The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011061	Escherichia coli str. Sanji chromosome, complete genome	4891769	199879	272722	4891769	plate,tRNA,protease,transposase	uncultured_Caudovirales_phage(20.0%)	59	NA	NA
WP_001295561.1|199879_201232_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|201261_203694_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|203815_204301_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|204304_205330_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|205434_205890_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|205893_206682_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139654.1|206681_207830_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|207826_208423_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|208459_211942_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|211954_212914_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|213012_215154_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901099.1|215210_215600_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176549.1|215664_216963_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|217011_217272_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|217258_217459_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|217624_218170_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635537.1|218166_218589_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239163.1|218602_219313_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001336393.1|219512_220337_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|220390_222109_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|222220_222928_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|222924_223329_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|223446_224262_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|224301_224955_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000594006.1|224947_225979_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
WP_001140187.1|226166_226742_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|232501_233305_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648572.1|233301_234216_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|234456_235257_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000016007.1|235260_235884_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000644685.1|235931_237290_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|237361_238117_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|238150_238873_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|238869_239337_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001340895.1|239401_240133_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_001086141.1|240669_241455_+	lipoprotein	NA	NA	NA	NA	NA
WP_001236653.1|241591_242071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908066.1|242080_242995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|243038_243521_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087741.1|243544_244897_-	membrane protein	NA	NA	NA	NA	NA
WP_122545204.1|244907_248342_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240525.1|248450_249863_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088852.1|249867_250611_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614325.1|250607_253373_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000343289.1|253381_254143_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246443.1|254147_255479_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|255481_256006_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113709.1|256002_257283_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|257307_258390_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|258353_260204_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|260207_260621_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056989.1|260627_262103_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|262153_262378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|262412_262913_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|263607_264126_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_032329316.1|264335_266477_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	2.4e-25
WP_039023185.1|266552_270785_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_001101839.1|270762_271155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420818.1|271585_272722_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011061	Escherichia coli str. Sanji chromosome, complete genome	4891769	280980	336787	4891769	portal,holin,capsid,tail,plate,terminase,head,integrase,protease,transposase	Shigella_phage(56.86%)	71	315294:315311	346835:346852
WP_000006255.1|280980_281478_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|281701_283441_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|283385_284171_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|284241_285297_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|285348_285642_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|285644_286043_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|286052_286505_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|286810_287077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|287009_287546_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|287602_289060_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|289320_289779_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|289870_291115_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|291172_291574_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_039023169.1|291612_292668_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
WP_001285288.1|292955_294059_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|294070_295324_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_000051893.1|295528_296692_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_000433939.1|296568_296919_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000206732.1|296918_297224_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|297223_297586_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000008200.1|297576_298113_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000917896.1|298789_299086_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000450735.1|299271_299898_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|299995_300196_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|300233_300785_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_001250269.1|300960_301140_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_062914680.1|301129_302071_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
