The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	2755050	2823484	7459003	head,tail,transposase,plate,integrase	Burkholderia_phage(55.77%)	76	2753722:2753740	2781056:2781074
2753722:2753740	attL	CTGCGCGGTGCGCTGGATC	NA	NA	NA	NA
WP_006485401.1|2755050_2755422_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	100.0	8.5e-64
WP_062910474.1|2755418_2755835_-	regulatory protein GemA	NA	Q6QIE7	Burkholderia_phage	91.9	8.6e-65
WP_015985074.1|2756162_2756435_-	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	100.0	1.1e-41
WP_062910475.1|2756498_2757116_-	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	98.5	5.3e-111
WP_080466866.1|2757239_2757662_-	hypothetical protein	NA	Q6QIE3	Burkholderia_phage	96.4	1.8e-73
WP_062910476.1|2757697_2758027_-	hypothetical protein	NA	Q6QIE2	Burkholderia_phage	97.2	8.4e-55
WP_143262559.1|2758028_2759243_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	98.8	1.9e-221
WP_062910477.1|2759239_2761039_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	98.3	0.0e+00
WP_062910478.1|2761056_2761998_-	hypothetical protein	NA	Q6QID9	Burkholderia_phage	86.5	2.6e-141
WP_062910479.1|2762009_2762318_-	helix-turn-helix domain-containing protein	NA	A4JWN4	Burkholderia_virus	79.4	5.3e-35
WP_062910480.1|2762314_2762794_-	hypothetical protein	NA	Q6QID6	Burkholderia_phage	98.1	1.4e-87
WP_012493768.1|2762914_2763151_+	hypothetical protein	NA	Q6QID5	Burkholderia_phage	100.0	3.6e-36
WP_006485399.1|2763199_2763442_-	DNA-binding protein	NA	Q6QID3	Burkholderia_phage	100.0	4.4e-37
WP_012493766.1|2763569_2763986_+	helix-turn-helix transcriptional regulator	NA	Q6QID2	Burkholderia_phage	100.0	7.1e-67
WP_062910481.1|2763982_2764756_+	hypothetical protein	NA	Q6QID1	Burkholderia_phage	88.0	1.4e-124
WP_062910482.1|2764829_2765018_+	hypothetical protein	NA	A4JWP0	Burkholderia_virus	98.4	7.2e-27
WP_062910483.1|2764998_2765535_+	hypothetical protein	NA	A4JWP1	Burkholderia_virus	96.1	5.3e-91
WP_062911413.1|2765598_2765823_+	hypothetical protein	NA	A4JWP2	Burkholderia_virus	81.2	1.4e-24
WP_021158467.1|2765889_2766237_+	phage protein	NA	A4JWP3	Burkholderia_virus	89.6	5.2e-47
WP_062911414.1|2766239_2766851_+	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	97.0	2.6e-110
WP_062910484.1|2766847_2767447_+	hypothetical protein	NA	A4JWP5	Burkholderia_virus	86.8	4.0e-87
WP_015985069.1|2767443_2767782_+	hypothetical protein	NA	A4JWP6	Burkholderia_virus	100.0	6.2e-53
WP_062910485.1|2767778_2768111_+	hypothetical protein	NA	Q6QIC3	Burkholderia_phage	99.1	1.6e-58
WP_059598248.1|2768112_2768658_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	99.4	1.5e-88
WP_062910486.1|2768654_2770157_+	hypothetical protein	NA	Q6QIC1	Burkholderia_phage	98.8	1.3e-291
WP_062910487.1|2770153_2771629_+	DUF935 domain-containing protein	NA	Q6QIC0	Burkholderia_phage	98.4	4.0e-282
WP_062910488.1|2771621_2772458_+|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	97.8	1.1e-162
WP_062910489.1|2772454_2772982_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	98.3	2.6e-90
WP_062910490.1|2773196_2774315_+	hypothetical protein	NA	Q6QIB7	Burkholderia_phage	98.7	1.4e-210
WP_006485371.1|2774360_2775284_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	95.1	5.6e-165
WP_062910491.1|2775358_2775691_+	DUF2190 family protein	NA	Q6QIB4	Burkholderia_phage	99.1	1.1e-51
WP_006485358.1|2775692_2776145_+	DUF1320 domain-containing protein	NA	Q6QIB3	Burkholderia_phage	100.0	5.5e-81
WP_062910492.1|2776144_2776609_+	hypothetical protein	NA	A4JWK3	Burkholderia_virus	99.4	6.7e-82
WP_062910493.1|2776605_2776851_+	hypothetical protein	NA	A4JWK4	Burkholderia_virus	97.5	1.3e-36
WP_062910494.1|2776854_2778288_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	97.5	7.2e-268
WP_021158451.1|2778290_2778815_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	97.1	6.1e-92
WP_062911415.1|2778939_2779269_+|tail	phage tail assembly protein	tail	A4JWK7	Burkholderia_virus	98.2	8.1e-50
WP_062910495.1|2779195_2779399_+	hypothetical protein	NA	Q6QIA7	Burkholderia_phage	95.5	6.3e-29
WP_062911416.1|2779401_2779644_-	hypothetical protein	NA	A4JWK9	Burkholderia_virus	97.5	1.2e-34
WP_062910496.1|2779673_2782280_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	97.9	0.0e+00
2781056:2781074	attR	GATCCAGCGCACCGCGCAG	NA	NA	NA	NA
WP_062910497.1|2782288_2783179_+|tail	phage tail protein	tail	Q6QIA4	Burkholderia_phage	98.8	3.7e-105
WP_080466867.1|2783178_2783388_+	hypothetical protein	NA	Q6QIA3	Burkholderia_phage	95.7	2.8e-32
WP_062910499.1|2783375_2784581_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	97.0	1.6e-212
WP_062910500.1|2784577_2785180_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	92.5	8.3e-101
WP_062910501.1|2785233_2785587_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	99.1	1.5e-62
WP_062910502.1|2785583_2786735_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	92.2	6.9e-197
WP_062910503.1|2786727_2787309_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	92.2	2.7e-96
WP_062910504.1|2787308_2789756_+	hypothetical protein	NA	Q6QI97	Burkholderia_phage	42.8	1.3e-96
WP_080466868.1|2789811_2790507_+	acyltransferase	NA	NA	NA	NA	NA
WP_034202382.1|2790818_2791310_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_058903085.1|2791418_2792567_-	epoxide hydrolase	NA	NA	NA	NA	NA
WP_058903084.1|2792645_2793593_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_034203351.1|2793725_2794526_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062885506.1|2794507_2795872_-	MFS transporter	NA	NA	NA	NA	NA
WP_034202385.1|2795966_2797319_-	MFS transporter	NA	NA	NA	NA	NA
WP_006482658.1|2797505_2798465_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_058903081.1|2798642_2800298_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006479115.1|2801093_2801576_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_006481932.1|2801860_2802517_+	LysE family translocator	NA	NA	NA	NA	NA
WP_006481934.1|2802633_2803809_+	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_048985523.1|2803870_2804302_+	DedA family protein	NA	NA	NA	NA	NA
WP_058903079.1|2804441_2806427_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.5	2.4e-11
WP_034202390.1|2806462_2808115_-	acyl-CoA synthetase	NA	A0A2H4PQM9	Staphylococcus_phage	26.4	5.4e-33
WP_085964389.1|2808220_2809027_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_034202391.1|2809212_2812380_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	2.7e-57
WP_058903078.1|2812416_2813646_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_058903594.1|2813651_2815157_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_006485649.1|2815190_2815886_+	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.1	7.0e-35
WP_034202394.1|2815882_2817367_+	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_006485658.1|2817466_2818054_+	LysE family translocator	NA	NA	NA	NA	NA
WP_006485655.1|2818066_2818912_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_006485654.1|2819144_2819702_-	DNA-directed RNA polymerase subunit beta	NA	NA	NA	NA	NA
WP_006485650.1|2820065_2820620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048985533.1|2820742_2821297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058903075.1|2821700_2822495_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062910753.1|2822533_2823484_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	3343295	3368710	7459003	transposase,integrase	uncultured_virus(28.57%)	22	3339753:3339767	3371034:3371048
3339753:3339767	attL	ACCGCTGTCGAGCGC	NA	NA	NA	NA
WP_105819029.1|3343295_3344533_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	94.7	6.4e-156
WP_012213993.1|3344881_3345670_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.1	8.8e-34
WP_011881665.1|3347557_3348316_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	49.0	1.3e-61
WP_012217371.1|3348816_3349182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012217373.1|3349504_3350764_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.9e-44
WP_012217374.1|3350729_3351683_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_011881662.1|3351761_3352619_+	phage Gp37/Gp68 family protein	NA	M4R142	Tetraselmis_viridis_virus	46.9	4.9e-62
WP_011881661.1|3352649_3353921_+	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_062910753.1|3354229_3355180_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_154817385.1|3355252_3355708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011881659.1|3356428_3357082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131754048.1|3357934_3358192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011881658.1|3358854_3359112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011881657.1|3359256_3361965_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_011881656.1|3361972_3362980_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011881655.1|3362982_3364299_+	TniQ family protein	NA	NA	NA	NA	NA
WP_044582768.1|3364408_3364669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011881653.1|3364802_3366443_-|transposase	IS66-like element ISBmu30 family transposase	transposase	A0A218MNE7	uncultured_virus	32.7	3.9e-60
WP_011881652.1|3366533_3366947_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	40.4	3.5e-18
WP_080466871.1|3367085_3367856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080466977.1|3367804_3368038_+	ferredoxin	NA	NA	NA	NA	NA
WP_012467846.1|3368125_3368710_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
3371034:3371048	attR	ACCGCTGTCGAGCGC	NA	NA	NA	NA
>prophage 3
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	3384087	3439645	7459003	transposase	Stx2-converting_phage(21.43%)	44	NA	NA
