia_phage(85.71%)	8	NA	NA
WP_062920745.1|2835334_2838442_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2838496_2839762_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2839791_2840880_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_062920746.1|2840966_2841227_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	4.6e-40
WP_002210513.1|2841435_2842197_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2842457_2843360_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_062920747.1|2843371_2844637_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	98.8	5.6e-232
WP_002210516.1|2844629_2845250_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP012743	Klebsiella pneumoniae subsp. pneumoniae strain TGH8 chromosome, complete genome	5439720	3063074	3091428	5439720	tail	Klebsiella_phage(18.52%)	35	NA	NA
WP_087831371.1|3063074_3066209_-	SGNH/GDSL hydrolase family protein	NA	A0A1I9SEN3	Klebsiella_phage	32.3	1.7e-104
WP_039110596.1|3066303_3069372_-	kinase	NA	A0A286S259	Klebsiella_phage	97.2	0.0e+00
WP_004152651.1|3069368_3069749_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_039110595.1|3069758_3070241_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	95.6	4.1e-82
WP_039110593.1|3070421_3070886_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	1.5e-57
WP_039110591.1|3070885_3073768_-|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.0	1.7e-98
WP_032416607.1|3073841_3074210_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	3.3e-15
WP_004217333.1|3074320_3074677_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_008807842.1|3074753_3074960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008807841.1|3075097_3075580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591823.1|3075633_3076806_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
WP_004190640.1|3076829_3077222_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_039110587.1|3077218_3077770_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	2.3e-28
WP_004217344.1|3077771_3078155_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_040246471.1|3078141_3078375_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	4.4e-10
WP_004190649.1|3078384_3078639_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_023300922.1|3078640_3079036_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_129321712.1|3079076_3079349_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004190653.1|3079357_3080311_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_032423789.1|3080321_3081107_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.7e-66
WP_062920774.1|3081378_3081726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804596.1|3081821_3082250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804600.1|3082253_3082475_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.3e-11
WP_020804604.1|3082471_3082726_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_020804603.1|3082718_3082922_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
WP_039110576.1|3082918_3083704_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	4.8e-64
WP_032417027.1|3083696_3084032_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	1.3e-10
WP_032417026.1|3084039_3084789_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
WP_023286278.1|3084791_3085700_-	hypothetical protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
WP_020804480.1|3085714_3085903_-	ClpX C4-type zinc finger	NA	NA	NA	NA	NA
WP_023287506.1|3085990_3086527_-	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
WP_029503646.1|3086529_3086763_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
WP_039110572.1|3086867_3087263_+	helix-turn-helix transcriptional regulator	NA	K7PM35	Enterobacteria_phage	74.0	1.4e-48
WP_136085610.1|3087280_3087379_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_074177544.1|3088917_3091428_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	1.1e-18
>prophage 8
NZ_CP012743	Klebsiella pneumoniae subsp. pneumoniae strain TGH8 chromosome, complete genome	5439720	3152847	3167327	5439720	integrase	Salmonella_phage(36.36%)	14	3152629:3152644	3164633:3164648
3152629:3152644	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_039110606.1|3152847_3153516_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.8	4.0e-80
WP_113706523.1|3153716_3154625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039110604.1|3155297_3156563_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.0	7.6e-205
WP_002901812.1|3156564_3156984_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_022631177.1|3157510_3157819_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
WP_004179600.1|3158115_3158307_+	YebW family protein	NA	NA	NA	NA	NA
WP_012967861.1|3158315_3158471_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
WP_039110567.1|3158608_3161647_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	57.0	3.0e-292
WP_062920787.1|3161659_3162769_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.4	6.5e-184
WP_071891120.1|3162809_3163049_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	68.8	2.3e-22
WP_038807825.1|3163269_3164487_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	5.6e-120
WP_004151901.1|3164633_3165524_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3164633:3164648	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3165523_3166516_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3166517_3167327_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 9
NZ_CP012743	Klebsiella pneumoniae subsp. pneumoniae strain TGH8 chromosome, complete genome	5439720	3538547	3628558	5439720	plate,terminase,tail,protease,lysis,integrase,tRNA,capsid,portal,head	Salmonella_phage(55.56%)	94	3577139:3577154	3630991:3631006
WP_002898139.1|3538547_3539840_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_032419141.1|3539930_3541274_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3541282_3541894_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_062920821.1|3542016_3546270_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3546405_3546900_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3547432_3548401_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_062920822.1|3548515_3550282_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	26.2	1.0e-21
WP_062920823.1|3550282_3552004_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.0	9.0e-15
WP_002898014.1|3552048_3552750_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3553103_3553322_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3553441_3555721_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3555751_3556069_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3556394_3556616_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3556692_3558633_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3558629_3559745_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004176693.1|3559891_3561550_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3561969_3562665_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3562780_3563680_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_004176696.1|3563823_3565476_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_004147771.1|3565486_3566455_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_062920824.1|3566666_3567101_-	DoxX family protein	NA	NA	NA	NA	NA