WP_074151166.1|302067_302562_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.1e-85
WP_000210164.1|302561_302888_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_062914681.1|302884_303274_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	96.9	1.9e-66
WP_062914682.1|303293_304103_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.1	2.4e-151
WP_062914683.1|304110_305100_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	4.0e-193
WP_042093445.1|305117_305465_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	87.6	4.7e-56
WP_062914684.1|305486_305972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053897786.1|305995_306817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120496.1|307096_307423_+|holin	phage holin, lambda family	holin	U5P0K7	Shigella_phage	99.1	1.2e-56
WP_016159277.1|307426_307903_+	glycoside hydrolase family 104 protein	NA	U5P0A9	Shigella_phage	98.7	6.4e-88
WP_012599940.1|307886_308279_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	86.2	1.4e-53
WP_016159276.1|308804_309239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135210.1|309366_309717_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	3.1e-63
WP_000929172.1|309842_310337_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_124064769.1|310570_312067_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	1.8e-298
WP_000605606.1|312078_312261_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_062914686.1|312260_313502_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	7.6e-242
WP_001193631.1|313479_314130_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257490.1|314144_315350_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	100.0	8.2e-225
315294:315311	attL	GGCGGCATGCTGGTCGAT	NA	NA	NA	NA
WP_062914687.1|315398_315599_+	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	6.5e-26
WP_000927711.1|315601_315925_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_062914688.1|315921_316332_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	3.9e-70
WP_062914689.1|316306_316813_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.3	5.0e-83
WP_000779292.1|316809_317370_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_062914690.1|317378_317549_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	1.2e-25
WP_061353157.1|317532_319029_+|tail	phage tail protein	tail	U5P0H3	Shigella_phage	99.6	1.0e-277
WP_000090998.1|319028_319385_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000571713.1|319381_319705_+|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_062914691.1|319789_321697_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.1	0.0e+00
WP_062914692.1|321721_323098_+	DNA circularization protein	NA	U5P4I0	Shigella_phage	98.7	4.8e-253
WP_062914693.1|323094_324174_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	98.9	6.5e-205
WP_001259087.1|324173_324722_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	6.6e-97
WP_062914694.1|324721_325147_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	5.2e-81
WP_062914695.1|325133_326192_+|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	98.9	2.5e-201
WP_000383548.1|326182_326767_+	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_001340317.1|327498_327732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032316.1|327712_328123_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.3	2.2e-20
WP_062914697.1|328125_328632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062914698.1|328661_329216_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.4	2.2e-87
WP_062914699.1|329323_330049_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	43.5	8.1e-34
WP_062914700.1|330452_331886_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	49.7	7.0e-106
WP_158638449.1|331920_333135_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	6.1e-34
WP_023147794.1|333893_334874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772656.1|335578_336787_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	7.7e-130
346835:346852	attR	ATCGACCAGCATGCCGCC	NA	NA	NA	NA
>prophage 3
NZ_CP011061	Escherichia coli str. Sanji chromosome, complete genome	4891769	1267325	1323367	4891769	portal,holin,tRNA,capsid,tail,terminase,head,integrase	Escherichia_phage(44.44%)	62	1262420:1262434	1268900:1268914
1262420:1262434	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074971.1|1267325_1268444_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	44.4	1.6e-84
WP_000003742.1|1268412_1268682_-	excisionase	NA	NA	NA	NA	NA
WP_000102136.1|1268743_1271185_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
1268900:1268914	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001070255.1|1271278_1271470_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854558.1|1271466_1271655_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001517906.1|1272055_1272259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|1272223_1272442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092153.1|1272534_1272735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001420344.1|1273166_1273505_-	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000747951.1|1273896_1274139_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693850.1|1274122_1274548_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262390.1|1274619_1275690_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_001151150.1|1275730_1276153_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_000761441.1|1276153_1276567_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	2.0e-58
