The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	256018	264117	5776895		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|256018_256303_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029992.1|256341_257976_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	1.3e-156
WP_000743914.1|258382_259921_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	6.8e-22
WP_000833094.1|260307_261633_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	7.1e-44
WP_000929886.1|261926_262628_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.4	1.6e-39
WP_000719237.1|262611_264117_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	1.3e-30
>prophage 2
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	293452	301828	5776895		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625682.1|293452_294760_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170545.1|294848_295568_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|295560_295815_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666782.1|295811_296495_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055594.1|296478_298698_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	3.3e-163
WP_000879026.1|298682_300098_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262424.1|300203_301244_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.3	5.5e-68
WP_016078569.1|301240_301828_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.9	2.7e-27
>prophage 3
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	322638	426667	5776895	tail,protease,integrase,transposase,capsid,portal,head,tRNA,terminase	Bacillus_phage(59.65%)	108	363788:363847	425290:427030
WP_000086999.1|322638_322929_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_000051441.1|322944_324402_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_001047684.1|324416_325844_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016078570.1|326404_327310_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.8	9.2e-27
WP_000416657.1|327450_328197_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017762738.1|328276_329716_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_000225139.1|329831_331199_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000358123.1|331191_332643_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000263262.1|332690_333014_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000915107.1|333146_333638_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_016078573.1|333682_334912_-	aminopeptidase	NA	NA	NA	NA	NA
WP_016078574.1|335028_336111_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000875600.1|336648_337356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001200491.1|337402_338599_-	NupC family nucleoside transporter	NA	NA	NA	NA	NA
WP_016097565.1|339024_340404_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.7	6.5e-117
WP_042596948.1|340462_341587_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	98.9	3.0e-213
WP_042596950.1|342349_343213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042596951.1|343392_343746_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	46.4	2.6e-22
WP_080775517.1|344262_345390_+	hypothetical protein	NA	H0UST6	Bacillus_phage	51.9	1.2e-108
WP_042596955.1|345878_346232_-	helix-turn-helix transcriptional regulator	NA	A0A1B0T6A7	Bacillus_phage	88.9	7.9e-51
WP_052497261.1|346471_346684_+	helix-turn-helix transcriptional regulator	NA	A0A1B0T6B2	Bacillus_phage	85.3	1.7e-24
WP_042596960.1|346699_347050_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	83.6	4.6e-51
WP_155721722.1|347046_347196_+	hypothetical protein	NA	A0A1B1P8G4	Bacillus_phage	77.1	1.4e-14
WP_042596963.1|347424_348165_+	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	82.1	3.1e-81
WP_042596964.1|348112_348976_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	92.9	1.1e-130
WP_042596967.1|348978_349173_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	85.9	6.9e-25
WP_042596968.1|349189_349468_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.1	7.9e-14
WP_042596970.1|349460_349820_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	54.2	1.4e-31
WP_042596972.1|349838_350006_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_042596973.1|350031_350283_+	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	48.7	1.3e-15
WP_042596975.1|350302_350758_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	49.5	1.1e-20
WP_000283199.1|351020_351212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080775449.1|351231_351795_+	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	93.6	2.1e-98
WP_042596978.1|351808_352084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042596980.1|352131_352389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042596982.1|352419_352725_+	hypothetical protein	NA	A0A0S2MVE9	Bacillus_phage	66.0	1.3e-33
WP_000108305.1|353443_355243_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.9	1.7e-32
WP_042596985.1|355360_355681_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	56.6	9.4e-27
WP_042596986.1|355719_355980_+	hypothetical protein	NA	A0A219UQQ6	Bacillus_phage	51.8	2.5e-14
WP_042596988.1|356169_356400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042596990.1|356515_356725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052497238.1|356770_357037_+	hypothetical protein	NA	A0A1X9SGH7	Bacillus_phage	54.5	1.1e-12
WP_000166190.1|357346_357829_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	2.5e-71
WP_001012113.1|357828_358371_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	1.3e-89
WP_042596994.1|359005_359188_+	hypothetical protein	NA	A0A0A7AQ61	Bacillus_phage	80.0	4.5e-18
WP_042596997.1|359219_359648_+	hypothetical protein	NA	A0A0A7AQA1	Bacillus_phage	59.0	2.6e-16
WP_042597000.1|359647_359872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042597002.1|359876_360191_+	helix-turn-helix domain-containing protein	NA	A0A142F1N8	Bacillus_phage	64.4	2.7e-10
WP_042597003.1|360156_360492_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.9	2.1e-53
WP_042597004.1|360642_360999_+	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	98.3	5.1e-58
WP_042597006.1|360995_362651_+|terminase	terminase large subunit	terminase	A0A2H4JI41	uncultured_Caudovirales_phage	98.5	0.0e+00
WP_080775450.1|362655_363801_+|portal	phage portal protein	portal	A0A2H4JBZ5	uncultured_Caudovirales_phage	92.1	1.2e-196
363788:363847	attL	AAGACCTGCGGTAGTATGTCAACTGAGAAATAACAAAGTTTAAAGTTGTCAAAGGTCAAT	NA	NA	NA	NA
WP_001236353.1|363935_365165_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_062804247.1|365538_366327_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	61.5	6.7e-58
WP_000234879.1|366330_367485_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	97.7	1.1e-213
WP_000536353.1|367490_367784_+	hypothetical protein	NA	D2XR19	Bacillus_phage	83.5	6.8e-40
WP_001182260.1|367785_368160_+|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	90.3	1.1e-58
WP_062804248.1|368147_368585_+	hypothetical protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	91.0	1.1e-73
WP_062804249.1|368581_368944_+	DUF3168 domain-containing protein	NA	A0A2H4JBW1	uncultured_Caudovirales_phage	83.3	2.1e-54
WP_062804250.1|368959_369544_+|tail	phage tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	92.7	9.9e-99
WP_042989393.1|369600_369975_+	hypothetical protein	NA	A0A2H4JBU8	uncultured_Caudovirales_phage	86.0	4.0e-53
WP_062804251.1|370139_375137_+|tail	phage tail protein	tail	A0A2H4JI37	uncultured_Caudovirales_phage	82.4	0.0e+00
WP_042597010.1|375176_376646_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	78.1	4.2e-231
WP_062804252.1|376642_381493_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	90.5	0.0e+00
WP_000354139.1|381509_381887_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	62.9	3.9e-40
WP_042597018.1|381988_382948_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	94.4	3.4e-173
WP_042597020.1|382962_383244_+	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	94.6	8.5e-40
WP_000159646.1|383246_383453_+	hypothetical protein	NA	D2XR32	Bacillus_phage	97.1	1.3e-32
WP_042597022.1|383452_384271_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	98.9	6.1e-163
WP_000566714.1|384843_385833_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_001251723.1|386184_386703_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	37.1	1.6e-20
WP_016078575.1|386797_387505_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000217559.1|387765_388461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704500.1|388475_389585_-	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.6	3.9e-19
WP_042597025.1|389679_390951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000711513.1|390939_392361_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_016078578.1|392631_393747_+	amidohydrolase	NA	NA	NA	NA	NA