WP_105782820.1|3384087_3385322_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	1.1e-102
WP_011881636.1|3386569_3387838_+	porin	NA	NA	NA	NA	NA
WP_011881635.1|3387887_3389084_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_062910543.1|3389725_3391036_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_131754044.1|3391672_3391882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011881633.1|3392011_3392272_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011881632.1|3392564_3393644_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_012467839.1|3393555_3393909_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_011881631.1|3394076_3394865_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.3	4.7e-35
WP_012217387.1|3396977_3398498_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.8	1.1e-11
WP_011881629.1|3398887_3400222_+	MFS transporter	NA	NA	NA	NA	NA
WP_011881628.1|3400270_3401263_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011881627.1|3401296_3402784_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011881626.1|3402810_3404625_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_011881625.1|3405057_3406041_+	nitrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011881624.1|3406070_3406883_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011881623.1|3406888_3407671_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.3	3.8e-13
WP_011881622.1|3407744_3408818_+	porin	NA	NA	NA	NA	NA
WP_105782820.1|3409396_3410631_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	65.5	1.1e-102
WP_043291487.1|3411030_3411462_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	29.1	6.5e-07
WP_011880276.1|3411458_3411806_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.5	7.0e-36
WP_011880277.1|3411857_3413402_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	47.3	8.6e-134
WP_011880278.1|3413409_3414006_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_080466875.1|3414238_3414415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012217373.1|3415862_3417122_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.9e-44
WP_011875599.1|3417960_3419517_+|transposase	IS21-like element IS408 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.1	1.4e-160
WP_006397350.1|3419533_3420283_+	Insertion sequence IS408 ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.7	4.8e-82
WP_062911421.1|3420636_3421821_-	porin	NA	NA	NA	NA	NA
WP_062911422.1|3422250_3423054_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_080466876.1|3423217_3423670_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_012217391.1|3424121_3424976_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	66.7	1.9e-45
WP_134163192.1|3425064_3425523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044582753.1|3425942_3426884_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011881614.1|3426960_3427371_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011881613.1|3427638_3427866_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_011881612.1|3427870_3429067_+	MFS transporter	NA	NA	NA	NA	NA
WP_011881611.1|3429175_3430069_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011881610.1|3430370_3431501_+	MFS transporter	NA	NA	NA	NA	NA
WP_012217396.1|3431526_3432576_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.2	1.1e-71
WP_011881608.1|3432625_3433615_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011881605.1|3434910_3435387_-	hemerythrin	NA	NA	NA	NA	NA
WP_011881604.1|3435687_3437019_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_011881603.1|3437035_3438211_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011881602.1|3438385_3439645_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.0	3.9e-44
>prophage 4
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	3453237	3511997	7459003	transposase,integrase,tRNA	uncultured_Caudovirales_phage(15.79%)	47	3442764:3442780	3485118:3485134
3442764:3442780	attL	GGCCGCCGCGCCTTGCA	NA	NA	NA	NA
WP_062910547.1|3453237_3454389_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_062911423.1|3454388_3456068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080466877.1|3456064_3457960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012213993.1|3458326_3459115_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.1	8.8e-34
WP_062910549.1|3462440_3463805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080466978.1|3463807_3464770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105819029.1|3464689_3465926_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	94.7	6.4e-156
WP_154817386.1|3465918_3469230_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_105819029.1|3469301_3470539_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	94.7	6.4e-156
WP_105848424.1|3470816_3471978_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	9.5e-85
WP_080001177.1|3472051_3473320_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	43.9	3.5e-40
WP_062910552.1|3473593_3474298_+	hypothetical protein	NA	Q7M296	Enterobacteria_phage	30.5	3.9e-17
WP_062910553.1|3474475_3476587_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_062910554.1|3476583_3478425_+	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_080466879.1|3478509_3478977_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	48.1	8.1e-11
WP_062910555.1|3479757_3480798_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.7	3.4e-94
WP_060092086.1|3481038_3482241_+	DUF4102 domain-containing protein	NA	A0A221SAN4	Ralstonia_phage	28.6	6.2e-31
WP_060092088.1|3482237_3483308_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	42.1	5.6e-23
WP_062911424.1|3483316_3484039_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	71.2	2.9e-92
WP_060092090.1|3484031_3484454_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	3.8e-52
WP_060092092.1|3484464_3485544_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
3485118:3485134	attR	TGCAAGGCGCGGCGGCC	NA	NA	NA	NA
WP_060092094.1|3485551_3486046_-	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	44.8	2.0e-28
WP_060092096.1|3486052_3486394_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060092098.1|3486552_3486861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060092100.1|3487493_3488324_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.5	8.1e-46
WP_060092101.1|3488402_3490454_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_060092103.1|3490519_3490732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060092105.1|3491486_3491801_+	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_080466979.1|3491871_3492165_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_154817453.1|3492470_3492836_+	DUF2958 domain-containing protein	NA	A0A1W6DX76	Sphingobium_phage	47.8	5.7e-20
WP_060092107.1|3493180_3493951_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_060092109.1|3494061_3494346_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060092111.1|3494372_3495218_+	RepA replication protein	NA	NA	NA	NA	NA
WP_080466881.1|3495232_3495487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060092113.1|3495483_3496122_+	AAA family ATPase	NA	B0ZSI1	Halomonas_phage	39.6	4.3e-31
WP_060092170.1|3496118_3496403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060092114.1|3496399_3496945_+	DUF2840 domain-containing protein	NA	NA	NA	NA	NA
WP_060092115.1|3496941_3497541_+	peptidase	NA	NA	NA	NA	NA
WP_024100077.1|3497989_3499993_+	relaxase/mobilization nuclease and DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_080381190.1|3500201_3501224_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_080381189.1|3501445_3503707_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_057055115.1|3503773_3505450_+	FAD-binding protein	NA	A0A1V0SI18	Klosneuvirus	32.1	1.9e-57
WP_060092117.1|3505609_3507250_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	3.6e-29
WP_080466883.1|3507246_3508986_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024100072.1|3509667_3510612_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024100071.1|3510608_3510887_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_024100070.1|3511016_3511997_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	58.0	4.1e-97
>prophage 5
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	3692995	3814756	7459003	transposase,integrase,tRNA,protease	Stx2-converting_phage(23.08%)	115	3750343:3750362	3780947:3780966
WP_006483311.1|3692995_3694336_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_006478678.1|3694391_3695021_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_006483316.1|3695062_3696208_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_006493685.1|3696454_3697792_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_006399927.1|3697933_3698173_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_011694299.1|3698230_3699418_+	GTPase HflX	NA	NA	NA	NA	NA
WP_006493684.1|3699465_3700812_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_006485903.1|3700827_3701727_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_006478685.1|3701763_3701955_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_006496416.1|3702068_3703217_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_006496417.1|3703330_3704677_+	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	36.1	3.4e-70
WP_006485899.1|3704684_3705281_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_006485906.1|3705555_3707472_+	potassium transporter Kup	NA	A7J6G4	Paramecium_bursaria_Chlorella_virus	32.8	3.7e-78