WP_001224662.1|1276660_1276843_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_011076332.1|1277456_1277675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|1277877_1278090_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_032155008.1|1278257_1278536_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001221526.1|1278537_1279596_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_000139999.1|1279596_1279977_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_000762879.1|1279973_1280795_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_106104550.1|1281189_1281276_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|1281764_1281977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001333560.1|1282047_1282383_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_000874243.1|1282643_1282832_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001333561.1|1282828_1282990_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000372595.1|1283139_1283355_+|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193264.1|1283359_1283710_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000992097.1|1283773_1284307_+	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_075202333.1|1284523_1284706_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000738421.1|1284796_1285090_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001135104.1|1285615_1285966_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_001333563.1|1286113_1286596_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001140892.1|1286595_1288353_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_000923134.1|1288500_1289727_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_000766109.1|1290332_1291550_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000719064.1|1291626_1291944_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	5.3e-22
WP_001147814.1|1291952_1292291_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000968644.1|1292287_1292737_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001206700.1|1292733_1293078_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	5.1e-55
WP_000097535.1|1293138_1293843_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	92.7	1.4e-112
WP_001324129.1|1293842_1294229_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_077253127.1|1294270_1294531_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	95.3	2.3e-39
WP_000224003.1|1294577_1297805_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_001330090.1|1297782_1298139_+|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_001152457.1|1298138_1298837_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	3.4e-130
WP_001333568.1|1298842_1299586_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	4.5e-149
WP_000090843.1|1299522_1300131_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.9e-100
WP_000515345.1|1300191_1303671_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001233546.1|1303738_1304338_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	1.6e-107
WP_001189123.1|1308291_1309800_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_042047081.1|1311213_1311744_+	chaperone of endosialidase	NA	A0A2D1UII2	Escherichia_phage	85.2	2.5e-69
WP_000241001.1|1311981_1312650_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000799406.1|1313204_1314068_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1314051_1315188_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359434.1|1315437_1316664_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1316712_1317834_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|1317909_1319370_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265471.1|1319369_1320041_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1320209_1321580_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1321583_1322225_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|1322260_1323367_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP011061	Escherichia coli str. Sanji chromosome, complete genome	4891769	2150846	2221337	4891769	integrase,transposase	Stx2-converting_phage(20.0%)	64	2204654:2204669	2227526:2227541
WP_002431311.1|2150846_2152388_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_001323397.1|2155468_2155627_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234729.1|2155781_2156600_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	40.1	4.2e-47
WP_000855059.1|2156941_2157415_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	1.5e-12
WP_001186774.1|2157430_2157907_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692341.1|2157969_2158191_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	4.2e-10
WP_001295723.1|2158353_2158722_+	antitoxin	NA	NA	NA	NA	NA
WP_000854761.1|2158811_2159189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|2159400_2159514_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001333339.1|2159948_2161484_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_000612626.1|2161532_2161880_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|2161876_2162281_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001445118.1|2162774_2163164_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001016348.1|2163617_2163800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2163900_2164230_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_057109539.1|2164401_2165460_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105393.1|2165657_2166131_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_000343760.1|2166226_2167447_+|transposase	ISL3-like element ISKox3 family transposase	transposase	NA	NA	NA	NA
WP_001310935.1|2167573_2168740_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	1.5e-226
WP_000980567.1|2168948_2170376_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_000985273.1|2170418_2170646_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_000492321.1|2170659_2171718_-	transport protein YeeE	NA	NA	NA	NA	NA
WP_000019197.1|2171896_2173255_-	putrescine/proton symporter PlaP	NA	NA	NA	NA	NA
WP_010723108.1|2173244_2173307_-	membrane protein YoeI	NA	NA	NA	NA	NA
WP_000803351.1|2173521_2174451_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000754749.1|2174496_2175321_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000767829.1|2175403_2175658_-	type II toxin-antitoxin system mRNA interferase toxin YoeB	NA	NA	NA	NA	NA
WP_001259255.1|2175654_2175906_-	YoeB-YefM toxin-antitoxin system antitoxin YefM	NA	NA	NA	NA	NA
WP_001364200.1|2176189_2176240_+	his operon leader peptide	NA	NA	NA	NA	NA
WP_032329340.1|2176385_2177285_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
WP_001446927.1|2177290_2178595_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_000108945.1|2178591_2179662_+	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_046464156.1|2179661_2180729_+	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_001103561.1|2180728_2181319_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_000586445.1|2181318_2182056_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_000880176.1|2182037_2182814_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_000954831.1|2182807_2183416_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_128552998.1|2183454_2184414_-	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 3-alpha-mannosyltransferase WbdC	NA	NA	NA	NA	NA