WP_001005634.1|393940_394546_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000599506.1|394578_396105_-	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	30.8	6.9e-19
WP_000924420.1|396119_396683_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_000033215.1|397274_398504_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_000392488.1|398516_399560_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_000926560.1|399613_400255_+	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000983742.1|400299_401307_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002153558.1|401303_402344_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000732570.1|402392_403310_-	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001070938.1|403641_404691_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000235474.1|404888_405257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000276022.1|405452_405683_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000051518.1|405917_406442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000443834.1|406462_406912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004281.1|407074_407743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000434727.1|407982_409248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046099.1|409385_410612_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_000424116.1|410841_411222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000862979.1|411356_411989_-	cyclase family protein	NA	NA	NA	NA	NA
WP_000147472.1|412335_413445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016078579.1|413556_414339_+	nucleotidyltransferase domain-containing protein	NA	Q8SCS5	Pseudomonas_phage	43.9	1.1e-44
WP_098992794.1|414375_415730_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	85.1	9.5e-129
WP_016078580.1|415801_417103_-	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_000199973.1|417248_418775_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000661228.1|419356_420442_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_003255986.1|420495_421251_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000823756.1|421298_422093_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016078581.1|422215_422938_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	3.4e-32
WP_016078582.1|423147_424440_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.6	1.3e-10
WP_000711822.1|424586_425036_+	arginine repressor	NA	NA	NA	NA	NA
WP_001236353.1|425437_426667_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
425290:427030	attR	AAGACCTGCGGTAGTATGTCAACTGAGAAATAACAAAGTTTAAAGTTGTCAAAGGTCAATTTGTTTAAAAAAGGCATCACGAAACTAAACCAGTAACGAATGTAATTTACTGGAAAATAATGAAAGGTAGCGATGACAAAAATTTATGTCATTCTTTCACACACCTTCCTGGCGTAAAAAGTTGGTGGCTACGTAGTAGCGCATCCACCAATCGCACAAATTTTCTTGCGGTTAGAACGAGTGCACGTTTGTGTTGATGTTTTGGTACTTCATTATATTTTTTCACGTAATACTCTTGATAATCTGATACATGCTTTCTTACTGAATTGGCGGCTTCAACTAAGTAATAACGCAAGTAATGATTACCTGTACGGGATAATGAAGTATCTTCGGCTGTAAAACGACCGGATTGGTGCTTTCGCCAGTATAATCCAGCGTATTTGGCTATTTTTGTTTCATCGTCAAATCTTTCGATTTGGCCAATTTCAGCAATGATACCGGCAGCGAAAACAGGACCTACTCCAGGAATAGATTCAAGTGTTTGGGTCAAACCAGCCATGATTTTTTTAATAGACTTTTCTAATTCCTTGATTTGTTGTTGAAACGTACGAATGACTGCGATGGATGTACCTAAGATGACATCTATTGAATCTTCTACAACCTTATCCAAGCGATAAGAAGCTTTCACAGCTTTTTGAATGGATGCTGCTACGCATTTTGGATCACCAAAACGGTTTCGACTTTTTTCCTGTAGGAACTCAGCGAGTTCTTCTAAAGGCATATTAGCGAGTTCCTCTAAGCTGAATTTTTCAAGAAATAGTTCTGTCATGGCGCTACCAAATACGGAAGTATCCACCTCTTGTGAAAATGTATTACATTTAAAACTTAGGTGTTGAAGAAAGTGTTGTTTTTCTTTCGTTAACATTTTGACAAGTTGGTATCGTGATCTTGTTAATTGCTGCAGTGCCACGTACTGACTTTCTTTTACGATAGACATTTGATTACGGCCAAATCGTAAGTAATCAGCAATGACAAAGGCATCAATCTCATCGGTTTTATTCATGTCAGAATAGCTTTTCTTAAAATTTGCGACTTGTTTTGGGTTTAGGAGAAATACTTTTGCTCCAAAACGCTGTAAATCTATATCATGGTGAAGAAACATAGAAGGATGAAAGCTGTAAACAGAGGTGGATTCTAGACCAATCTTAAGGATGTCGACCTCTTTACCCGCAATACACTGTAATAATTTTTCTTTGAGTGTAGTAGCTCCTGGTAGGTCATTACTGACCGAAAAAGAATCCAGTTTTTCTCCGTCACCATTTAAAAAGCAAACTTTCATATCAAACGAACTTACATCTAAACCAACAAATAATCTCATGTAAGAGACCCCCCTTCTATATTAGAATCATTTCTTGGACGTCTCGAGATATCTCTAGTGTGTACGCCGACCAACAACCTCGTGTATGAGAGCTAGTCCTGAATCGAAAGCCGCCCTAGAGCTACTATCATCTAGGTTCGAGGGTCAGGCTGCTCAGCCTGCGAGTAAGGAGTCCCGCGCGTTCACTGAGAAACACTCTTCAAATGTGGTAAATCCACAGGAGGTGAAAGAATTGTCCCAAATGATCCTAAAATCATTATCTAGAAATATCTTGAGACGTCCAAGTATTTTTATTTATAGGGCTCTTATTAAGAAGAAAATCTAAGCCAGTAATAGGGCTTAAATATTAATATACGAGGAGGT	NA	NA	NA	NA
>prophage 4
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	1195717	1239266	5776895	holin,tail,protease,capsid,portal,head,terminase	Bacillus_phage(51.02%)	57	NA	NA
WP_044797875.1|1195717_1197496_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.1	2.7e-22
WP_033698958.1|1197526_1198930_-	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	1.5e-113
WP_000289677.1|1199073_1199292_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033698956.1|1199307_1199991_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	35.1	4.6e-23
WP_000385074.1|1200140_1200413_+	helix-turn-helix transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	50.0	3.0e-10
WP_033698954.1|1200895_1201648_+	antirepressor	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	80.6	1.8e-105
WP_001186272.1|1201659_1201848_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	96.8	6.1e-26
WP_033698952.1|1201874_1202300_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	97.2	6.3e-71
WP_000178948.1|1202317_1203031_+	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.7	3.6e-127
WP_033698950.1|1203030_1203246_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	98.6	2.5e-31
WP_033698948.1|1203178_1203517_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	98.2	4.0e-52
WP_033698946.1|1203610_1204564_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	89.9	2.4e-147
WP_033698944.1|1204575_1205055_+	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	95.0	1.2e-81
WP_000139235.1|1205047_1205278_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_001245738.1|1205301_1205859_+	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	70.8	2.0e-64
WP_033698942.1|1205897_1206332_+	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	90.3	7.6e-72
WP_001268031.1|1206390_1206681_+	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	93.8	2.5e-50
WP_001093039.1|1206827_1207619_+	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_050428366.1|1207701_1208034_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_033698937.1|1208355_1209051_+	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	81.5	5.4e-112
WP_000590881.1|1209090_1209402_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	84.5	1.0e-41
WP_000540086.1|1209437_1209965_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	97.7	4.1e-96
WP_015670520.1|1209961_1210288_+	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	98.1	4.7e-58
WP_003308641.1|1210325_1210727_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	99.2	1.1e-67
WP_000711194.1|1211110_1211530_-	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	4.5e-61
WP_081206614.1|1211581_1211764_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	65.5	7.9e-15
WP_000650576.1|1211943_1212168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033698935.1|1212181_1212385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033698933.1|1212390_1212825_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	59.4	4.1e-17
WP_033698931.1|1212892_1213102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016099127.1|1213108_1213366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033698928.1|1213356_1213731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000666398.1|1213696_1214032_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	1.6e-53
WP_000763336.1|1214184_1214541_+	hypothetical protein	NA	A0A2H4JBV9	uncultured_Caudovirales_phage	100.0	3.6e-59
WP_033698926.1|1214537_1216193_+|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	96.7	0.0e+00
WP_050428367.1|1216258_1217365_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	90.1	6.3e-187
WP_000216402.1|1217348_1218125_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	2.5e-57
WP_033698924.1|1218144_1219308_+|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	95.9	4.7e-209
WP_033698922.1|1219320_1219617_+	hypothetical protein	NA	D2XR19	Bacillus_phage	89.6	6.6e-43
WP_033698920.1|1219618_1219969_+|head	phage head closure protein	head	D2XR20	Bacillus_phage	85.3	2.4e-52
WP_033698918.1|1219970_1220315_+	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	79.6	2.8e-45
WP_033698916.1|1220311_1220647_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	96.3	5.0e-55
WP_033698914.1|1220647_1221241_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	90.8	2.4e-100
WP_000415932.1|1221247_1221610_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	8.9e-42
WP_000897022.1|1221840_1223076_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	73.1	6.2e-151