WP_062910588.1|3707582_3709907_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_006485898.1|3710071_3710824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006478692.1|3710900_3711116_+	YdcH family protein	NA	NA	NA	NA	NA
WP_006496420.1|3711171_3713421_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	29.4	2.8e-77
WP_006484415.1|3713543_3714368_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_034178468.1|3714409_3715621_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_012492651.1|3715627_3716467_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_062910589.1|3716827_3718693_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_062910590.1|3718792_3719974_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_006491801.1|3720095_3720836_+	3-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_006485265.1|3720955_3721522_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_034201652.1|3721934_3722069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062910591.1|3722184_3722718_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_062884493.1|3722802_3723057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048986472.1|3723201_3723462_-	transporter suffix domain-containing protein	NA	NA	NA	NA	NA
WP_006497181.1|3724026_3725388_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_006485268.1|3725391_3726318_+	sugar kinase	NA	NA	NA	NA	NA
WP_006485258.1|3726436_3726976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006485263.1|3727089_3728271_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_012492650.1|3728358_3729204_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_006485262.1|3729370_3730309_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034201719.1|3730433_3731450_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_034178470.1|3731608_3732160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062910592.1|3732378_3732852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006485250.1|3732889_3733693_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_006497185.1|3733689_3734391_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	24.7	4.0e-06
WP_062910593.1|3734543_3736868_+	AsmA family protein	NA	NA	NA	NA	NA
WP_034201722.1|3736959_3737412_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_062910594.1|3737580_3739173_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	26.7	3.4e-53
WP_080466980.1|3739491_3740508_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_154817388.1|3740719_3741217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080466884.1|3741419_3741812_+	recombinase family protein	NA	K7PGS7	Enterobacteria_phage	49.3	7.7e-07
WP_043291487.1|3741708_3742140_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	29.1	6.5e-07
WP_011880276.1|3742136_3742484_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.5	7.0e-36
WP_011880277.1|3742535_3744080_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	47.3	8.6e-134
WP_080466981.1|3744544_3745093_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	43.0	4.1e-14
WP_154817390.1|3745237_3745462_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_154817391.1|3745551_3745767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062910598.1|3746401_3747268_-	AAA family ATPase	NA	U5N3V8	Enterobacteria_phage	44.1	3.7e-49
WP_062910599.1|3747264_3748521_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	33.0	8.5e-47
WP_154817392.1|3748745_3749021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012213993.1|3749328_3750117_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.1	8.8e-34
3750343:3750362	attL	GCGCGCCGCGCAGGTTGACG	NA	NA	NA	NA
WP_154817393.1|3751924_3752209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062910602.1|3752224_3752836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105848424.1|3752766_3753929_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	9.5e-85
WP_062910603.1|3754059_3754650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006397350.1|3754705_3755455_-	Insertion sequence IS408 ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.7	4.8e-82
WP_011875599.1|3755471_3757028_-|transposase	IS21-like element IS408 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.1	1.4e-160
WP_062910604.1|3757310_3758132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011880278.1|3758135_3758732_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011880277.1|3758739_3760284_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	47.3	8.6e-134
WP_011880276.1|3760335_3760683_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.5	7.0e-36
WP_043291487.1|3760679_3761111_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	29.1	6.5e-07
WP_062910605.1|3761332_3762277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062910606.1|3762354_3762759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062910607.1|3762755_3763406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154817394.1|3763513_3764770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062910609.1|3764970_3766002_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	41.2	7.7e-54
WP_062910610.1|3766252_3767221_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	39.6	4.1e-49
WP_058901506.1|3767621_3768371_+	hypothetical protein	NA	E3SJ86	Synechococcus_phage	32.0	9.6e-22
WP_058901505.1|3768371_3769370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058901504.1|3769371_3770250_+	4Fe-4S cluster-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059723807.1|3770246_3771314_+	asparagine synthase	NA	NA	NA	NA	NA
WP_062910611.1|3771321_3772530_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_034201728.1|3772486_3773176_-	cephalosporin hydroxylase	NA	NA	NA	NA	NA
WP_062910612.1|3773201_3774167_+	phosphotransferase	NA	NA	NA	NA	NA
WP_006485231.1|3774163_3774760_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_062911426.1|3774776_3775289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006493163.1|3775579_3776068_+	DUF2501 domain-containing protein	NA	NA	NA	NA	NA
WP_006488152.1|3776219_3776585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006488133.1|3776853_3778290_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_060210674.1|3778413_3779604_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_006488120.1|3779669_3780308_+	OmpW family protein	NA	NA	NA	NA	NA
WP_154817395.1|3780368_3782813_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
3780947:3780966	attR	GCGCGCCGCGCAGGTTGACG	NA	NA	NA	NA
WP_062910614.1|3782841_3783519_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_006488135.1|3783633_3784314_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_006493160.1|3784906_3785110_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_006497200.1|3785529_3786624_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006488129.1|3786710_3787871_+	polyamine ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	33.2	6.0e-23
WP_006488137.1|3787867_3788794_+	ABC transporter permease subunit	NA	Q6GZ02	Mycoplasma_phage	24.3	4.4e-08
WP_006488141.1|3788790_3789612_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_059723798.1|3789704_3790511_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_062910615.1|3790529_3792200_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_062910616.1|3792228_3793113_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_006497206.1|3793366_3794749_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_006488126.1|3794979_3795540_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_006488139.1|3795548_3795773_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062910617.1|3795747_3796446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006497208.1|3796494_3797523_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062910618.1|3797647_3799213_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_006489712.1|3799215_3802362_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_062910619.1|3802358_3803468_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_006491184.1|3803657_3804278_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012492640.1|3804314_3806084_-	ClcB-like voltage-gated chloride channel protein	NA	NA	NA	NA	NA
WP_034201738.1|3806151_3807228_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_006491186.1|3807340_3808234_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006491175.1|3808395_3809160_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_006491178.1|3809188_3810181_+	sugar kinase	NA	NA	NA	NA	NA
WP_006493476.1|3810296_3811577_+	MFS transporter	NA	NA	NA	NA	NA
WP_062911427.1|3811581_3812547_+	D-glycerate dehydrogenase	NA	M1I1Q8	Acanthocystis_turfacea_Chlorella_virus	27.0	1.4e-17
WP_006491185.1|3812868_3813912_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	24.7	4.8e-11
WP_060264951.1|3813967_3814756_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	4012663	4063612	7459003	head,tRNA,tail,terminase,portal,plate,capsid	Burkholderia_virus(24.0%)	68	NA	NA
WP_034201819.1|4012663_4013794_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_060211538.1|4013858_4014812_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062910669.1|4014974_4016396_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_006495224.1|4016431_4017718_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	43.4	1.5e-86
WP_062910670.1|4017795_4018848_-	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_006484216.1|4018995_4019433_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_059723600.1|4019620_4020109_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_034201824.1|4020452_4021076_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.0	2.4e-18