WP_000704906.1|2185205_2186372_-	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.7	1.8e-112
WP_049284001.1|2186535_2187906_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.6	9.3e-31
WP_062914711.1|2187928_2189344_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.6	5.8e-52
WP_062914712.1|2189571_2190978_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	8.0e-38
WP_062914713.1|2191144_2192542_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_062914714.1|2192760_2193714_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_062914715.1|2193721_2195470_-	pectate lyase superfamily protein	NA	A0A0A8J9B0	Klebsiella_phage	33.0	7.6e-54
WP_062914716.1|2195490_2196258_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_020801633.1|2196267_2197437_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_062914717.1|2197448_2198537_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_062914718.1|2198536_2199829_-	O-antigen ligase	NA	NA	NA	NA	NA
WP_062914719.1|2199785_2200940_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_020801659.1|2200950_2202117_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_062914720.1|2202120_2203071_-	polysaccharide pyruvyl transferase	NA	NA	NA	NA	NA
WP_062914721.1|2203930_2206102_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
2204654:2204669	attL	TCGTTTTCCATTTTTA	NA	NA	NA	NA
WP_020801645.1|2206120_2206552_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_020801619.1|2206558_2207692_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_062914722.1|2207837_2209271_-	capsule assembly Wzi family protein	NA	NA	NA	NA	NA
WP_160342378.1|2209560_2209683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062914723.1|2211032_2212184_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	1.5e-42
WP_162497698.1|2212232_2213087_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.4	1.1e-66
WP_024189503.1|2213362_2214253_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	40.3	9.6e-45
WP_001178345.1|2215005_2217696_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0R6PEZ3	Moraxella_phage	43.5	5.5e-35
WP_001252306.1|2218147_2220001_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|2220022_2220604_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|2220695_2221337_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
2227526:2227541	attR	TAAAAATGGAAAACGA	NA	NA	NA	NA
>prophage 5
NZ_CP011061	Escherichia coli str. Sanji chromosome, complete genome	4891769	2290568	2298878	4891769		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001551351.1|2290568_2292569_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|2292693_2293155_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551352.1|2293196_2293667_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001308766.1|2293713_2294433_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2294429_2296115_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240398.1|2296336_2297068_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|2297127_2297235_+	protein YohO	NA	NA	NA	NA	NA
WP_000783134.1|2297215_2297947_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569343.1|2297951_2298878_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 6
NZ_CP011061	Escherichia coli str. Sanji chromosome, complete genome	4891769	2900309	2913492	4891769		Escherichia_phage(50.0%)	12	NA	NA
WP_039023140.1|2900309_2902871_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141322.1|2902976_2903633_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272547.1|2903683_2904481_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000847984.1|2904646_2905555_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	5.1e-118
WP_000590403.1|2905551_2906814_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|2906810_2907449_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|2907453_2908230_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|2908318_2909683_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|2909776_2910769_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2910831_2911971_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2912110_2912737_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2912730_2913492_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 7
NZ_CP011061	Escherichia coli str. Sanji chromosome, complete genome	4891769	4226365	4309874	4891769	lysis,portal,holin,tRNA,capsid,tail,plate,terminase,head,integrase,protease,transposase	Escherichia_phage(51.02%)	90	4219573:4219590	4311450:4311467
4219573:4219590	attL	CAGCGGCATCTCTTCGGG	NA	NA	NA	NA
WP_000560983.1|4226365_4226803_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4226847_4227789_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001295676.1|4228641_4228860_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|4229077_4229320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027703.1|4229649_4230579_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4230575_4231211_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4231207_4232110_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_077248221.1|4232122_4235173_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753617.1|4235366_4236200_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001295677.1|4236352_4237408_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931299.1|4237457_4239206_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_001019486.1|4239205_4240276_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446015.1|4240265_4241717_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|4241727_4242174_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619493.1|4242474_4242789_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179741.1|4242798_4243623_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001311268.1|4244073_4245333_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144073.1|4245329_4246799_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217137.1|4247086_4247923_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000863142.1|4247906_4248845_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063517.1|4248841_4249876_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000122641.1|4250160_4250781_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_001166063.1|4251040_4252024_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|4252172_4252847_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4252952_4254326_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4254322_4255021_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4255170_4255671_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_000985246.1|4255857_4256838_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|4256907_4257201_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|4257337_4257610_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|4257779_4258280_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4258343_4258568_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277952.1|4258567_4258870_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_001113270.1|4258869_4259094_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027659.1|4259090_4259366_+	