WP_033698912.1|1223353_1225732_+	membrane protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	47.7	6.5e-48
WP_062804264.1|1225773_1227243_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	79.3	1.1e-234
WP_062804265.1|1227239_1232084_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	83.9	0.0e+00
WP_033699583.1|1232100_1232478_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	65.6	2.5e-42
WP_042596564.1|1232515_1232941_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	90.8	3.6e-66
WP_033699580.1|1232940_1233897_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	98.4	5.1e-185
WP_000742862.1|1234212_1234779_-	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	5.9e-24
WP_001016124.1|1234918_1235137_+	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	91.7	9.5e-31
WP_000100788.1|1235161_1235452_+	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	90.7	9.3e-42
WP_033699578.1|1235469_1236303_-	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	82.7	7.4e-124
WP_000159539.1|1236780_1237740_+	ferrochelatase	NA	NA	NA	NA	NA
WP_001069166.1|1237799_1239266_+	catalase	NA	A0A2K9L572	Tupanvirus	47.8	1.7e-123
>prophage 5
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	1936886	1984732	5776895	tail,transposase,portal,head,terminase	Bacillus_phage(90.91%)	58	NA	NA
WP_000755512.1|1936886_1938179_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.5	2.2e-10
WP_001194308.1|1938278_1939043_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_044797938.1|1939279_1940854_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	100.0	1.9e-285
WP_062804282.1|1940831_1942214_-	recombinase family protein	NA	B8R885	Bacillus_phage	98.9	6.7e-263
WP_001137803.1|1942213_1942846_-	helix-turn-helix domain-containing protein	NA	W8CZ28	Bacillus_phage	100.0	2.1e-110
WP_016064699.1|1943096_1943345_+	helix-turn-helix transcriptional regulator	NA	W8CYU5	Bacillus_phage	100.0	8.3e-39
WP_062804283.1|1943460_1943697_+	hypothetical protein	NA	W8CYL8	Bacillus_phage	97.4	9.3e-32
WP_016064701.1|1943689_1943959_+	hypothetical protein	NA	W8CYE5	Bacillus_phage	100.0	4.0e-47
WP_016124416.1|1944144_1944630_+	siphovirus Gp157 family protein	NA	W8CYU7	Bacillus_phage	95.7	1.5e-76
WP_062804284.1|1944641_1944851_+	hypothetical protein	NA	A0A1B1P7F7	Bacillus_phage	68.2	2.0e-17
WP_062804285.1|1944831_1945524_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	90.5	2.5e-117
WP_062804286.1|1945528_1945843_+	hypothetical protein	NA	A0A1B1P7F1	Bacillus_phage	95.2	7.0e-51
WP_015994853.1|1945871_1946405_+	hypothetical protein	NA	A0A1B1P7H0	Bacillus_phage	100.0	5.5e-96
WP_062804287.1|1946407_1946995_+	hypothetical protein	NA	W8CZ31	Bacillus_phage	98.5	6.4e-106
WP_062804288.1|1946994_1947828_+	hypothetical protein	NA	W8CYV0	Bacillus_phage	98.6	3.2e-159
WP_062804289.1|1947862_1948048_+	hypothetical protein	NA	A0A0A7AR03	Bacillus_phage	59.0	1.1e-14
WP_062804290.1|1948062_1948248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804291.1|1948313_1949009_+	transcriptional regulator	NA	W8CYS3	Bacillus_phage	86.1	2.5e-109
WP_062804429.1|1949175_1949628_+	hypothetical protein	NA	A0A1B1P7H1	Bacillus_phage	97.3	6.9e-84
WP_062804292.1|1949620_1949827_+	hypothetical protein	NA	W8CYE7	Bacillus_phage	94.1	8.1e-32
WP_033699819.1|1950245_1950746_+	hypothetical protein	NA	A0A1B1P7G1	Bacillus_phage	100.0	7.6e-92
WP_015994862.1|1950869_1951070_+	NINE protein	NA	A0A1B1P7I0	Bacillus_phage	100.0	1.6e-32
WP_062804430.1|1951107_1952439_+	hypothetical protein	NA	W8CYE8	Bacillus_phage	99.5	1.1e-254
WP_062804293.1|1952635_1952863_+	hypothetical protein	NA	A0A1B1P7I9	Bacillus_phage	100.0	1.8e-32
WP_001236353.1|1952978_1954208_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_062804294.1|1954580_1954811_+	hypothetical protein	NA	A0A1B1P7I3	Bacillus_phage	97.4	6.7e-35
WP_016064720.1|1954925_1955525_+	DUF1064 domain-containing protein	NA	W8CYE9	Bacillus_phage	100.0	1.4e-111
WP_155721724.1|1956021_1956186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016064724.1|1956325_1956604_+	hypothetical protein	NA	K4LPB5	Bacillus_virus	100.0	4.0e-50
WP_062804295.1|1956902_1957142_+	hypothetical protein	NA	A0A1B1P7I4	Bacillus_phage	97.5	2.6e-37
WP_062804296.1|1958678_1958939_+	hypothetical protein	NA	W8CYW3	Bacillus_phage	100.0	2.4e-44
WP_062804297.1|1958935_1959199_+	hypothetical protein	NA	W8CYS7	Bacillus_phage	93.1	5.0e-42
WP_000432374.1|1959198_1959468_+	hypothetical protein	NA	W8CYM4	Bacillus_phage	100.0	4.6e-43
WP_060852207.1|1959563_1960043_+|terminase	terminase small subunit	terminase	W8CYF1	Bacillus_phage	99.4	9.3e-87
WP_062804299.1|1960325_1961645_+|terminase	PBSX family phage terminase large subunit	terminase	W8CZ36	Bacillus_phage	99.1	1.7e-260
WP_062804300.1|1961659_1963159_+|portal	phage portal protein	portal	W8CYW5	Bacillus_phage	95.3	2.0e-268
WP_062804301.1|1963225_1964251_+|head	phage head morphogenesis protein	head	A0A1B1P7K3	Bacillus_phage	97.4	2.6e-187
WP_062804302.1|1964259_1964460_+	hypothetical protein	NA	W8CYM5	Bacillus_phage	92.4	9.3e-25
WP_062804303.1|1964560_1965172_+	DUF4355 domain-containing protein	NA	A0A1B1P7J6	Bacillus_phage	85.7	2.2e-80
WP_000209681.1|1965248_1966085_+	hypothetical protein	NA	A0A1B1P7J5	Bacillus_phage	100.0	5.3e-154
WP_000782183.1|1966121_1966487_+	hypothetical protein	NA	W8CYS9	Bacillus_phage	100.0	7.1e-63
WP_001216890.1|1966490_1966823_+	hypothetical protein	NA	W8CYM6	Bacillus_phage	100.0	3.1e-57
WP_000503577.1|1966822_1967239_+	hypothetical protein	NA	W8CYF3	Bacillus_phage	100.0	8.9e-70
WP_000616958.1|1967235_1967637_+	hypothetical protein	NA	A0A1B1P7K0	Bacillus_phage	99.2	6.0e-71
WP_000561467.1|1967655_1968321_+	hypothetical protein	NA	A0A1B1P7K6	Bacillus_phage	100.0	2.2e-126
WP_000446742.1|1968386_1968806_+	hypothetical protein	NA	W8CYT0	Bacillus_phage	100.0	3.3e-72
WP_002162841.1|1968826_1969099_+	hypothetical protein	NA	W8CYM7	Bacillus_phage	98.9	2.2e-45
WP_062804304.1|1969101_1971945_+|tail	phage tail tape measure protein	tail	K4LRV6	Bacillus_virus	96.8	0.0e+00
WP_000649519.1|1971956_1973471_+|tail	phage tail protein	tail	W8CYX4	Bacillus_phage	99.8	1.5e-300
WP_062804305.1|1973474_1978595_+	hypothetical protein	NA	A0A1B1P7K4	Bacillus_phage	93.4	0.0e+00
WP_062804306.1|1978604_1978892_+	hypothetical protein	NA	W8CZ40	Bacillus_phage	98.9	5.2e-45
WP_062804307.1|1978950_1979742_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7K2	Bacillus_phage	98.5	1.5e-153
WP_062804308.1|1979773_1980031_+	hypothetical protein	NA	W8CYT2	Bacillus_phage	100.0	4.4e-27
WP_000612415.1|1980071_1980749_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.6	3.0e-123
WP_016077844.1|1980745_1981819_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	100.0	2.2e-192
WP_000818985.1|1982046_1982766_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_002083265.1|1983478_1983733_+	hypothetical protein	NA	W8CYN0	Bacillus_phage	100.0	4.5e-40
WP_001258547.1|1983862_1984732_+	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	44.2	1.6e-65
>prophage 6
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	2022381	2071714	5776895	coat,transposase,protease	Bacillus_phage(37.5%)	52	NA	NA
WP_000099758.1|2022381_2023329_+|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	57.1	1.8e-94
WP_001259903.1|2023368_2023677_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000877950.1|2023783_2024719_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000162602.1|2025692_2025917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000426317.1|2026001_2026349_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_001236353.1|2026503_2027733_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_016077838.1|2028278_2028806_+	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_016077837.1|2028988_2030038_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_016077836.1|2030238_2032221_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.2	8.7e-30
WP_000539571.1|2032417_2032723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016077835.1|2033044_2033410_+	DUF3979 domain-containing protein	NA	NA	NA	NA	NA
WP_000370209.1|2033444_2034485_-	membrane protein	NA	NA	NA	NA	NA
WP_000105199.1|2034726_2035170_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	6.2e-45
WP_000488205.1|2035272_2035728_+	DUF3939 domain-containing protein	NA	NA	NA	NA	NA
WP_042597866.1|2035942_2036887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594036.1|2036931_2037933_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000683363.1|2038037_2038229_-	DUF3896 domain-containing protein	NA	NA	NA	NA	NA
WP_042597868.1|2038406_2039870_+	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	22.0	1.5e-15