WP_048986581.1|4021236_4021455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006495229.1|4021719_4022691_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.2	2.3e-12
WP_006484195.1|4022769_4023243_-	VOC family protein	NA	A0A2K9L1J4	Tupanvirus	37.6	2.4e-18
WP_062910671.1|4023403_4023637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006484170.1|4023640_4023889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006484174.1|4023929_4024238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043204865.1|4024421_4025165_+	DUF695 domain-containing protein	NA	NA	NA	NA	NA
WP_080466888.1|4025559_4025910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062910672.1|4025938_4026334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910673.1|4026635_4027100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006495234.1|4027183_4027699_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_154817398.1|4028119_4028494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124492672.1|4028810_4029164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910676.1|4029182_4029803_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_154817399.1|4029799_4030285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910678.1|4030340_4030547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910679.1|4030550_4031183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154817400.1|4031260_4031965_-	lysozyme	NA	A0A059VA40	Pseudomonas_phage	42.2	1.5e-29
WP_062910681.1|4032288_4034220_-	hypothetical protein	NA	Q6UKA1	Burkholderia_virus	26.8	1.4e-27
WP_080466889.1|4034226_4034772_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_154817401.1|4034782_4035706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080466890.1|4035715_4036357_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_062910683.1|4036357_4037518_-|plate	baseplate J/gp47 family protein	plate	A0A2P9JZK6	Alteromonadaceae_phage	32.4	2.4e-35
WP_062910684.1|4037517_4037958_-	hypothetical protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	40.0	3.0e-23
WP_062910685.1|4038017_4038641_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_062910686.1|4038637_4039792_-	hypothetical protein	NA	U5P0H6	Shigella_phage	32.1	7.5e-34
WP_080466891.1|4039788_4041225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910688.1|4041230_4043144_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	51.3	2.9e-22
WP_154817402.1|4043279_4043624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910690.1|4043632_4044004_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_062910691.1|4044065_4045550_-|tail	phage tail protein	tail	Q8W623	Enterobacteria_phage	42.0	3.6e-89
WP_062910692.1|4045546_4045747_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_062910693.1|4045756_4046320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910694.1|4046316_4046640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910695.1|4046641_4046908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910696.1|4046907_4047978_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	32.9	4.5e-49
WP_062910697.1|4048059_4048737_-	DUF3859 domain-containing protein	NA	NA	NA	NA	NA
WP_062910698.1|4048773_4049388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910699.1|4049408_4050299_-	S49 family peptidase	NA	Q6UYI0	Burkholderia_phage	41.7	2.5e-45
WP_062910700.1|4050298_4051933_-|portal	phage portal protein	portal	A0A286MNI7	Klebsiella_phage	33.9	1.6e-74
WP_017918055.1|4051932_4052181_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_080466892.1|4052191_4054393_-|terminase	terminase	terminase	V5YTA4	Pseudomonas_phage	32.8	9.2e-89
WP_062910701.1|4054325_4055003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910702.1|4055118_4055739_-	hypothetical protein	NA	A0A291AUT0	Sinorhizobium_phage	36.1	1.1e-07
WP_062910703.1|4055947_4056262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910704.1|4056261_4056690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910705.1|4056686_4056947_-	hypothetical protein	NA	Q6V7S5	Burkholderia_virus	51.2	3.2e-17
WP_062910706.1|4056946_4057186_-	hypothetical protein	NA	A4JX60	Burkholderia_virus	49.4	9.5e-16
WP_062910707.1|4057182_4057671_-	hypothetical protein	NA	K7ZPX8	Xanthomonas_citri_phage	34.0	1.4e-13
WP_080466893.1|4057667_4058000_-	hypothetical protein	NA	Q6JIF6	Burkholderia_virus	81.2	4.5e-40
WP_080466894.1|4058002_4058431_-	DUF1364 family protein	NA	Q3HR02	Burkholderia_phage	70.1	3.9e-52
WP_062910709.1|4058427_4059012_-	helix-turn-helix transcriptional regulator	NA	Q3HR01	Burkholderia_phage	72.8	5.8e-75
WP_063822409.1|4059011_4059635_-	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	49.3	8.2e-43
WP_062910711.1|4059804_4061070_-	replication protein	NA	A0A1W6JNY0	Morganella_phage	31.0	2.0e-11
WP_154817403.1|4061071_4061371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910713.1|4061466_4061784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154817404.1|4061951_4062248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910715.1|4062249_4062624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910716.1|4062625_4062877_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080466896.1|4062949_4063612_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	33.3	4.2e-21
>prophage 7
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	4383647	4413108	7459003	tail,transposase,plate	Pseudomonas_phage(18.18%)	27	NA	NA
WP_006492556.1|4383647_4384916_+|transposase	IS256-like element ISBcen18 family transposase	transposase	A0A218MNI5	uncultured_virus	42.8	3.8e-39
WP_146211671.1|4386212_4386572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080465509.1|4386603_4387095_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_080465510.1|4387132_4388932_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_060263189.1|4388924_4390268_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_034200755.1|4390279_4392391_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.1	2.0e-64
WP_062910791.1|4392530_4394408_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_043205777.1|4394409_4394982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012492498.1|4395006_4395384_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_062910792.1|4396174_4396375_-	hypothetical protein	NA	Q3HQV3	Burkholderia_phage	70.5	8.7e-23
WP_062910793.1|4396409_4397225_-	patatin-like phospholipase family protein	NA	A0A0H3TN97	Faustovirus	29.9	1.8e-10
WP_062910794.1|4397224_4397830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910795.1|4397840_4398170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154817407.1|4398711_4399482_-	lysozyme	NA	A0A059VA40	Pseudomonas_phage	43.9	3.7e-29
WP_154817408.1|4399805_4401737_-	hypothetical protein	NA	Q6UKA1	Burkholderia_virus	30.8	1.3e-33
WP_080466905.1|4401743_4402289_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_154817409.1|4402299_4403223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080466906.1|4403232_4403874_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_062910683.1|4403874_4405035_-|plate	baseplate J/gp47 family protein	plate	A0A2P9JZK6	Alteromonadaceae_phage	32.4	2.4e-35
WP_062910800.1|4405034_4405475_-	hypothetical protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	40.0	1.5e-22
WP_063822412.1|4405534_4406158_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_062910802.1|4406154_4407309_-	hypothetical protein	NA	U5P0H6	Shigella_phage	31.6	2.6e-34
WP_080466907.1|4407305_4408742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910804.1|4408747_4410697_-	hypothetical protein	NA	Q2NP98	Xanthomonas_phage	23.2	6.2e-12
WP_062910805.1|4410829_4411177_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_062910806.1|4411185_4411560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910807.1|4411623_4413108_-|tail	phage tail protein	tail	B5TK67	Pseudomonas_phage	42.0	2.1e-89
>prophage 8
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	4416972	4428635	7459003	head,portal,tail,terminase	Burkholderia_virus(33.33%)	16	NA	NA
WP_062910813.1|4416972_4417863_-	S49 family peptidase	NA	Q6UYI0	Burkholderia_phage	45.2	2.5e-45
WP_062910814.1|4417862_4419497_-|portal	phage portal protein	portal	A0A286MNI7	Klebsiella_phage	34.1	7.3e-75
WP_062910815.1|4419496_4419745_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_080466908.1|4419755_4421957_-|terminase	terminase	terminase	V5YTA4	Pseudomonas_phage	32.8	3.2e-89
WP_062910816.1|4421889_4422567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910817.1|4422683_4423304_-	hypothetical protein	NA	A0A291AUT0	Sinorhizobium_phage	36.1	1.1e-07
WP_154817410.1|4423500_4423764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910819.1|4423826_4424255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062910705.1|4424251_4424512_-	hypothetical protein	NA	Q6V7S5	Burkholderia_virus	51.2	3.2e-17
WP_062910706.1|4424511_4424751_-	hypothetical protein	NA	A4JX60	Burkholderia_virus	49.4	9.5e-16
WP_062910707.1|4424747_4425236_-	hypothetical protein	NA	K7ZPX8	Xanthomonas_citri_phage	34.0	1.4e-13
WP_080466909.1|4425232_4425565_-	hypothetical protein	NA	Q6JIF6	Burkholderia_virus	80.2	1.0e-39
WP_080466894.1|4425567_4425996_-	DUF1364 family protein	NA	Q3HR02	Burkholderia_phage	70.1	3.9e-52
WP_062910821.1|4425992_4426577_-	ArsR family transcriptional regulator	NA	Q3HR01	Burkholderia_phage	73.3	2.6e-75
WP_063822413.1|4426576_4427200_-	DUF1064 domain-containing protein	NA	A4JX56	Burkholderia_virus	47.8	1.1e-42
WP_062910823.1|4427369_4428635_-	replication protein	NA	A0A1W6JNY0	Morganella_phage	31.7	8.9e-12