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	100.0	2.3e-45
WP_002431311.1|4260840_4262382_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.3e-129
WP_001016257.1|4262396_4263143_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000012516.1|4264460_4266944_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000038166.1|4267315_4268350_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.1	1.6e-200
WP_000156872.1|4268349_4270122_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085956.1|4270295_4271150_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.6	1.7e-136
WP_001248567.1|4271208_4272282_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_024176422.1|4272285_4273029_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	96.4	4.6e-125
WP_062914735.1|4273128_4273638_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	4.3e-90
WP_000846414.1|4273637_4273841_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	2.6e-30
WP_000123123.1|4273844_4274126_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144097.1|4274125_4274623_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000736582.1|4274637_4275063_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	3.7e-55
WP_000040631.1|4275050_4275476_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	94.3	1.3e-63
WP_000917160.1|4275583_4276051_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	3.3e-81
WP_001001770.1|4276043_4276496_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	4.5e-75
WP_001093698.1|4276562_4277198_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_000127167.1|4277194_4277542_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001121501.1|4277546_4278455_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	3.7e-161
WP_001285346.1|4278447_4279059_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_001032315.1|4280353_4280770_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.0	3.4e-21
WP_024176421.1|4280741_4281344_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	75.5	2.5e-81
WP_001333405.1|4281358_4281874_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	56.8	5.0e-46
WP_000839179.1|4282015_4282420_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4282416_4282764_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_001333339.1|4282812_4284348_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	3.5e-289
WP_062914736.1|4284355_4284958_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.3	3.5e-99
WP_001286718.1|4285017_4286208_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_001251408.1|4286220_4286739_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|4286795_4287071_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|4287103_4287223_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069960.1|4287215_4289663_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000978889.1|4289677_4290157_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000882940.1|4290156_4291320_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000468308.1|4291401_4291620_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_085947770.1|4291692_4293061_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001145759.1|4293335_4293848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076742.1|4294055_4294958_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|4295138_4296101_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045683.1|4296420_4297410_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001326656.1|4297516_4298272_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216327.1|4298326_4299094_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802214.1|4299201_4299801_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155257.1|4299901_4300342_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655989.1|4300553_4300853_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323547.1|4300879_4301308_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796332.1|4301312_4302059_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4302155_4303166_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4303300_4304809_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4304831_4305677_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4306101_4306347_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4306431_4306917_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4307009_4307936_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|4308002_4309334_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4309343_4309874_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
4311450:4311467	attR	CAGCGGCATCTCTTCGGG	NA	NA	NA	NA
>prophage 8
NZ_CP011061	Escherichia coli str. Sanji chromosome, complete genome	4891769	4582491	4630559	4891769	integrase,transposase	Enterobacteria_phage(16.67%)	39	4623228:4623242	4631567:4631581
WP_131501864.1|4582491_4582605_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	71.4	3.4e-08
WP_001043260.1|4584262_4585078_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|4585138_4585942_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4585941_4586778_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|4587083_4587326_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001493764.1|4587357_4588008_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032153701.1|4588113_4589313_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|4589579_4589885_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023300759.1|4589912_4591127_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_021598067.1|4591343_4592228_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_021512463.1|4592848_4593115_-	P fimbrial regulatory protein KS71A	NA	NA	NA	NA	NA