WP_016077832.1|2039954_2040539_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000442822.1|2040563_2041466_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_000613427.1|2041631_2042582_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001048683.1|2042849_2043320_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001126157.1|2043458_2044409_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_062804310.1|2044603_2044849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053955.1|2044911_2046348_-|transposase	IS4-like element IS231A family transposase	transposase	NA	NA	NA	NA
WP_001042731.1|2046607_2047267_+	oxidoreductase	NA	NA	NA	NA	NA
WP_016077831.1|2047296_2048334_-	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_000283913.1|2048467_2048920_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.0	1.1e-25
WP_000824273.1|2050008_2051670_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000943769.1|2051729_2052146_+	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	64.8	1.3e-39
WP_000543118.1|2052159_2052705_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
WP_000858828.1|2052718_2053330_+	phosphoserine phosphatase 1	NA	NA	NA	NA	NA
WP_000817481.1|2053375_2053936_-	exosporium protein ExsB	NA	NA	NA	NA	NA
WP_000938005.1|2054117_2055194_+|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_000880690.1|2056019_2056622_+	DedA family protein	NA	NA	NA	NA	NA
WP_000678844.1|2056724_2058104_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000932389.1|2058287_2059229_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_000418726.1|2059427_2060324_+	permease	NA	NA	NA	NA	NA
WP_000488058.1|2060327_2061197_+	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000141164.1|2061316_2061823_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000505094.1|2061949_2062036_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_002083284.1|2062196_2063381_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_000340543.1|2063412_2063871_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_001045962.1|2064097_2064277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861642.1|2064378_2065002_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000217335.1|2065026_2065509_-	DUF456 family protein	NA	NA	NA	NA	NA
WP_000353734.1|2065510_2066818_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016077830.1|2067026_2067896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016077829.1|2068243_2068831_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016077828.1|2068839_2069472_+	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_001220522.1|2069661_2070309_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_098369157.1|2070368_2071714_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	73.7	1.1e-111
>prophage 7
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	2085114	2131025	5776895	holin,tail,protease,integrase,transposase,capsid,portal,head,terminase	Bacillus_phage(93.88%)	53	2085076:2085094	2131369:2131387
2085076:2085094	attL	ATGGTCACAGTGTTTCTTA	NA	NA	NA	NA
WP_016098373.1|2085114_2086206_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	80.1	2.8e-163
WP_016098374.1|2086945_2088166_+	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	49.5	2.9e-108
WP_000258007.1|2088565_2088910_-	helix-turn-helix domain-containing protein	NA	H0UST7	Bacillus_phage	40.6	1.2e-14
WP_016098375.1|2089084_2089291_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000549467.1|2089366_2089555_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	95.2	1.4e-25
WP_016098376.1|2089779_2090523_+	phage regulatory protein	NA	H0UST9	Bacillus_phage	75.7	3.5e-101
WP_016098378.1|2090685_2090994_+	hypothetical protein	NA	W8CYU1	Bacillus_phage	90.5	1.9e-40
WP_042597105.1|2091019_2091667_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	97.2	3.5e-113
WP_042597876.1|2091909_2092926_+	hypothetical protein	NA	W8CYG5	Bacillus_phage	97.0	2.7e-184
WP_042597877.1|2092888_2093701_+	DNA replication protein	NA	A0A0S2GLK2	Bacillus_phage	98.9	1.5e-153
WP_000436951.1|2093742_2094009_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_016098383.1|2094080_2094245_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	98.1	2.9e-24
WP_042597879.1|2094473_2094884_+	hypothetical protein	NA	Q2LI92	Bacillus_phage	92.6	3.3e-69
WP_042597880.1|2095045_2095255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042597882.1|2095676_2096051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042597886.1|2097547_2097829_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	89.2	5.0e-40
WP_042597891.1|2098194_2098683_+	ArpU family transcriptional regulator	NA	A0A1B0T6C9	Bacillus_phage	95.1	5.4e-82
WP_001012130.1|2098679_2099222_+|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	99.4	5.5e-96
WP_002179614.1|2099428_2099674_+	hypothetical protein	NA	W8CYG8	Bacillus_phage	100.0	6.9e-38
WP_000017440.1|2100076_2100364_+	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_033669512.1|2100400_2100619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016098393.1|2100664_2100886_+	hypothetical protein	NA	W8CYF7	Bacillus_phage	98.5	5.5e-26
WP_042597894.1|2100878_2101118_+	hypothetical protein	NA	W8CZ42	Bacillus_phage	94.9	3.8e-17
WP_000773601.1|2101134_2101347_+	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_042597896.1|2101481_2101736_+	hypothetical protein	NA	W8CYT4	Bacillus_phage	100.0	1.5e-43
WP_042597898.1|2101725_2102103_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	96.8	3.8e-67
WP_062804311.1|2102232_2102736_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	98.2	9.7e-87
WP_062804312.1|2102737_2104432_+|terminase	terminase large subunit	terminase	H0USW3	Bacillus_phage	99.1	0.0e+00
WP_000499525.1|2104803_2106000_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_062804313.1|2106296_2107550_+|portal	phage portal protein	portal	H0USW4	Bacillus_phage	99.0	1.9e-240
WP_086405676.1|2107536_2108247_+|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	99.6	1.5e-128
WP_044798175.1|2108284_2109451_+|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	100.0	5.6e-210
WP_044798174.1|2109471_2109759_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	97.9	8.9e-45
WP_044798173.1|2109745_2110069_+|head	phage head closure protein	head	W8CYF9	Bacillus_phage	99.1	3.3e-56
WP_044798172.1|2110061_2110496_+	HK97 gp10 family phage protein	NA	W8CZ44	Bacillus_phage	100.0	1.0e-76
WP_030022312.1|2110492_2110852_+	DUF3168 domain-containing protein	NA	W8CYY6	Bacillus_phage	100.0	5.9e-62
WP_000896770.1|2110852_2111461_+|tail	tail protein	tail	W8CYT6	Bacillus_phage	100.0	5.8e-102
WP_042596503.1|2111507_2111825_+	hypothetical protein	NA	W8CYN3	Bacillus_phage	100.0	1.2e-53
WP_000344049.1|2111854_2112031_+	hypothetical protein	NA	W8CYG0	Bacillus_phage	100.0	6.7e-27
WP_042597914.1|2112045_2113362_+|tail	phage tail tape measure protein	tail	H0USX3	Bacillus_phage	91.1	4.0e-148
WP_000108316.1|2114482_2116288_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.1	5.5e-31
WP_042597917.1|2118958_2120443_+|tail	phage tail protein	tail	H0USX4	Bacillus_phage	94.9	3.3e-284
WP_042597919.1|2120439_2124465_+	phage minor structural protein	NA	H0USX5	Bacillus_phage	90.3	0.0e+00
WP_016098407.1|2124590_2124815_+	XpaF1 protein	NA	A0A1B1P780	Bacillus_phage	94.6	2.7e-28
WP_033669515.1|2124890_2125316_+|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	88.7	9.8e-64
WP_042597921.1|2125315_2126017_+	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	89.0	1.2e-119
WP_016098411.1|2126637_2127441_-	hypothetical protein	NA	A6M971	Geobacillus_virus	41.3	7.1e-23
WP_016098412.1|2127440_2127647_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	43.1	8.2e-08
WP_016098413.1|2127835_2128153_+	hypothetical protein	NA	H0USY0	Bacillus_phage	97.1	1.4e-51
WP_016098414.1|2128149_2128332_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	1.5e-21
WP_000891545.1|2128447_2129629_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	93.4	1.9e-213
WP_042597925.1|2129570_2130191_+	phage protein	NA	H0USY2	Bacillus_phage	96.6	1.3e-112
WP_016098418.1|2130200_2131025_-	helix-turn-helix domain-containing protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	66.9	9.6e-100
2131369:2131387	attR	ATGGTCACAGTGTTTCTTA	NA	NA	NA	NA
>prophage 8
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	2218834	2225748	5776895		Bacillus_phage(33.33%)	8	NA	NA
WP_000427801.1|2218834_2219110_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	41.2	2.9e-08
WP_003277991.1|2219308_2219572_+	hypothetical protein	NA	A0A218KBU4	Bacillus_phage	38.9	4.4e-06
WP_000456183.1|2220218_2220566_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	27.5	6.6e-10
WP_000109855.1|2220756_2221830_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.3	6.9e-74
WP_000709202.1|2221826_2221952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499713.1|2222271_2223099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000165966.1|2223208_2223856_+	HD domain-containing protein	NA	S4W232	Pandoravirus	28.3	2.5e-10