>prophage 9
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	5041287	5047854	7459003		Enterobacteria_phage(66.67%)	7	NA	NA
WP_062911447.1|5041287_5042082_-	ABC transporter ATP-binding protein	NA	Q66093	Chlorella_virus	26.3	2.1e-06
WP_062910952.1|5042087_5042906_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_062910953.1|5042907_5044323_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.2	2.9e-59
WP_154817414.1|5044459_5045359_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.2	4.7e-23
WP_062910955.1|5045351_5045903_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.2	2.5e-51
WP_062910956.1|5045887_5046781_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.1	4.1e-96
WP_062910957.1|5046792_5047854_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.3	1.1e-87
>prophage 10
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	5173953	5183003	7459003		unidentified_phage(16.67%)	7	NA	NA
WP_006484964.1|5173953_5175504_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.3	9.5e-24
WP_006476832.1|5175539_5176082_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_006484932.1|5176078_5176765_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	26.4	7.2e-08
WP_006485002.1|5176808_5177624_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.2	1.8e-37
WP_062911000.1|5177734_5179657_-	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	37.0	3.1e-56
WP_006476837.1|5179660_5180797_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	26.9	5.0e-22
WP_006484920.1|5181050_5183003_-	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.3	2.5e-146
>prophage 11
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	5458645	5520861	7459003	transposase,plate,tRNA	Acidithiobacillus_phage(20.0%)	55	NA	NA
WP_006482047.1|5458645_5459944_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_006494405.1|5460014_5461097_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	46.6	6.7e-08
WP_006482071.1|5461104_5461947_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_006477066.1|5462014_5462326_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_006482052.1|5462350_5462947_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_062911035.1|5463149_5463941_+	dioxygenase	NA	NA	NA	NA	NA
WP_006482046.1|5464052_5465651_-	APC family permease	NA	NA	NA	NA	NA
WP_006477070.1|5466071_5466275_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	71.6	1.4e-20
WP_006494125.1|5466376_5467627_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_006482064.1|5467816_5468422_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_012492315.1|5468577_5469861_-	MFS transporter	NA	NA	NA	NA	NA
WP_006481919.1|5470080_5470701_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048991979.1|5470777_5471350_+	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_034201872.1|5471410_5472301_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006494412.1|5472390_5473524_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_034201067.1|5473661_5473994_-	YegP family protein	NA	NA	NA	NA	NA
WP_062911036.1|5474147_5474642_-	Water stress and hypersensitive response domain-containing protein	NA	NA	NA	NA	NA
WP_006481916.1|5475284_5477453_+	peptidase M1	NA	A0A0P0IY26	Acinetobacter_phage	26.7	2.2e-50
WP_006481915.1|5477575_5478496_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034201070.1|5478657_5479635_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_006481917.1|5479659_5479812_+	DUF1427 family protein	NA	NA	NA	NA	NA
WP_006481924.1|5479839_5480868_-	transporter	NA	NA	NA	NA	NA
WP_006494415.1|5481079_5482072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911037.1|5482193_5483039_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_062911038.1|5483340_5487285_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_006483243.1|5487281_5488271_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_006494417.1|5488275_5489226_+	OmpA family protein	NA	NA	NA	NA	NA
WP_006484398.1|5489319_5490441_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_062911039.1|5490485_5493155_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	32.2	1.2e-90
WP_006494420.1|5493196_5494297_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_048986026.1|5494260_5496096_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_006477092.1|5496172_5496658_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_006477093.1|5496720_5497224_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_062911040.1|5497294_5498785_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_006484395.1|5498800_5499316_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_043204524.1|5499362_5499989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034178609.1|5500363_5500975_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_006477098.1|5501080_5502427_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_006494424.1|5502423_5503206_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_062911459.1|5503321_5503657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048986020.1|5503738_5504056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006485337.1|5504337_5505138_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_006485326.1|5505247_5505451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911041.1|5506552_5507260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035973142.1|5507343_5508108_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	29.3	7.8e-11
WP_062911042.1|5508246_5509164_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006397350.1|5509784_5510534_-	Insertion sequence IS408 ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	60.7	4.8e-82
WP_011875599.1|5510550_5512107_-|transposase	IS21-like element IS408 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.1	1.4e-160
WP_062911043.1|5512408_5513197_+	hypothetical protein	NA	A0A097ZIH2	Ralstonia_phage	44.0	2.1e-35
WP_080466926.1|5513198_5513414_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_012213993.1|5513819_5514608_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.1	8.8e-34
WP_154817420.1|5517097_5517733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063822418.1|5517791_5518907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063822419.1|5518903_5519572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105848424.1|5519699_5520861_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	9.5e-85
>prophage 12
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	5695415	5807749	7459003	tail,transposase,holin,plate,integrase	Burkholderia_phage(62.86%)	102	5745103:5745133	5768001:5768031
WP_006477367.1|5695415_5695769_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_006484031.1|5695871_5697290_-	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.1	9.9e-44
WP_006484033.1|5697541_5698276_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_006491878.1|5698298_5699117_-	flagellar biosynthesis protein FlhG	NA	NA	NA	NA	NA
WP_062911064.1|5699109_5700909_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_006485892.1|5700905_5703008_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_006485884.1|5703004_5704204_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_006485888.1|5704633_5705131_-	VOC family protein	NA	NA	NA	NA	NA
WP_006497451.1|5705295_5706534_-	DUF3443 family protein	NA	NA	NA	NA	NA
WP_012492269.1|5706550_5707054_-	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_006497453.1|5707313_5708045_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_006485893.1|5708047_5708443_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	6.0e-07
WP_062911065.1|5708510_5709602_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_006497454.1|5709598_5710357_-	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_006493442.1|5710353_5711346_-	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_062911066.1|5711349_5713308_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.0	1.5e-10
WP_006486165.1|5713345_5713861_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_062911067.1|5713908_5716170_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_006482646.1|5716203_5716581_-	response regulator	NA	NA	NA	NA	NA
WP_006482647.1|5716605_5717625_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_006482649.1|5717638_5718499_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_006493184.1|5718679_5719234_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_006477348.1|5719326_5719680_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_062911068.1|5720311_5721376_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_006489320.1|5721479_5721776_-	H-NS histone family protein	NA	F8TUP5	EBPR_podovirus	41.1	1.9e-10
WP_006489324.1|5722075_5722819_+	aquaporin Z	NA	A0A1B1ISL4	uncultured_Mediterranean_phage	50.8	8.1e-05
WP_006496246.1|5722949_5723774_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_062911069.1|5723935_5724817_-	ATPase	NA	NA	NA	NA	NA
WP_006489711.1|5724958_5725561_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_062911070.1|5725659_5726895_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_062911071.1|5727124_5729248_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_006401410.1|5729414_5729627_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_034201118.1|5730157_5731312_+	flagellin	NA	NA	NA	NA	NA
WP_062911072.1|5731444_5732953_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_034201120.1|5732978_5733278_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_062911073.1|5733534_5735880_+	glycosyltransferase family 41 protein	NA	NA	NA	NA	NA