WP_000930062.1|4593549_4593864_+	major pilus subunit operon regulatory protein PapB	NA	NA	NA	NA	NA
WP_000271619.1|4594784_4596017_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_000878218.1|4596167_4597034_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_161954780.1|4597030_4597261_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062914740.1|4597496_4598477_+	thymidylate synthase	NA	A0A218MLB7	uncultured_virus	35.1	5.6e-22
WP_000820616.1|4598473_4599418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000637419.1|4599420_4600503_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A075BTZ7	Microcystis_phage	38.6	5.5e-10
WP_032153698.1|4600969_4601236_+	hypothetical protein	NA	A0A1L2CUJ8	Pectobacterium_phage	71.6	1.0e-26
WP_000438165.1|4602657_4606071_+	DEAD/DEAH box helicase family protein	NA	Q6NDX2	Leptospira_phage	26.2	8.5e-17
WP_000627728.1|4606134_4607769_+	N-6 DNA methylase	NA	J7I0U9	Acinetobacter_phage	30.9	2.6e-32
WP_000742120.1|4607765_4608908_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000778955.1|4608916_4610539_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000499115.1|4610538_4611435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571844.1|4612056_4612803_+	porin family protein	NA	NA	NA	NA	NA
WP_000228490.1|4613222_4614119_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	27.3	2.1e-31
WP_001207396.1|4614167_4615247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100182.1|4615293_4616865_+	ATP--cob(I)alamin adenosyltransferase	NA	NA	NA	NA	NA
WP_000766274.1|4616861_4617128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001238004.1|4617267_4617465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025492097.1|4617517_4619191_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_032153697.1|4619334_4620369_-	tetratricopeptide repeat family protein	NA	NA	NA	NA	NA
WP_023181049.1|4620418_4620694_+|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	97.8	3.8e-45
WP_001037798.1|4621633_4623028_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_000813678.1|4623222_4624653_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
4623228:4623242	attL	TCAGCATCCATAAAG	NA	NA	NA	NA
WP_001083368.1|4624652_4625930_-	MFS transporter	NA	NA	NA	NA	NA
WP_000253907.1|4625992_4628119_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_000053331.1|4628214_4629225_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001218742.1|4629374_4630559_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.1	1.7e-121
4631567:4631581	attR	TCAGCATCCATAAAG	NA	NA	NA	NA
>prophage 1
NZ_CP011062	Escherichia coli str. Sanji plasmid pSJ_255, complete sequence	255368	58077	98183	255368	transposase,protease,integrase	Escherichia_phage(38.46%)	44	57978:57994	94716:94732
57978:57994	attL	ATATAAAAGAACGGGAA	NA	NA	NA	NA
WP_000795947.1|58077_59253_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001285422.1|59423_59636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|59996_61079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|61245_62745_-	kinase	NA	NA	NA	NA	NA
WP_000081622.1|62770_64408_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|64407_65448_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|65533_66172_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|66171_66813_-	TerD family protein	NA	NA	NA	NA	NA
WP_001388628.1|66835_67474_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|67936_68404_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|68421_69630_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|69640_70597_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_042634304.1|70596_71676_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|71677_72451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|72443_73586_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|73595_74654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|74978_75560_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|75559_76717_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|76739_77195_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_062914744.1|77217_78258_+	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|78306_78885_+	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|78952_79528_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|79956_81198_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|81760_82042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|82091_82283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|82374_82746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|83088_83481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|84084_84378_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062914745.1|85755_85962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|86063_86474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053276223.1|86486_87302_+	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
WP_001043843.1|87555_87981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|88592_89297_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389365.1|89776_90541_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|90767_91073_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|91956_92661_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|92804_93359_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|93489_94320_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|94457_95090_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
94716:94732	attR	TTCCCGTTCTTTTATAT	NA	NA	NA	NA
WP_001749986.1|95174_95627_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|95849_96197_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|96190_97030_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|97157_97361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|97478_98183_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP011062	Escherichia coli str. Sanji plasmid pSJ_255, complete sequence	255368	112996	162591	255368	transposase,integrase	Escherichia_phage(43.48%)	46	119966:120025	160735:161555
WP_077879133.1|112996_113602_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.1e-116
WP_000691727.1|113677_115597_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	100.0	0.0e+00