WP_000783164.1|2223852_2225748_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	25.3	4.9e-46
>prophage 9
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	2674845	2770032	5776895	tail,head,protease,transposase,integrase,capsid,bacteriocin,tRNA	Bacillus_phage(50.0%)	87	2678161:2678220	2721285:2723022
WP_098369157.1|2674845_2676191_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	73.7	1.1e-111
WP_000350258.1|2677624_2678119_+	DUF4030 domain-containing protein	NA	NA	NA	NA	NA
2678161:2678220	attL	AAGACCTGCGGTAGTATGTCAACTGAGAAATAACAAAGTTTAAAGTTGTCAAAGGTCAAT	NA	NA	NA	NA
WP_001236353.1|2678308_2679538_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_016077652.1|2679906_2681277_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	42.6	4.4e-73
WP_001254187.1|2681297_2681648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098992794.1|2681749_2683104_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	85.1	9.5e-129
WP_000290889.1|2683271_2683475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042598155.1|2683498_2683741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001021710.1|2684897_2685395_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000397601.1|2685653_2686283_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001194779.1|2686548_2687181_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001079445.1|2687292_2687994_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016077649.1|2687990_2688893_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000551042.1|2689037_2689208_+	DUF2197 domain-containing protein	NA	NA	NA	NA	NA
WP_042598150.1|2689617_2691171_+|tRNA	lysine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_042598148.1|2691230_2691659_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_000285653.1|2691809_2692724_+	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_000238992.1|2692851_2693559_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_062804318.1|2693555_2693807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000108316.1|2694480_2696286_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.1	5.5e-31
WP_000354655.1|2697346_2698243_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	33.7	2.0e-05
WP_000395988.1|2698301_2699291_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_002082721.1|2699809_2701438_+	ABC-F type ribosomal protection protein	NA	A0A1B0RXA0	Streptococcus_phage	34.3	1.2e-53
WP_000503550.1|2701458_2702052_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016077647.1|2702782_2703553_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	3.1e-31
WP_016077646.1|2703527_2705459_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000975387.1|2705509_2706196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001165517.1|2706273_2706615_-	DUF3914 domain-containing protein	NA	NA	NA	NA	NA
WP_000517056.1|2706891_2708133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000701766.1|2708220_2709246_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000471637.1|2709335_2710784_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_016077645.1|2710788_2711703_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016077644.1|2712009_2712699_+	thiaminase II	NA	NA	NA	NA	NA
WP_002082716.1|2713096_2713360_+	DUF3937 domain-containing protein	NA	NA	NA	NA	NA
WP_001071349.1|2713813_2714143_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_042598145.1|2714636_2715122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000736198.1|2715428_2716130_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_000675852.1|2716168_2717278_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.7	5.7e-148
WP_081206606.1|2718380_2719574_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVK2	Bacillus_phage	59.0	1.5e-125
WP_000427704.1|2720093_2720453_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	43.9	7.8e-22
WP_044797971.1|2720623_2720827_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	59.7	4.4e-14
WP_062804319.1|2721032_2721317_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	89.4	2.9e-35
WP_001236353.1|2721432_2722662_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_000216410.1|2723035_2723818_+|protease	Clp protease ClpP	protease	R9TLM7	Paenibacillus_phage	52.8	1.9e-57
2721285:2723022	attR	AAGACCTGCGGTAGTATGTCAACTGAGAAATAACAAAGTTTAAAGTTGTCAAAGGTCAATTTGTTTAAAAAAGGCATCACGAAACTAAACCAGTAACGAATGTAATTTACTGGAAAATAATGAAAGGTAGCGATGACAAAAATTTATGTCATTCTTTCACACACCTTCCTGGCGTAAAAAGTTGGTGGCTACGTAGTAGCGCATCCACCAATCGCACAAATTTTCTTGCGGTTAGAACGAGTGCACGTTTGTGTTGATGTTTTGGTACTTCATTATATTTTTTCACGTAATACTCTTGATAATCTGATACATGCTTTCTTACTGAATTGGCGGCTTCAACTAAGTAATAACGCAAGTAATGATTACCTGTACGGGATAATGAAGTATCTTCGGCTGTAAAACGACCGGATTGGTGCTTTCGCCAGTATAATCCAGCGTATTTGGCTATTTTTGTTTCATCGTCAAATCTTTCGATTTGGCCAATTTCAGCAATGATACCGGCAGCGAAAACAGGACCTACTCCAGGAATAGATTCAAGTGTTTGGGTCAAACCAGCCATGATTTTTTTAATAGACTTTTCTAATTCCTTGATTTGTTGTTGAAACGTACGAATGACTGCGATGGATGTACCTAAGATGACATCTATTGAATCTTCTACAACCTTATCCAAGCGATAAGAAGCTTTCACAGCTTTTTGAATGGATGCTGCTACGCATTTTGGATCACCAAAACGGTTTCGACTTTTTTCCTGTAGGAACTCAGCGAGTTCTTCTAAAGGCATATTAGCGAGTTCCTCTAAGCTGAATTTTTCAAGAAATAGTTCTGTCATGGCGCTACCAAATACGGAAGTATCCACCTCTTGTGAAAATGTATTACATTTAAAACTTAGGTGTTGAAGAAAGTGTTGTTTTTCTTTCGTTAACATTTTGACAAGTTGGTATCGTGATCTTGTTAATTGCTGCAGTGCCACGTACTGACTTTCTTTTACGATAGACATTTGATTACGGCCAAATCGTAAGTAATCAGCAATGACAAAGGCATCAATCTCATCGGTTTTATTCATGTCAGAATAGCTTTTCTTAAAATTTGCGACTTGTTTTGGGTTTAGGAGAAATACTTTTGCTCCAAAACGCTGTAAATCTATATCATGGTGAAGAAACATAGAAGGATGAAAGCTGTAAACAGAGGTGGATTCTAGACCAATCTTAAGGATGTCGACCTCTTTACCCGCAATACACTGTAATAATTTTTCTTTGAGTGTAGTAGCTCCTGGTAGGTCATTACTGACCGAAAAAGAATCCAGTTTTTCTCCGTCACCATTTAAAAAGCAAACTTTCATATCAAACGAACTTACATCTAAACCAACAAATAATCTCATGTAAGAGACCCCCCTTCTATATTAGAATCATTTCTTGGACGTCTCGAGATATCTCTAGTGTGTACGCCGACCAACAACCTCGTGTATGAGAGCTAGTCCTGAATCGAAAGCCGCCCTAGAGCTACTATCATCTAGGTTCGAGGGTCAGGCTGCTCAGCCTGCGAGTAAGGAGTCCCGCGCGTTCACTGAGAAACACTCTTCAAATGTGGTAAATCCACAGGAGGTGAAAGAATTGTCCCAAATGATCCTAAAATCATTATCTAGAAATATCTTGAGACGTCCAAGTATTTTTATTTATAGGGCTCTTATTAAGAAGAAAATCTAAGCCAGTAATAGGGCTTAAATATTAATATACGAGGA	NA	NA	NA	NA
WP_044797999.1|2723821_2724976_+|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	90.4	2.0e-199
WP_044798000.1|2724981_2725275_+	hypothetical protein	NA	D2XR19	Bacillus_phage	93.8	5.3e-45
WP_044798001.1|2725276_2725630_+|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	95.7	6.6e-58
WP_044798002.1|2725631_2725973_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	92.0	9.9e-51
WP_044798003.1|2725972_2726302_+	hypothetical protein	NA	D2XR22	Bacillus_phage	88.1	1.5e-48
WP_001004914.1|2726302_2726890_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	81.0	3.3e-86
WP_000415921.1|2726894_2727257_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	90.0	9.8e-57
WP_044798005.1|2727487_2728951_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	85.4	4.9e-187
WP_044798007.1|2729173_2731339_+|tail	phage tail tape measure protein, TP901 family, core region	tail	A0A2H4JC82	uncultured_Caudovirales_phage	82.6	7.6e-96
WP_044798008.1|2731380_2732856_+|tail	phage tail protein	tail	D2XR27	Bacillus_phage	58.4	6.4e-163
WP_044798009.1|2732852_2737586_+	peptidase S74	NA	D2XR28	Bacillus_phage	57.9	0.0e+00
WP_000398729.1|2737624_2737858_+	hypothetical protein	NA	A0A0A7AQY5	Bacillus_phage	97.3	6.6e-06
WP_000499525.1|2738042_2739239_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_000461723.1|2739536_2739776_+	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	98.7	1.2e-34
WP_044798010.1|2739772_2740837_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	96.6	8.7e-202
WP_044798011.1|2741270_2742461_+	ATP-binding protein	NA	C7BGE8	Burkholderia_phage	28.4	7.8e-34
WP_044798012.1|2742457_2743231_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_062804320.1|2743919_2745602_+	RNAseH domain-containing protein	NA	NA	NA	NA	NA
WP_033668957.1|2745809_2746577_+	DUF3959 family protein	NA	NA	NA	NA	NA
WP_016077599.1|2746721_2747138_+	DUF3995 domain-containing protein	NA	NA	NA	NA	NA
WP_000878369.1|2747260_2747464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000416836.1|2747792_2748005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000565700.1|2748214_2749219_+	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_000282691.1|2749365_2749770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042598142.1|2749930_2751166_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000106404.1|2751432_2752716_+	MFS transporter	NA	NA	NA	NA	NA
WP_001069207.1|2752705_2753338_+	Vat family streptogramin A O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.1	1.6e-25
WP_000046095.1|2753408_2753564_+	DUF1540 domain-containing protein	NA	NA	NA	NA	NA
WP_000289121.1|2753666_2754164_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000168021.1|2754304_2755519_+	cytochrome P450	NA	NA	NA	NA	NA