WP_034201122.1|5735908_5737054_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2D2W2B8	Stenotrophomonas_phage	31.1	2.3e-11
WP_034201123.1|5737055_5737754_+	WbqC family protein	NA	NA	NA	NA	NA
WP_062911074.1|5737750_5738713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034201125.1|5738768_5740046_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_034201126.1|5740357_5741050_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_062911075.1|5743349_5744969_-	TIGR04222 domain-containing membrane protein	NA	NA	NA	NA	NA
5745103:5745133	attL	GGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
WP_006484103.1|5745532_5745739_+|tail	tail protein	tail	E5E3W5	Burkholderia_phage	64.7	5.1e-18
WP_006484093.1|5745755_5746100_+	membrane protein	NA	A4JWU2	Burkholderia_virus	77.9	5.7e-38
WP_006484102.1|5746101_5746368_+|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	65.5	6.2e-24
WP_063822421.1|5746364_5747222_+	DUF3380 domain-containing protein	NA	A4JWZ0	Burkholderia_virus	65.8	2.9e-91
WP_062911076.1|5747218_5747659_+	protein lysB	NA	K4NXJ2	Burkholderia_phage	44.4	3.2e-17
WP_058901998.1|5747775_5748225_+|tail	phage tail protein	tail	E5E3V9	Burkholderia_phage	54.2	1.5e-30
WP_006484112.1|5748733_5749420_+|plate	phage baseplate assembly protein V	plate	K4NXJ5	Burkholderia_phage	69.2	2.0e-82
WP_034201129.1|5749416_5749779_+|plate	baseplate assembly protein	plate	K4PAX6	Burkholderia_phage	69.2	3.4e-41
WP_006484106.1|5749775_5750690_+|plate	baseplate assembly protein	plate	E5FFH3	Burkholderia_phage	72.6	1.5e-117
WP_006484097.1|5750682_5751225_+|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	70.9	5.2e-70
WP_006496266.1|5751231_5753802_+	hypothetical protein	NA	E5E3V2	Burkholderia_phage	63.9	6.8e-269
WP_034201130.1|5753818_5754508_+|tail	caudovirales tail fiber assembly protein	tail	E5E3V1	Burkholderia_phage	81.2	1.3e-86
WP_062911077.1|5754562_5755735_+|tail	phage tail sheath protein	tail	A4JWS7	Burkholderia_virus	81.2	1.3e-185
WP_077175722.1|5755769_5756273_+|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	74.3	2.2e-70
WP_006484110.1|5756348_5756720_+|tail	phage tail assembly protein	tail	K4NXA3	Burkholderia_phage	65.5	2.2e-27
WP_006484104.1|5756728_5756842_+|tail	GpE family phage tail protein	tail	A0A089FGX3	Burkholderia_phage	85.7	1.1e-09
WP_062911078.1|5756857_5759428_+	hypothetical protein	NA	E5E3U6	Burkholderia_phage	46.8	2.6e-135
WP_034201134.1|5759450_5759882_+|tail	phage tail protein	tail	K4NXK5	Burkholderia_phage	67.4	8.2e-42
WP_006485451.1|5759878_5760949_+	phage late control D family protein	NA	K4PAY4	Burkholderia_phage	70.6	1.1e-135
WP_006485449.1|5761136_5761433_-	hypothetical protein	NA	E5E3U3	Burkholderia_phage	50.5	1.6e-12
WP_077175721.1|5761750_5762206_-	helix-turn-helix transcriptional regulator	NA	E5E3U2	Burkholderia_phage	62.9	3.2e-44
WP_006485450.1|5762332_5762548_+	hypothetical protein	NA	E5E3U1	Burkholderia_phage	80.0	4.4e-20
WP_006485448.1|5762729_5762978_+	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	91.5	3.5e-37
WP_034201136.1|5763105_5763363_+	hypothetical protein	NA	A4JWQ9	Burkholderia_virus	56.0	2.1e-13
WP_034201137.1|5763368_5766161_+	hypothetical protein	NA	E5E3N5	Burkholderia_phage	91.0	0.0e+00
WP_080466928.1|5766157_5766529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059721111.1|5766580_5766853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006484045.1|5766855_5767932_+|integrase	site-specific integrase	integrase	A0A1S5NNJ1	Burkholderia_phage	81.7	7.2e-164
WP_006496275.1|5768313_5769201_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
5768001:5768031	attR	GGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
WP_062911079.1|5769307_5771395_-	AAA family ATPase	NA	A7KV33	Bacillus_phage	35.7	4.0e-102
WP_058902305.1|5771705_5772413_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_006485682.1|5772686_5773739_+	oxidoreductase	NA	NA	NA	NA	NA
WP_006485676.1|5773942_5774305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059721115.1|5774772_5775891_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_006485673.1|5776017_5776398_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_006485677.1|5776456_5779384_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	51.0	6.2e-258
WP_062911464.1|5779535_5780678_+	alginate lyase family protein	NA	NA	NA	NA	NA
WP_006485681.1|5780708_5782097_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_058902008.1|5782163_5782565_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_034201144.1|5782564_5782801_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059721116.1|5783516_5785220_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_062884188.1|5785216_5786314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006493582.1|5786408_5787425_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062884189.1|5787630_5788179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006489874.1|5788355_5789882_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_034178592.1|5790203_5790632_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_062911080.1|5790742_5792365_-	MFS transporter	NA	NA	NA	NA	NA
WP_012492249.1|5792520_5793405_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_034201150.1|5793397_5794195_-	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_006489528.1|5794191_5795589_-	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_006496293.1|5795728_5797141_-	ethanolamine permease	NA	NA	NA	NA	NA
WP_034201881.1|5797330_5798794_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_062911465.1|5799070_5799952_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_062884192.1|5800110_5800488_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_062911081.1|5800498_5803009_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.5	1.8e-133
WP_006490878.1|5803090_5803522_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_006490876.1|5803590_5804163_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062884194.1|5804208_5805639_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_006488477.1|5805654_5806443_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012493617.1|5806729_5807749_-|transposase	IS110-like element ISBcen5 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	6769334	6825032	7459003	coat,transposase,integrase,protease	Bacillus_virus(20.0%)	55	6787015:6787031	6830907:6830923
WP_006484009.1|6769334_6769871_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_012492815.1|6770167_6771163_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_006476181.1|6771368_6772334_+|transposase	IS110-like element ISBcen8 family transposase	transposase	Q75QL1	Wolbachia_phage	34.2	1.3e-23
WP_006492931.1|6772350_6773160_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006497169.1|6773378_6774131_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_062911229.1|6774254_6777269_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_012492813.1|6777477_6778482_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_034201471.1|6778481_6780452_+	fused uroporphyrinogen-III synthase HemD/membrane protein HemX	NA	NA	NA	NA	NA
WP_062911230.1|6780454_6781642_+	heme biosynthesis protein HemY	NA	NA	NA	NA	NA
WP_062911231.1|6781739_6782966_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_006489657.1|6782962_6783376_-	helix-turn-helix domain-containing protein	NA	C8CHN0	Thermus_virus	51.8	9.0e-06
WP_006489648.1|6783632_6784937_-	MFS transporter	NA	NA	NA	NA	NA
WP_058901699.1|6785082_6785841_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062911232.1|6785928_6787368_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
6787015:6787031	attL	GTCGGCCGCGCCCGCGT	NA	NA	NA	NA
WP_006489643.1|6787703_6788231_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	52.0	6.5e-49
WP_062911233.1|6788285_6789137_-	GIY-YIG nuclease family protein	NA	W8W2G4	Invertebrate_iridovirus	45.8	1.1e-08
WP_062911234.1|6789186_6790221_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_048985781.1|6790372_6792619_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_006489664.1|6792690_6793869_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_062911235.1|6793978_6795697_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.5	2.3e-87
WP_006398637.1|6795780_6796119_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_006491862.1|6796264_6797341_-	porin	NA	NA	NA	NA	NA
WP_012492810.1|6797888_6798815_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006489651.1|6798949_6799447_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058901695.1|6799513_6800293_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.8	1.6e-16
WP_006489646.1|6800311_6801025_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_006489645.1|6801021_6801711_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_012492809.1|6801940_6802723_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012492808.1|6803089_6803794_+	pirin family protein	NA	NA	NA	NA	NA
WP_058901693.1|6803863_6804418_-	periplasmic heavy metal sensor	NA	NA	NA	NA	NA
WP_006493394.1|6804642_6805368_+	response regulator	NA	W8CYM9	Bacillus_phage	36.3	3.8e-31
WP_058901692.1|6805351_6806668_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_011545926.1|6806710_6806977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062884173.1|6807553_6808576_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_062911236.1|6808875_6810633_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006497149.1|6810655_6811993_+	nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	2.4e-31