WP_001791010.1|115612_115729_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001067858.1|116219_116924_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_032193599.1|116953_117658_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_000105383.1|118325_119762_-	glutathione synthase	NA	NA	NA	NA	NA
119966:120025	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|120028_120733_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|120854_121760_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|121756_122995_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|122994_123579_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|123715_124420_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_152921942.1|125544_126012_+	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	47.2	4.9e-08
WP_000784387.1|126860_127718_-	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001424595.1|127733_127991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|128102_128807_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067855.1|130081_130786_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|130899_131676_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000742814.1|131904_132930_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|133351_134104_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|135914_136400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|137777_138593_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|138679_138982_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|138875_139127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062914750.1|139157_140651_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|140762_141068_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|141095_142310_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|142526_143411_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_062914754.1|144335_145040_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.3	9.4e-120
WP_046788546.1|145124_145526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344976.1|145534_148486_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|148488_149049_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|149174_149525_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|149727_150741_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|150907_151750_+	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000050382.1|151845_152454_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|152511_153303_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|153564_154824_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|154916_155708_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|155877_156210_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_109023896.1|157111_157387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|157389_158181_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|158649_158895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|158932_159796_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001067855.1|160026_160731_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|160881_161697_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
160735:161555	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCG	NA	NA	NA	NA
WP_001067855.1|161886_162591_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP011063	Escherichia coli str. Sanji plasmid pSJ_98, complete sequence	98436	205	98038	98436	transposase,terminase,holin,integrase,tail	Escherichia_phage(58.59%)	104	51:63	24621:24633
51:63	attL	TAAATCCATACAG	NA	NA	NA	NA
WP_000542336.1|205_427_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_000067534.1|434_1466_+|integrase	site-specific integrase	integrase	Q71TG5	Escherichia_phage	99.7	2.2e-194
WP_023156637.1|2073_2634_+	Ref family protein	NA	Q5QBN4	Enterobacteria_phage	95.7	2.3e-97
WP_023156639.1|2822_3464_+	hypothetical protein	NA	A0A077SK30	Escherichia_phage	98.1	1.6e-113
WP_023156640.1|3520_4828_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_000747846.1|4874_5123_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000224043.1|5119_5560_-	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_062914756.1|5593_12361_-	N-6 DNA methylase	NA	Q1MVN7	Enterobacteria_phage	98.7	0.0e+00
WP_023153801.1|12436_14146_+	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.6	0.0e+00
WP_023352830.1|14138_15158_+	hypothetical protein	NA	Q71TR6	Escherichia_phage	89.7	7.6e-163
WP_001345478.1|15449_16007_-	lysozyme	NA	Q71TF3	Escherichia_phage	100.0	4.2e-107
WP_023352831.1|16175_16664_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	87.7	1.1e-74
WP_023351931.1|16866_17655_+	hypothetical protein	NA	A0A077SK34	Escherichia_phage	99.2	8.0e-144
WP_023352832.1|17647_18742_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	36.7	6.7e-40
WP_001165936.1|18773_19082_-	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_062914757.1|19071_22059_-	hypothetical protein	NA	A0A1B0VFX4	Salmonella_phage	99.5	0.0e+00
WP_048218295.1|22158_23367_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	99.8	4.1e-224
WP_000175491.1|23406_23772_-	hypothetical protein	NA	A0A1B0V846	Salmonella_phage	98.3	9.3e-47
WP_048218296.1|23768_25688_-	defense against restriction protein A	NA	A0A1B0V7H1	Salmonella_phage	98.4	0.0e+00
24621:24633	attR	CTGTATGGATTTA	NA	NA	NA	NA
WP_001345482.1|25689_26292_-	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	100.0	5.4e-100
WP_000580776.1|26278_26722_-	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_000887652.1|26718_27048_-|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_048218298.1|27122_27386_-	hypothetical protein	NA	Q71TD9	Escherichia_phage	62.4	4.0e-23
WP_023351542.1|27821_28394_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.6	1.5e-83
WP_048218313.1|28424_28913_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	72.2	1.7e-59
WP_062914758.1|28912_29515_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	9.8e-94
WP_001032314.1|29486_29903_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	47.6	4.1e-22
WP_077879135.1|29905_33127_-	hypothetical protein	NA	A0A1B0V7G4	Salmonella_phage	46.0	1.1e-16
WP_001286326.1|33138_33573_-	hypothetical protein	NA	A0A077SLL3	Escherichia_phage	100.0	3.3e-75
WP_048218248.1|33651_34488_-	hypothetical protein	NA	A0A1B0V7F2	Salmonella_phage	98.2	8.4e-152
WP_062914759.1|34487_35921_-	hypothetical protein	NA	A0A1B0VAD6	Salmonella_phage	99.8	8.2e-272