WP_004176700.1|3567252_3568971_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_004176702.1|3569009_3570011_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_062920825.1|3570021_3571464_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3571551_3572565_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004209681.1|3572561_3573392_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_062920826.1|3573423_3574563_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3575440_3575956_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3576182_3576911_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3576931_3577663_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
3577139:3577154	attL	GACAGCCTGATCCCGG	NA	NA	NA	NA
WP_002896386.1|3577669_3578386_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004191163.1|3578385_3579054_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_062920827.1|3579237_3579969_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_019704675.1|3580055_3581528_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	1.8e-27
WP_002896380.1|3581524_3582241_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_062920828.1|3582319_3583447_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.8e-19
WP_002896376.1|3583488_3583977_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3584034_3584880_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3584876_3585830_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3585840_3586974_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_062920829.1|3587137_3588250_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3588598_3589078_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3589166_3590069_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_008805812.1|3590243_3590531_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3590733_3590997_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3591003_3591387_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_004147745.1|3591653_3593339_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3593560_3593779_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_021566199.1|3593869_3594970_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	5.5e-175
WP_000980414.1|3594966_3595452_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	1.8e-66
WP_062920830.1|3595448_3598526_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.9	0.0e+00
WP_000763311.1|3598518_3598638_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3598652_3598955_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|3599009_3599525_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001555854.1|3599534_3600707_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	4.6e-204
WP_001555853.1|3600849_3601416_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	2.2e-87
WP_077263506.1|3601446_3601989_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	55.4	2.1e-42
WP_001555895.1|3601988_3602591_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	2.5e-97
WP_001174919.1|3602562_3603003_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_062920831.1|3603005_3604412_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	75.5	1.0e-154
WP_001086820.1|3604408_3605014_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_021532224.1|3605006_3605915_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.2e-143
WP_000177580.1|3605901_3606261_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_038430657.1|3606257_3606836_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	84.9	3.0e-92
WP_038431118.1|3606962_3608474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591600.1|3608561_3609026_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	5.5e-60
WP_038431116.1|3609018_3609450_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	2.2e-71
WP_038431114.1|3609545_3609974_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.9e-59
WP_038431112.1|3609970_3610486_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.2	1.8e-88
WP_000171568.1|3610466_3610682_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_038431109.1|3610685_3610889_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	3.0e-31
WP_000673530.1|3610888_3611353_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_021563628.1|3611448_3612099_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_032427925.1|3612102_3613158_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.7e-181
WP_002895967.1|3613174_3614008_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_031591583.1|3614150_3615917_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_038431107.1|3615916_3616945_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	86.7	4.9e-170
WP_038431152.1|3616975_3618628_-	NTPase	NA	X2KLG0	Campylobacter_phage	27.8	2.1e-13
WP_016529210.1|3618829_3619672_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.5	1.3e-59
WP_016529211.1|3619671_3619890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016529212.1|3620176_3620410_-	DinI family protein	NA	A0A1S6L014	Salmonella_phage	89.6	1.1e-32
WP_001154434.1|3620420_3620609_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_038431106.1|3620762_3623177_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.8	0.0e+00
WP_032291301.1|3623173_3624031_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	4.3e-159
WP_000145290.1|3624027_3624330_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_000752613.1|3624326_3624554_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244228.1|3624553_3624787_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_001747374.1|3624854_3625196_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	6.6e-55
WP_000956187.1|3625313_3625610_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	2.2e-22
WP_000460893.1|3625617_3626127_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188450.1|3626191_3626395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346406.1|3626540_3627110_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_000900883.1|3627125_3627317_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001763838.1|3627577_3628558_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.5	4.8e-98
3630991:3631006	attR	GACAGCCTGATCCCGG	NA	NA	NA	NA
>prophage 10
NZ_CP012743	Klebsiella pneumoniae subsp. pneumoniae strain TGH8 chromosome, complete genome	5439720	4048982	4097923	5439720	terminase,plate,tail,lysis,tRNA	uncultured_Caudovirales_phage(25.42%)	77	NA	NA
WP_062920886.1|4048982_4049300_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	52.0	1.4e-22