WP_000954440.1|2755627_2756206_+	cysteine dioxygenase	NA	NA	NA	NA	NA
WP_000766389.1|2756380_2757232_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001088545.1|2757654_2759442_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000743784.1|2759676_2761803_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_002162782.1|2761879_2762410_+	signal peptidase I	NA	NA	NA	NA	NA
WP_000932152.1|2762669_2763857_+	UDP-glucosyltransferase	NA	A0A2H4ZK81	Cryptophlebia_leucotreta_granulosis_virus	24.3	4.0e-06
WP_000864388.1|2763948_2764629_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_001038209.1|2765038_2765587_+	ECF-type riboflavin transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016077598.1|2765597_2767298_+	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	2.1e-16
WP_016077597.1|2767290_2768091_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000120182.1|2768227_2768335_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000348332.1|2768435_2769695_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.1	1.6e-24
WP_001074707.1|2769819_2770032_-|transposase	transposase	transposase	A0A0U3U8Y8	Bacillus_phage	75.0	1.8e-18
>prophage 10
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	2922265	2930333	5776895		Bacillus_phage(71.43%)	13	NA	NA
WP_062804358.1|2922265_2922814_+	HNH endonuclease	NA	A0A218KBW3	Bacillus_phage	58.0	1.0e-52
WP_062804359.1|2922942_2923452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804360.1|2924170_2924404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804361.1|2924400_2925324_+	toprim domain-containing protein	NA	A0A0S2MXZ7	Enterococcus_phage	40.5	9.6e-56
WP_086421742.1|2925504_2926467_+	sigma-70 family RNA polymerase sigma factor	NA	R9R4B7	Vibrio_phage	45.7	1.2e-11
WP_062804363.1|2926530_2926737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155721730.1|2926780_2926945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804364.1|2927090_2927363_+	hypothetical protein	NA	A0A222Z7Z6	Bacillus_phage	52.8	2.7e-19
WP_062804365.1|2927363_2927645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804366.1|2927744_2928530_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D6X870	Bacillus_phage	66.5	2.5e-97
WP_062804367.1|2928558_2928792_-	hypothetical protein	NA	A0A0S2MVE8	Bacillus_phage	42.0	3.0e-06
WP_062804368.1|2928819_2929230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081206609.1|2929244_2930333_-	DUF2479 domain-containing protein	NA	I1TLF6	Bacillus_phage	35.8	2.6e-20
>prophage 11
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	3802868	3855394	5776895	holin,transposase,tRNA	Streptococcus_phage(33.33%)	53	NA	NA
WP_017763506.1|3802868_3804071_+|tRNA	serine-tRNA(Ala) deacylase AlaX	tRNA	NA	NA	NA	NA
WP_000432585.1|3804115_3804559_-	NUDIX hydrolase	NA	D0R7I2	Paenibacillus_phage	31.7	4.8e-05
WP_001247725.1|3804663_3805245_+	SAP domain-containing protein	NA	NA	NA	NA	NA
WP_001077997.1|3805253_3806345_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_042595444.1|3806337_3807801_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	1.3e-27
WP_001093320.1|3807866_3808442_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_042595448.1|3808565_3810179_-	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_079245827.1|3810347_3811181_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042595450.1|3811578_3811782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001236353.1|3812151_3813381_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_000214258.1|3813667_3814480_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000160410.1|3814651_3814864_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000981064.1|3814886_3815135_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_000403997.1|3815154_3815607_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0F7LBB1	uncultured_marine_virus	35.4	2.7e-11
WP_002162635.1|3815622_3816444_-	serine/threonine protein phosphatase	NA	NA	NA	NA	NA
WP_002005544.1|3816540_3817380_+	YitT family protein	NA	NA	NA	NA	NA
WP_000800779.1|3817399_3817771_-	glyoxalase	NA	NA	NA	NA	NA
WP_042595456.1|3818007_3819540_+	sporulation kinase KinA	NA	NA	NA	NA	NA
WP_000975496.1|3819583_3820192_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_044798047.1|3820216_3821155_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_000687593.1|3821495_3822974_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_001183916.1|3823272_3823761_-	cytochrome c biogenesis protein CcdC	NA	NA	NA	NA	NA
WP_042595465.1|3823873_3825448_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_000204597.1|3825515_3826643_-	alkene reductase	NA	NA	NA	NA	NA
WP_000451479.1|3827206_3827683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000399844.1|3827928_3828900_-	formimidoylglutamase	NA	NA	NA	NA	NA
WP_000887549.1|3828878_3830150_-	imidazolonepropionase	NA	NA	NA	NA	NA
WP_042595469.1|3830162_3831821_-	urocanate hydratase	NA	NA	NA	NA	NA
WP_000631844.1|3831844_3833362_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	40.6	4.2e-101
WP_000926515.1|3833467_3833908_-	hut operon transcriptional regulator HutP	NA	NA	NA	NA	NA
WP_000166776.1|3834102_3835050_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000722190.1|3835063_3835636_-	4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein	NA	NA	NA	NA	NA
WP_000332115.1|3835632_3836211_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000262400.1|3836465_3836762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000889371.1|3836865_3837297_+	DUF2621 domain-containing protein	NA	NA	NA	NA	NA
WP_001028640.1|3837367_3837874_-	cytochrome c biogenesis protein CcdC	NA	NA	NA	NA	NA
WP_001152674.1|3837964_3838672_-	cytochrome c-type biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_000947042.1|3839160_3840075_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000253664.1|3840162_3841308_+	amidohydrolase	NA	NA	NA	NA	NA
WP_098369157.1|3841377_3842722_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	73.7	1.1e-111
WP_000482759.1|3842792_3843737_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000159708.1|3844764_3846234_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	39.0	6.6e-67
WP_001236353.1|3846688_3847918_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_000050614.1|3848126_3848702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001220622.1|3848872_3849472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000423234.1|3849565_3850465_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000872365.1|3850618_3850984_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_000578954.1|3850980_3851658_+	LrgB family protein	NA	NA	NA	NA	NA
WP_000442973.1|3851670_3852084_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_042595477.1|3852226_3852427_+	DUF3903 domain-containing protein	NA	NA	NA	NA	NA
WP_000974664.1|3852794_3853550_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000644411.1|3853648_3853795_-	BC1881 family protein	NA	NA	NA	NA	NA
WP_001236353.1|3854164_3855394_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
>prophage 12
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	3873616	3882915	5776895	bacteriocin	Bacillus_phage(44.44%)	12	NA	NA
WP_000413739.1|3873616_3874237_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_003279471.1|3874327_3875131_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000031386.1|3875131_3875674_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_001102628.1|3875666_3875990_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000392443.1|3876361_3876592_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	77.6	1.7e-25
WP_001051376.1|3876653_3877496_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	47.7	1.4e-32
WP_000981478.1|3877619_3878609_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	43.3	1.7e-34
WP_000464432.1|3878843_3879230_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	68.3	5.4e-45
WP_000511422.1|3879638_3880526_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	64.6	1.0e-94
WP_001189066.1|3880678_3880873_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	72.6	2.6e-16
WP_000283430.1|3881839_3882052_-	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_000708856.1|3882255_3882915_+	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	8.7e-35
>prophage 13
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	4701440	4709128	5776895		Bacillus_phage(33.33%)	9	NA	NA
WP_000221121.1|4701440_4702364_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	2.6e-45
WP_000247674.1|4702489_4703425_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.4e-24
WP_000018046.1|4703426_4704119_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.7	8.2e-36
WP_001014310.1|4704463_4704658_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255945.1|4704697_4705897_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	6.1e-71