WP_006497148.1|6812057_6812552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006497146.1|6812548_6813100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006487640.1|6813388_6813598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006497145.1|6813736_6815158_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_060267035.1|6815150_6815744_+	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	64.0	3.0e-26
WP_006497144.1|6815785_6817153_-	MFS transporter	NA	NA	NA	NA	NA
WP_062911237.1|6817338_6817719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043206388.1|6817836_6818241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006478153.1|6818439_6818766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006497142.1|6818909_6819410_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_059721374.1|6819431_6820055_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006487647.1|6820170_6820911_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_006487649.1|6820964_6821297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153260051.1|6821630_6821774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006497139.1|6821799_6822354_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_006487637.1|6822366_6822675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006487655.1|6822677_6822974_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_062911238.1|6823080_6823797_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_062911239.1|6824021_6825032_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	51.9	4.0e-71
6830907:6830923	attR	GTCGGCCGCGCCCGCGT	NA	NA	NA	NA
>prophage 14
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	6831558	6868036	7459003	head,tail,terminase,portal,holin,capsid	Burkholderia_phage(97.14%)	43	NA	NA
WP_062911247.1|6831558_6831765_-	hypothetical protein	NA	C7BGF3	Burkholderia_phage	85.3	6.9e-23
WP_062911248.1|6831894_6832119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911249.1|6832654_6833119_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_154817426.1|6833333_6833597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050012102.1|6833655_6834207_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	63.4	1.7e-47
WP_062911251.1|6834233_6835601_+	replicative DNA helicase	NA	C7BGG1	Burkholderia_phage	60.2	1.4e-151
WP_063822423.1|6835639_6836611_+	helix-turn-helix domain-containing protein	NA	C7BGG2	Burkholderia_phage	43.6	2.6e-67
WP_062911253.1|6836623_6837022_+	hypothetical protein	NA	C7BGG3	Burkholderia_phage	49.2	4.6e-31
WP_154817427.1|6837181_6837415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154817428.1|6837425_6837659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080466948.1|6837854_6838223_+	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	91.8	5.1e-61
WP_062911255.1|6838418_6838922_+	hypothetical protein	NA	C7BGG6	Burkholderia_phage	90.4	1.4e-85
WP_062911256.1|6838966_6840631_+|terminase	terminase large subunit	terminase	C7BGG7	Burkholderia_phage	85.8	2.5e-288
WP_062911257.1|6840627_6841917_+|portal	phage portal protein	portal	C7BGG8	Burkholderia_phage	84.6	3.7e-215
WP_080466949.1|6841945_6842698_+	peptidase S14	NA	C7BGG9	Burkholderia_phage	93.6	2.2e-111
WP_062911259.1|6842766_6844032_+|capsid	phage major capsid protein	capsid	C7BGH0	Burkholderia_phage	97.1	2.1e-231
WP_062911260.1|6844082_6844667_+	hypothetical protein	NA	C7BGH1	Burkholderia_phage	92.3	7.1e-97
WP_062911261.1|6844677_6845004_+|head	phage head closure protein	head	C7BGH2	Burkholderia_phage	97.2	1.4e-54
WP_062911262.1|6844996_6845419_+	HK97 gp10 family phage protein	NA	C7BGH3	Burkholderia_phage	95.0	2.3e-65
WP_062911263.1|6845415_6845760_+	DUF3168 domain-containing protein	NA	Q3HQT5	Burkholderia_phage	73.7	3.0e-39
WP_023477143.1|6845820_6846285_+	hypothetical protein	NA	Q4FAS7	Burkholderia_phage	90.9	1.1e-71
WP_062911264.1|6846313_6846781_+|tail	phage tail protein	tail	C7BGC7	Burkholderia_phage	89.7	2.5e-73
WP_060127033.1|6846777_6847056_+	DUF4035 domain-containing protein	NA	Q4FAS6	Burkholderia_phage	95.7	4.0e-42
WP_062911265.1|6847069_6851170_+|tail	phage tail tape measure protein	tail	C7BGC8	Burkholderia_phage	96.9	0.0e+00
WP_062911266.1|6851169_6851508_+|tail	phage tail protein	tail	C7BGC9	Burkholderia_phage	92.9	7.0e-57
WP_154817429.1|6851516_6852731_+	hypothetical protein	NA	Q3HQU1	Burkholderia_phage	39.5	8.2e-55
WP_062911268.1|6852733_6853417_+|tail	phage minor tail protein L	tail	C7BGD1	Burkholderia_phage	93.8	1.6e-124
WP_062911269.1|6853466_6854219_+	C40 family peptidase	NA	C7BGD2	Burkholderia_phage	95.6	1.6e-146
WP_062911270.1|6854215_6854779_+|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	96.8	2.0e-93
WP_062911271.1|6854775_6858681_+	DUF1983 domain-containing protein	NA	C7BGD4	Burkholderia_phage	96.4	0.0e+00
WP_080466950.1|6858674_6858989_+	hypothetical protein	NA	C7BGD5	Burkholderia_phage	92.2	5.5e-48
WP_059499153.1|6858988_6859705_+	hypothetical protein	NA	C7BGD6	Burkholderia_phage	91.6	2.8e-127
WP_027808735.1|6859760_6860045_+|holin	holin	holin	C7BGD7	Burkholderia_phage	97.9	1.0e-40
WP_062911272.1|6860047_6860497_+	peptidase M15	NA	C7BGD8	Burkholderia_phage	95.3	1.4e-73
WP_062911273.1|6860493_6860976_+	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	75.0	2.6e-57
WP_059499155.1|6861114_6861906_+	DNA adenine methylase	NA	C7BGE1	Burkholderia_phage	98.9	1.0e-154
WP_062911274.1|6862008_6862905_+	hypothetical protein	NA	C7BGE2	Burkholderia_phage	91.9	1.2e-151
WP_062911275.1|6863006_6863432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911276.1|6863490_6863982_-	hypothetical protein	NA	C7BGE3	Burkholderia_phage	75.9	1.1e-69
WP_062911277.1|6864034_6864739_+	DUF159 family protein	NA	A0A1S5NTJ1	Burkholderia_phage	82.3	9.1e-115
WP_006478164.1|6865034_6865217_-	rubredoxin	NA	NA	NA	NA	NA
WP_012328968.1|6865415_6865820_+	DUF4399 domain-containing protein	NA	NA	NA	NA	NA
WP_006487664.1|6866086_6868036_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.1	6.3e-49
>prophage 15
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	6963276	6975155	7459003	transposase	uncultured_Caudovirales_phage(37.5%)	13	NA	NA
WP_154817430.1|6963276_6964725_+	hypothetical protein	NA	A0A2H4J165	uncultured_Caudovirales_phage	29.9	3.4e-39
WP_124492126.1|6964696_6966613_+	hypothetical protein	NA	A0A2H4J9J6	uncultured_Caudovirales_phage	23.3	1.9e-21
WP_011880278.1|6967013_6967610_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_011880277.1|6967617_6969162_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	47.3	8.6e-134
WP_011880276.1|6969213_6969561_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.5	7.0e-36
WP_043291487.1|6969557_6969989_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	29.1	6.5e-07
WP_154817431.1|6970091_6970940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105848424.1|6970943_6972106_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.2	9.5e-85
WP_154817432.1|6972193_6972970_+	hypothetical protein	NA	A0A2H4J185	uncultured_Caudovirales_phage	32.2	4.0e-23
WP_080466951.1|6972966_6973335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060343153.1|6973436_6973679_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060343152.1|6974039_6974285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080466952.1|6974348_6975155_+	hypothetical protein	NA	A0A291L9W7	Bordetella_phage	39.6	2.2e-40
>prophage 16
NZ_CP015036	Burkholderia cenocepacia strain 895 chromosome 1, complete sequence	7459003	7214576	7224156	7459003	integrase	Burkholderia_virus(50.0%)	13	7207564:7207578	7217915:7217929
7207564:7207578	attL	TCGCGCGCGCGGCGG	NA	NA	NA	NA
WP_080466958.1|7214576_7215638_-|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	42.1	6.0e-78
WP_062911317.1|7215935_7216223_-	hypothetical protein	NA	Q6J1P7	Burkholderia_virus	48.3	9.0e-13
WP_062911318.1|7216215_7216395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911319.1|7216397_7218560_-	DNA polymerase I	NA	Q6J1P5	Burkholderia_virus	75.3	0.0e+00
7217915:7217929	attR	CCGCCGCGCGCGCGA	NA	NA	NA	NA
WP_062911320.1|7218566_7218833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080466959.1|7218829_7219552_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_154817436.1|7219548_7219902_-	hypothetical protein	NA	A0A172JFU7	Citrobacter_phage	37.4	4.2e-12
WP_154817437.1|7220085_7220259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911324.1|7220270_7220861_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	49.2	8.0e-40
WP_062911325.1|7220866_7221046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154817456.1|7221042_7222395_-	DUF2800 domain-containing protein	NA	Q6J1N8	Burkholderia_virus	66.8	1.3e-165
WP_062911327.1|7222391_7222952_-	hypothetical protein	NA	Q6J1N6	Burkholderia_virus	51.0	1.2e-16
WP_062911328.1|7222980_7224156_-	hypothetical protein	NA	A0A0M4REI4	Salmonella_phage	49.0	4.0e-22
>prophage 1
NZ_CP015037	Burkholderia cenocepacia strain 895 chromosome 2, complete sequence	1072666	826394	864047	1072666	head,plate,transposase,terminase,capsid,portal,tail	Burkholderia_phage(91.67%)	49	NA	NA
WP_034200813.1|826394_827645_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.7	6.9e-41
WP_062911639.1|828272_828611_-	helix-turn-helix domain-containing protein	NA	A4JWW9	Burkholderia_virus	88.4	3.5e-48
WP_062911640.1|829000_829879_+	DUF550 domain-containing protein	NA	R4JG80	Burkholderia_phage	80.6	8.6e-123
WP_154817461.1|829869_830199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911643.1|830406_830586_+	hypothetical protein	NA	R4JEN9	Burkholderia_phage	88.1	6.8e-19
WP_062911644.1|830582_830813_+	hypothetical protein	NA	R4JJR9	Burkholderia_phage	88.2	1.1e-32