WP_062920887.1|4049299_4049539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062920888.1|4049971_4050193_-	hypothetical protein	NA	A0A2H4YGX6	Raoultella_phage	91.8	8.7e-32
WP_062920889.1|4050206_4051832_-	hypothetical protein	NA	A0A0C5AFR8	Klebsiella_phage	94.6	1.5e-309
WP_062920890.1|4051844_4053740_-	hypothetical protein	NA	A0A0C5ACP6	Klebsiella_phage	91.1	1.2e-249
WP_029498896.1|4053763_4054342_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	51.8	6.4e-50
WP_077265686.1|4054673_4055408_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	46.1	1.7e-31
WP_062920892.1|4055389_4056163_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	49.8	2.2e-66
WP_062920893.1|4056159_4057359_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	75.2	5.8e-162
WP_004152573.1|4057358_4057712_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_062920894.1|4057713_4058367_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	51.2	4.1e-61
WP_048322149.1|4058454_4059207_-	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	55.6	4.7e-61
WP_062920895.1|4059279_4059900_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	38.5	4.2e-31
WP_048322151.1|4059945_4060125_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_048322152.1|4060206_4060425_+	Arc family DNA-binding protein	NA	A0A0M5M1J2	Salmonella_phage	41.8	3.6e-06
WP_062920896.1|4060467_4060818_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	41.6	5.5e-20
WP_062920897.1|4060814_4061843_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	53.1	1.9e-97
WP_074442389.1|4061845_4062073_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	57.3	1.6e-20
WP_062920899.1|4062148_4062748_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	1.3e-53
WP_062920900.1|4062747_4064766_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	56.7	7.6e-207
WP_016244729.1|4064755_4064908_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_062920901.1|4064949_4065369_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	65.9	5.1e-41
WP_062920902.1|4065372_4065816_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	9.5e-62
WP_062920903.1|4065825_4066971_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	77.4	2.8e-166
WP_062920904.1|4066974_4067415_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.0	6.0e-40
WP_062920905.1|4067509_4067896_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	76.6	6.8e-48
WP_062920906.1|4067895_4068513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038435200.1|4068509_4068929_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	61.5	2.0e-40
WP_062920907.1|4068897_4069179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062920908.1|4069218_4070160_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	75.8	1.6e-135
WP_062920909.1|4070171_4070666_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	63.4	8.4e-51
WP_062920910.1|4070669_4071872_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.9	3.6e-111
WP_062920911.1|4071923_4072472_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	2.3e-49
WP_062920912.1|4072527_4073979_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.6	1.9e-191
WP_021312714.1|4074217_4075618_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	9.4e-188
WP_004218030.1|4075568_4076057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167875427.1|4076432_4076609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062920914.1|4076710_4077178_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	72.9	2.7e-54
WP_062920915.1|4077174_4077678_-	lysozyme	NA	M1FJA0	Enterobacteria_phage	80.2	5.5e-74
WP_004146347.1|4077680_4077995_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	86.1	6.3e-44
WP_062920916.1|4078444_4079134_-	antiterminator	NA	I6PDF8	Cronobacter_phage	55.8	4.5e-58
WP_114139929.1|4079130_4079892_-	YlcG family protein	NA	M9NYX8	Enterobacteria_phage	76.1	2.6e-75
WP_062920917.1|4079884_4080553_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	80.1	1.7e-107
WP_071891127.1|4080549_4080717_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	64.8	2.1e-09
WP_062920918.1|4080716_4081172_-	YbcN family protein	NA	K7P7B8	Enterobacteria_phage	69.5	1.8e-55
WP_062920919.1|4081424_4081733_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	54.1	2.2e-20
WP_062920921.1|4081913_4082111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077257772.1|4082660_4082825_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_071891130.1|4082824_4083400_-	ead/Ea22-like family protein	NA	Q858D0	Salmonella_phage	54.4	2.6e-43
WP_062920923.1|4083396_4083801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062920924.1|4083797_4084307_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	32.0	1.7e-06
WP_062920925.1|4084303_4084528_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	50.7	1.8e-13
WP_062920926.1|4084524_4084827_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062920927.1|4084826_4085603_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	65.4	1.4e-95
WP_023304897.1|4085599_4086328_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	73.0	7.8e-37
WP_004139615.1|4086461_4086683_-	bacteriophage CII family protein	NA	NA	NA	NA	NA
WP_004191589.1|4086722_4086941_-	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	50.7	1.4e-13
WP_021312733.1|4087049_4087709_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	61.5	1.9e-69
WP_160538933.1|4088063_4088222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|4088214_4088421_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_062920928.1|4088500_4089472_+	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	76.8	3.8e-39
WP_062920929.1|4089479_4089677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004177104.1|4089673_4089832_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	60.0	4.5e-06
WP_009483856.1|4089828_4090482_+	ERF family protein	NA	A0A1W6JP21	Morganella_phage	62.3	4.0e-64
WP_062920930.1|4090465_4090756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920931.1|4090752_4091058_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062920932.1|4091054_4091711_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	86.9	2.3e-112
WP_009483861.1|4091707_4091926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062920933.1|4091922_4092195_+	hypothetical protein	NA	Q716F1	Shigella_phage	63.5	1.1e-23
WP_062920934.1|4092191_4092947_+	hypothetical protein	NA	R9VWB9	Serratia_phage	57.1	8.6e-71
WP_062920935.1|4092943_4093135_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	59.3	1.1e-11
WP_062920936.1|4093131_4093353_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.2	2.0e-12
WP_029497251.1|4093352_4093592_+	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	47.4	2.4e-11
WP_071891156.1|4093604_4093940_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004143017.1|4095411_4096278_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|4096279_4096492_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4096537_4097923_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