WP_000587818.1|4706191_4706515_+	heme oxygenase	NA	NA	NA	NA	NA
WP_002162479.1|4706587_4707352_-	class B sortase	NA	NA	NA	NA	NA
WP_000403765.1|4707384_4708155_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	1.7e-13
WP_042595928.1|4708144_4709128_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.4	1.4e-17
>prophage 14
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	5075219	5168936	5776895	coat,holin,tail,protease,capsid,transposase,integrase,portal,head,tRNA,terminase	Bacillus_phage(67.27%)	102	5082013:5082047	5142442:5142476
WP_000287148.1|5075219_5076596_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.9	5.8e-49
WP_042596334.1|5076635_5077019_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810328.1|5077114_5077858_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_042596337.1|5077908_5078502_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_000757823.1|5078548_5079436_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	9.1e-80
WP_001104214.1|5079543_5081268_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.7	5.9e-176
WP_000545255.1|5081411_5082017_+	hypothetical protein	NA	NA	NA	NA	NA
5082013:5082047	attL	TATAAAGTGAAACTTTAATCAGCCCTCACCAATCA	NA	NA	NA	NA
WP_000487967.1|5082198_5083683_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	39.7	4.3e-58
WP_000920103.1|5083828_5084455_-	hypothetical protein	NA	A0A0H3UZG2	Geobacillus_virus	42.1	6.1e-14
WP_000027012.1|5084542_5084860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000415307.1|5084856_5085363_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_042596339.1|5085485_5086694_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000829785.1|5087155_5088145_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	52.4	2.3e-31
WP_062804418.1|5088259_5098279_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_000606668.1|5098707_5099187_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391930.1|5099415_5100663_+	MFS transporter	NA	NA	NA	NA	NA
WP_000535257.1|5100680_5101562_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000635493.1|5101642_5102104_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_000710531.1|5102426_5103254_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_000551103.1|5103263_5103884_-	hypothetical protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_000891536.1|5103825_5105007_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.7	6.9e-216
WP_000170777.1|5105122_5105305_-	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_001257569.1|5105301_5105619_-	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000649833.1|5105801_5105999_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001137905.1|5106007_5106187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000043397.1|5106192_5106771_+	hypothetical protein	NA	H0USX9	Bacillus_phage	88.0	5.0e-95
WP_000119483.1|5106824_5107163_+	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	94.6	2.1e-48
WP_000405778.1|5107708_5108410_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	90.3	1.7e-121
WP_000373913.1|5108409_5108835_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	96.5	1.2e-69
WP_000390482.1|5108910_5109135_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	97.3	8.3e-30
WP_000631942.1|5110474_5112817_-	endopeptidase	NA	A0A1C8E983	Bacillus_phage	95.3	0.0e+00
WP_000884123.1|5112813_5113497_-	hypothetical protein	NA	A0A1B0T6A0	Bacillus_phage	96.0	2.1e-124
WP_042596345.1|5113497_5116890_-|tail	phage tail tape measure protein	tail	A0A1B0T698	Bacillus_phage	92.2	0.0e+00
WP_000113340.1|5117133_5117520_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	99.2	3.6e-65
WP_000151366.1|5117531_5118167_-	hypothetical protein	NA	A0A1C8E980	Bacillus_phage	99.1	1.6e-115
WP_000157921.1|5118178_5118556_-	hypothetical protein	NA	A0A1C8E995	Bacillus_phage	87.2	2.5e-55
WP_001166633.1|5118555_5118885_-	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	96.3	2.2e-55
WP_001126092.1|5118874_5119207_-	hypothetical protein	NA	A0A1B2APX8	Phage_Wrath	96.4	1.6e-53
WP_001049344.1|5119445_5120750_-|capsid	phage major capsid protein	capsid	A0A2H4JFZ3	uncultured_Caudovirales_phage	91.1	5.5e-198
WP_000687903.1|5120751_5121333_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	96.4	1.4e-97
WP_000603760.1|5121403_5121661_+	hypothetical protein	NA	A0A1C8E966	Bacillus_phage	70.6	2.2e-26
WP_000524246.1|5121829_5123002_-|portal	phage portal protein	portal	A0A1C8E972	Bacillus_phage	99.2	2.7e-220
WP_000587611.1|5123017_5124742_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	94.3	0.0e+00
WP_000113444.1|5124738_5125164_-|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	94.3	5.3e-70
WP_000627440.1|5125637_5125952_-	hypothetical protein	NA	A0A1B0T6C6	Bacillus_phage	89.4	1.4e-46
WP_000074276.1|5125948_5126167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052395.1|5126213_5126411_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	83.1	2.3e-23
WP_000930965.1|5126468_5126693_-	hypothetical protein	NA	H0USV5	Bacillus_phage	91.9	2.3e-32
WP_000895343.1|5126977_5127367_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	61.2	9.9e-39
WP_102981940.1|5127384_5127483_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000847100.1|5127650_5127836_-	hypothetical protein	NA	Q3HKX5	Bacillus_phage	50.0	5.1e-09
WP_001092478.1|5127883_5128171_-	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	92.6	8.9e-45
WP_000726820.1|5128396_5128795_-	hypothetical protein	NA	A0A1B0T6B6	Bacillus_phage	97.0	1.0e-67
WP_000159772.1|5128879_5129626_-	sigma-70 family RNA polymerase sigma factor	NA	Q2I8C6	Bacillus_phage	74.2	8.2e-98
WP_000002743.1|5129622_5129847_-	hypothetical protein	NA	C7DTL1	Bacillus_phage	72.6	4.0e-24
WP_000532218.1|5129846_5130728_-	DNA replication protein	NA	A0A1B1P7U2	Bacillus_phage	32.6	5.2e-27
WP_000040038.1|5130739_5131513_-	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	47.4	4.9e-53
WP_000525424.1|5131645_5132527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372558.1|5132550_5133225_-	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	66.5	4.6e-84
WP_000277642.1|5133438_5133627_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	3.4e-21
WP_000368215.1|5133771_5134017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001236353.1|5134398_5135628_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_000004989.1|5135997_5136327_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	96.3	9.6e-51
WP_000466634.1|5136747_5138001_-	hypothetical protein	NA	H0UST6	Bacillus_phage	98.1	1.7e-212
WP_000896921.1|5138147_5138378_-	hypothetical protein	NA	H0UST5	Bacillus_phage	92.1	3.4e-31
WP_000237488.1|5139342_5140404_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.6	4.6e-171
WP_000833144.1|5140493_5140847_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	41.0	3.5e-14
WP_002083726.1|5140952_5141138_-	methyltransferase	NA	NA	NA	NA	NA
WP_000834610.1|5141540_5142329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042596363.1|5143241_5143805_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
5142442:5142476	attR	TATAAAGTGAAACTTTAATCAGCCCTCACCAATCA	NA	NA	NA	NA
WP_000573830.1|5143911_5144265_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	42.3	8.2e-16
WP_000077409.1|5144306_5145173_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595025.1|5145411_5145651_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682067.1|5146003_5147074_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054092.1|5147307_5147481_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_000470267.1|5147535_5148195_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	1.1e-21
WP_000679259.1|5148178_5148976_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000212735.1|5149197_5149539_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
WP_000622255.1|5149698_5149980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127057683.1|5150050_5150848_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_016078131.1|5151951_5152746_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000248589.1|5152798_5153107_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|5153302_5153539_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125497.1|5153854_5154070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614219.1|5154129_5155131_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_042596371.1|5155251_5155743_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	54.5	3.5e-41
WP_000351142.1|5155766_5156246_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001106085.1|5156407_5157511_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_016078132.1|5157455_5158802_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.0	4.7e-11