WP_000002800.1|35917_36274_-	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_100183872.1|36273_39969_-	transglycosylase SLT domain-containing protein	NA	A0A1B0VDM8	Salmonella_phage	85.9	0.0e+00
WP_000926342.1|40050_40932_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	98.6	2.7e-172
WP_000523980.1|40946_41558_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_023153778.1|41568_42135_-	hypothetical protein	NA	Q1MVL0	Enterobacteria_phage	99.5	1.1e-99
WP_032192786.1|42365_43259_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	30.3	3.4e-26
WP_001057312.1|43310_43787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000093548.1|43809_44160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001396852.1|44518_44638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071550046.1|44656_44878_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	80.3	9.3e-26
WP_033560573.1|44874_45966_+	antirepressor	NA	A0A077SLR9	Escherichia_phage	79.8	7.1e-159
WP_001187875.1|46130_46931_+	protein kilA	NA	Q1MVK4	Enterobacteria_phage	100.0	1.9e-148
WP_062914760.1|46960_47806_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	97.5	1.8e-149
WP_052761440.1|48070_49126_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	70.8	9.0e-143
WP_001561122.1|49195_49483_-	DUF3892 domain-containing protein	NA	NA	NA	NA	NA
WP_053896077.1|49772_50369_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	100.0	6.3e-109
WP_000509939.1|50540_51050_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035251.1|51061_51643_-	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.5	3.8e-103
WP_062914761.1|51678_52494_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.9	9.8e-113
WP_062914762.1|52503_54093_-	hypothetical protein	NA	Q71TB2	Escherichia_phage	98.5	1.9e-301
WP_023153705.1|54153_55860_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	94.4	4.7e-311
WP_053903354.1|56086_57088_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	99.7	4.8e-178
WP_001285362.1|57104_58301_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_001076427.1|58858_59719_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_000458377.1|60045_60447_-	hypothetical protein	NA	Q71TL7	Escherichia_phage	54.0	5.5e-32
WP_001281923.1|60517_60877_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	69.1	4.6e-38
WP_000007769.1|61054_61477_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_048218262.1|61516_62305_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	96.9	1.7e-117
WP_001177862.1|62766_63051_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	97.9	2.5e-47
WP_000472529.1|63043_63949_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	99.7	1.6e-159
WP_062914763.1|63945_66210_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	66.8	0.0e+00
WP_085947770.1|67312_68681_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000751808.1|69630_70458_+	hypothetical protein	NA	A0A077SLJ6	Escherichia_phage	100.0	1.6e-131
WP_001276603.1|70847_72212_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.8	1.6e-253
WP_062914764.1|72211_73210_+	hypothetical protein	NA	Q71TK3	Escherichia_phage	99.1	8.1e-194
WP_000535208.1|73256_73889_-	hypothetical protein	NA	Q1MVH8	Enterobacteria_phage	100.0	9.0e-90
WP_023153696.1|73881_74898_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.7	4.5e-192
WP_000602719.1|74899_75685_-	hypothetical protein	NA	A0A1B0V7N6	Salmonella_phage	99.6	3.6e-144
WP_000896801.1|75671_76400_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_001141908.1|76403_77621_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000235786.1|77630_78008_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840931.1|78154_78400_+	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000943607.1|78402_78981_+	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_000096174.1|79047_79203_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000484110.1|79704_80331_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
WP_023352819.1|80327_81005_+	hypothetical protein	NA	Q71TJ1	Escherichia_phage	99.6	1.1e-133
WP_000684868.1|81001_81703_+	hypothetical protein	NA	Q71TJ0	Escherichia_phage	99.6	2.1e-143
WP_023153718.1|82004_83267_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	99.8	9.2e-235
WP_000021768.1|83339_83846_+	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	99.4	1.8e-93
WP_023153717.1|84040_84769_+	hypothetical protein	NA	Q71T76	Escherichia_phage	99.1	1.7e-140
WP_000158004.1|84852_85056_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	95.5	5.2e-31
WP_023352820.1|85048_85288_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	97.5	1.3e-36
WP_023154014.1|85284_86010_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	49.8	7.5e-48
WP_000118152.1|86006_86306_+	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
WP_033550033.1|86307_86865_+	ead/Ea22-like family protein	NA	A0A0N7BYR8	Escherichia_phage	62.8	5.1e-36
WP_000224220.1|86866_87130_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	73.6	6.7e-31
WP_053903357.1|87140_87740_+	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	92.6	7.5e-78
WP_000516537.1|87822_88056_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	97.4	1.6e-36
WP_001677496.1|88234_88528_+	hypothetical protein	NA	A0A077SK23	Escherichia_phage	91.8	9.1e-45
WP_023154376.1|88534_88909_+	hypothetical protein	NA	A0A1B0VBU7	Salmonella_phage	97.6	1.1e-66
WP_077780118.1|88890_89823_+	hypothetical protein	NA	A0A1B0VDS6	Salmonella_phage	97.7	2.6e-178
WP_001261544.1|89819_90182_+	hypothetical protein	NA	Q71TI4	Escherichia_phage	100.0	2.2e-56
WP_001377386.1|90843_91095_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	94.0	4.6e-37
WP_000506726.1|91218_91608_+	DNA repair protein	NA	Q1MVE7	Enterobacteria_phage	99.2	1.4e-69
WP_001190712.1|91680_91902_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|91901_92282_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_000113019.1|92286_92466_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_000648823.1|92493_93537_+	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.8	2.2e-205
WP_001369802.1|93625_94078_+	hypothetical protein	NA	Q71T63	Escherichia_phage	98.7	1.1e-78
WP_000219605.1|94164_95358_+|terminase	terminase	terminase	Q5QBP3	Enterobacteria_phage	99.0	4.1e-208
WP_000124155.1|95357_96842_+	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	100.0	2.5e-292
WP_000611656.1|96866_97718_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874154.1|97828_98038_-	hypothetical protein	NA	Q5XLQ8	Enterobacteria_phage	100.0	4.8e-32