WP_062911645.1|830809_831715_+	DNA adenine methylase	NA	R4JMC6	Burkholderia_phage	89.0	8.0e-156
WP_062911646.1|831716_831932_+	hypothetical protein	NA	R4JG87	Burkholderia_phage	81.7	4.2e-23
WP_124634079.1|832110_833085_+	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	71.9	9.9e-136
WP_062911648.1|833096_834998_+	replication protein	NA	A4JWW0	Burkholderia_virus	73.1	6.8e-258
WP_080289798.1|834994_835273_+	hypothetical protein	NA	R4JMD0	Burkholderia_phage	93.5	1.0e-45
WP_080466991.1|835274_835556_+	ogr/Delta-like zinc finger family protein	NA	R4JG92	Burkholderia_phage	94.6	1.7e-48
WP_080466992.1|835552_835885_+	hypothetical protein	NA	R4JDJ1	Burkholderia_phage	91.7	3.9e-52
WP_062911650.1|835889_836480_+	hypothetical protein	NA	R4JDJ1	Burkholderia_phage	92.3	5.5e-89
WP_062911651.1|836476_837262_+	hypothetical protein	NA	R4JEP8	Burkholderia_phage	75.2	1.4e-47
WP_062911652.1|837258_837666_+	hypothetical protein	NA	E5FFG0	Burkholderia_phage	54.1	6.1e-15
WP_062911653.1|837876_838266_-	type II toxin-antitoxin system HicB family antitoxin	NA	R4JJS9	Burkholderia_phage	98.4	6.6e-67
WP_015875749.1|838262_838517_-	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	100.0	1.6e-42
WP_062911654.1|838940_840002_-|portal	phage portal protein	portal	R4JG97	Burkholderia_phage	96.4	3.0e-138
WP_080466993.1|840001_841819_-|terminase	terminase	terminase	R4JDJ3	Burkholderia_phage	91.7	0.0e+00
WP_062911655.1|841973_842840_+|capsid	phage capsid protein	capsid	R4JEQ3	Burkholderia_phage	88.2	9.1e-141
WP_062911656.1|842885_843923_+|capsid	phage major capsid protein, P2 family	capsid	R4JJT6	Burkholderia_phage	93.3	9.4e-185
WP_063822436.1|843932_844631_+|terminase	terminase	terminase	R4JMF4	Burkholderia_phage	93.7	1.6e-108
WP_062911658.1|844727_845228_+|head	head completion/stabilization protein	head	R4JGC6	Burkholderia_phage	94.6	2.2e-83
WP_137984761.1|845227_845482_+	hypothetical protein	NA	A0A1S5NNB0	Burkholderia_phage	67.1	2.9e-23
WP_060336527.1|845478_845685_+|tail	phage tail protein	tail	R4JDL4	Burkholderia_phage	98.5	1.9e-33
WP_062911660.1|845692_846136_+	hypothetical protein	NA	R4JES4	Burkholderia_phage	98.0	2.3e-76
WP_027812680.1|846123_846528_+	hypothetical protein	NA	R4JJW4	Burkholderia_phage	93.3	8.7e-62
WP_062911661.1|846563_847013_+	peptidase M15	NA	R4JMG7	Burkholderia_phage	97.3	2.0e-75
WP_062911662.1|847009_847450_+	hypothetical protein	NA	R4JGE0	Burkholderia_phage	78.8	2.5e-54
WP_062911664.1|847576_848053_+|tail	phage tail protein	tail	R4JET5	Burkholderia_phage	94.3	9.2e-79
WP_062911665.1|848049_848523_+	phage virion morphogenesis protein	NA	R4JJX8	Burkholderia_phage	96.1	2.9e-77
WP_062911666.1|848656_849373_+|plate	phage baseplate assembly protein V	plate	R4JMH2	Burkholderia_phage	94.1	1.9e-123
WP_062911667.1|849372_849747_+|plate	baseplate assembly protein	plate	R4JGE4	Burkholderia_phage	96.8	2.3e-61
WP_062911668.1|849743_850652_+|plate	baseplate assembly protein	plate	R4JDM0	Burkholderia_phage	95.4	2.8e-156
WP_062911669.1|850641_851187_+|tail	phage tail protein I	tail	R4JET8	Burkholderia_phage	97.8	2.7e-98
WP_080466994.1|851189_854549_+|tail	phage tail protein	tail	A0A1S5NTG6	Burkholderia_phage	83.7	0.0e+00
WP_062911671.1|854561_854972_+	hypothetical protein	NA	A0A1S5NV54	Burkholderia_phage	89.0	1.8e-67
WP_062911672.1|855022_855355_+	hypothetical protein	NA	R4JGE6	Burkholderia_phage	91.8	1.3e-47
WP_062911673.1|855422_856610_+|tail	phage tail sheath protein	tail	R4JDM4	Burkholderia_phage	98.5	2.7e-220
WP_062911674.1|856665_857175_+|tail	phage major tail tube protein	tail	R4JEU1	Burkholderia_phage	95.3	5.0e-91
WP_062911675.1|857228_857534_+|tail	phage tail assembly protein	tail	R4JJY8	Burkholderia_phage	99.0	2.4e-48
WP_076882569.1|857545_857662_+|tail	GpE family phage tail protein	tail	A0A1S5NR79	Burkholderia_phage	71.1	2.7e-08
WP_062911676.1|857654_860573_+	hypothetical protein	NA	R4JMH9	Burkholderia_phage	85.6	0.0e+00
WP_062911677.1|860580_861087_+|tail	phage tail protein	tail	R4JGF0	Burkholderia_phage	97.0	1.8e-85
WP_062911678.1|861091_862171_+	phage late control D family protein	NA	R4JDM6	Burkholderia_phage	98.1	9.7e-201
WP_062911679.1|862208_862541_-	hypothetical protein	NA	R4JGF4	Burkholderia_phage	74.0	4.8e-42
WP_080466995.1|862649_863468_-	glycosyltransferase family 25 protein	NA	A0A1S5NQ44	Burkholderia_phage	68.0	9.2e-103
WP_062911680.1|863504_864047_-	hypothetical protein	NA	R4JDM9	Burkholderia_phage	94.2	1.1e-91
>prophage 1
NZ_CP015038	Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence	199812	33230	102800	199812	integrase,plate,transposase	Bacillus_phage(18.75%)	58	72865:72882	105140:105157
WP_085954470.1|33230_34047_+|transposase	IS5-like element ISBcen20 family transposase	transposase	NA	NA	NA	NA
WP_062911760.1|34455_34752_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_062911761.1|34993_35197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011880278.1|35492_36089_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	33.0	2.6e-22
WP_012213993.1|37872_38661_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.1	8.8e-34
WP_011880276.1|40308_40656_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.5	7.0e-36
WP_043291487.1|40652_41084_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	36.4	1.8e-12
WP_062911763.1|41397_42936_-|transposase	IS3-like element ISBmu11 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.2	4.8e-44
WP_080467006.1|42960_43845_+	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	34.2	9.5e-37
WP_009693048.1|43938_45270_-	HAMP domain-containing protein	NA	Q8QNA2	Ectocarpus_siliculosus_virus	32.4	1.5e-09
WP_009693049.1|45266_45929_-	response regulator	NA	W8CYM9	Bacillus_phage	33.3	1.6e-25
WP_080467007.1|45910_46261_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_009693051.1|46676_46919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009693052.1|47232_47538_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_060097648.1|47843_48176_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_060097651.1|48349_49741_+	TolC family protein	NA	NA	NA	NA	NA
WP_060097655.1|49745_50840_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_060097657.1|50836_53905_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	21.3	2.9e-32
WP_009693061.1|53992_54658_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.3	1.4e-21
WP_062911764.1|54633_56022_+	sensor histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	31.1	1.1e-07
WP_012213865.1|56871_58422_+|transposase	IS21-like element ISBmu3 family transposase	transposase	K4I413	Acidithiobacillus_phage	55.4	1.0e-158
WP_009687279.1|58437_59187_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	61.2	2.4e-81
WP_080467023.1|59454_59766_-	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_060097665.1|60882_61332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060097661.1|61366_62149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012213993.1|66060_66849_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	34.1	8.8e-34
WP_080467024.1|68277_68526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080467009.1|70238_70799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911766.1|70805_75044_-	hypothetical protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	48.4	1.6e-25
72865:72882	attL	TCGACAAGTTGACCGCGG	NA	NA	NA	NA
WP_006482386.1|75065_75524_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_062911767.1|75589_76033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911768.1|76076_76946_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_062911769.1|76945_79945_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_062911770.1|80092_81973_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_062911771.1|82553_83009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062911772.1|83262_83511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911773.1|83958_84249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911774.1|84250_84430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911775.1|84939_85833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080467011.1|86056_86311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911776.1|86373_86841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080467012.1|86958_87918_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_062911779.1|88747_89476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911781.1|90290_91034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911782.1|91065_91323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911783.1|91604_92060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154817472.1|92146_92578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911785.1|92888_93089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911786.1|93137_93485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080467013.1|94104_95490_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_063822438.1|95525_96026_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_080467014.1|96029_96491_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_062911788.1|96651_97539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911789.1|97713_98013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062911790.1|98477_98954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062911791.1|98997_99852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154817473.1|99848_100955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062911793.1|100964_102800_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A067ZJC0	Vibrio_phage	37.5	3.1e-05
105140:105157	attR	TCGACAAGTTGACCGCGG	NA	NA	NA	NA