WP_000241494.1|5158807_5159920_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
WP_016078133.1|5159916_5160732_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_016078134.1|5161284_5161866_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000276467.1|5161905_5162670_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_000503340.1|5162779_5163412_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000274010.1|5163492_5163933_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000439090.1|5164080_5165052_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_042596374.1|5165069_5165336_+	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_001174583.1|5165709_5166207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435945.1|5166252_5166561_-	YutD family protein	NA	NA	NA	NA	NA
WP_000744127.1|5166679_5167258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178782.1|5167285_5168020_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002083707.1|5168120_5168936_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 15
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	5270073	5368607	5776895	holin,tail,protease,capsid,transposase,integrase,portal,head,tRNA,terminase	Bacillus_phage(81.97%)	102	5360178:5360228	5368836:5368886
WP_001021089.1|5270073_5271336_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	1.5e-88
WP_042596460.1|5271705_5272623_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000573651.1|5273006_5273402_-	SET domain-containing protein	NA	NA	NA	NA	NA
WP_000455073.1|5273598_5275101_-	DUF4077 domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.8	3.5e-07
WP_000714043.1|5275133_5276192_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000039962.1|5276507_5276942_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000568577.1|5276938_5277295_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000980956.1|5277324_5277564_-	DUF3947 family protein	NA	NA	NA	NA	NA
WP_000086300.1|5277643_5277877_-	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_001293768.1|5278036_5279230_-	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	32.6	3.2e-43
WP_042596467.1|5279235_5280783_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.3	4.0e-46
WP_001071085.1|5281219_5281735_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001222628.1|5282020_5282497_+	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_000834707.1|5282545_5282950_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_042596469.1|5284434_5284992_+	cysteine hydrolase	NA	A0A1V0SL12	Klosneuvirus	27.5	1.2e-05
WP_002083675.1|5285028_5285463_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_042596471.1|5285819_5286785_+	DUF4822 domain-containing protein	NA	NA	NA	NA	NA
WP_002008929.1|5287048_5287480_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000926482.1|5287647_5288229_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_042598534.1|5288284_5288734_+	cyanase	NA	NA	NA	NA	NA
WP_042596474.1|5288861_5290142_+	xanthine permease	NA	NA	NA	NA	NA
WP_000576735.1|5290176_5291715_-	anthrolysin O/cereolysin O family cholesterol-dependent cytolysin	NA	NA	NA	NA	NA
WP_000590056.1|5292149_5292902_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000631243.1|5292898_5293963_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000041823.1|5293959_5294976_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	36.8	1.0e-58
WP_016078161.1|5294995_5296015_-	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042596480.1|5296400_5297078_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001123920.1|5297959_5298427_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_042596482.1|5298798_5301237_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
WP_042596484.1|5301729_5302806_+	hypothetical protein	NA	A0A0S2MVF4	Bacillus_phage	38.8	7.6e-12
WP_042596487.1|5302822_5303431_-	hypothetical protein	NA	W8CZ47	Bacillus_phage	100.0	3.3e-113
WP_042596489.1|5303420_5304587_-	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	100.0	8.0e-225
WP_042596490.1|5304597_5304918_-	hypothetical protein	NA	W8CYN5	Bacillus_phage	100.0	7.1e-51
WP_127057661.1|5304937_5305069_-	hypothetical protein	NA	W8CYT8	Bacillus_phage	100.0	6.9e-21
WP_000264500.1|5305392_5305617_+	hypothetical protein	NA	A0A1B1P883	Bacillus_phage	74.3	1.3e-27
WP_042596492.1|5306564_5307266_-	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	92.8	1.6e-124
WP_042596494.1|5307265_5307691_-|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	97.9	1.4e-70
WP_042596496.1|5307765_5307990_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	94.6	1.4e-29
WP_042596497.1|5308113_5312175_-	phage minor structural protein	NA	W8CYT7	Bacillus_phage	100.0	0.0e+00
WP_044798171.1|5312171_5313656_-|tail	phage tail protein	tail	W8CYY9	Bacillus_phage	100.0	4.9e-296
WP_000108316.1|5316218_5318024_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.1	5.5e-31
WP_000344049.1|5320211_5320388_-	hypothetical protein	NA	W8CYG0	Bacillus_phage	100.0	6.7e-27
WP_042597911.1|5320417_5320735_-	hypothetical protein	NA	A0A0S2GLH2	Bacillus_phage	98.1	1.7e-52
WP_042597910.1|5320781_5321387_-|tail	tail protein	tail	W8CYT6	Bacillus_phage	98.0	9.6e-97
WP_030022312.1|5321387_5321747_-	DUF3168 domain-containing protein	NA	W8CYY6	Bacillus_phage	100.0	5.9e-62
WP_000763219.1|5321743_5322178_-	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	100.0	1.8e-76
WP_042597906.1|5322170_5322494_-|head	phage head closure protein	head	W8CYF9	Bacillus_phage	98.1	1.3e-55
WP_006919625.1|5322480_5322768_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	97.9	1.2e-44
WP_016097358.1|5322788_5323955_-|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	96.9	1.8e-208
WP_042597903.1|5323992_5324703_-|protease	Clp protease ClpP	protease	H0USW5	Bacillus_phage	99.2	2.7e-127
WP_062804419.1|5324689_5325943_-|portal	phage portal protein	portal	H0USW4	Bacillus_phage	99.5	2.2e-241
WP_000499525.1|5326239_5327436_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_042597899.1|5327807_5329502_-|terminase	terminase large subunit	terminase	H0USW3	Bacillus_phage	99.3	0.0e+00
WP_062804420.1|5329503_5330007_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	6.7e-88
WP_044798176.1|5330115_5330514_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	96.8	2.3e-67
WP_042597896.1|5330503_5330758_-	hypothetical protein	NA	W8CYT4	Bacillus_phage	100.0	1.5e-43
WP_000773601.1|5330892_5331105_-	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_044798177.1|5331121_5331361_-	hypothetical protein	NA	W8CZ42	Bacillus_phage	100.0	8.3e-20
WP_044798178.1|5331377_5331575_-	hypothetical protein	NA	W8CYF7	Bacillus_phage	100.0	9.8e-27
WP_044798179.1|5331620_5331848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000017440.1|5331884_5332172_-	hypothetical protein	NA	H0USV6	Bacillus_phage	91.6	1.7e-43
WP_002179614.1|5332574_5332820_-	hypothetical protein	NA	W8CYG8	Bacillus_phage	100.0	6.9e-38
WP_042596530.1|5333026_5333569_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	100.0	8.6e-97
WP_042596531.1|5333565_5334051_-	ArpU family transcriptional regulator	NA	W8CYU4	Bacillus_phage	100.0	1.0e-85
WP_000965619.1|5334408_5334690_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000404183.1|5336107_5336506_-	hypothetical protein	NA	W8CYU3	Bacillus_phage	100.0	1.7e-70
WP_042596535.1|5336859_5337159_-	hypothetical protein	NA	W8CZ51	Bacillus_phage	100.0	7.9e-52
WP_000705116.1|5337309_5337609_+	hypothetical protein	NA	W8CYG6	Bacillus_phage	100.0	1.1e-50
WP_042596537.1|5337605_5337821_-	aspartate ammonia-lyase	NA	W8CYN9	Bacillus_phage	100.0	1.1e-36
WP_000817807.1|5337838_5338003_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_000436950.1|5338074_5338341_-	hypothetical protein	NA	W8CYZ5	Bacillus_phage	100.0	2.7e-43
WP_000705175.1|5338382_5339195_-	hypothetical protein	NA	W8CZ50	Bacillus_phage	100.0	1.6e-155
WP_042596539.1|5339157_5340174_-	hypothetical protein	NA	W8CYG5	Bacillus_phage	100.0	3.8e-191
WP_042596541.1|5340419_5341067_-	sigma-70 family RNA polymerase sigma factor	NA	W8CYN8	Bacillus_phage	100.0	2.3e-117
WP_042596543.1|5341341_5341656_-	hypothetical protein	NA	W8CYU1	Bacillus_phage	100.0	9.8e-53
WP_042596545.1|5341819_5342644_-	antirepressor	NA	A0A0S2MV65	Bacillus_phage	77.0	1.9e-116
WP_042596547.1|5342861_5343050_-	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	100.0	2.5e-27
WP_000813894.1|5343082_5343319_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	100.0	4.3e-37
WP_000511081.1|5343467_5343812_+	helix-turn-helix transcriptional regulator	NA	W8CZ48	Bacillus_phage	100.0	1.9e-57
WP_042596549.1|5344212_5345451_-	hypothetical protein	NA	W8CYT9	Bacillus_phage	100.0	3.1e-235
WP_042596551.1|5346434_5347496_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	75.9	5.9e-158
WP_000976874.1|5347557_5348301_-	carboxylesterase	NA	NA	NA	NA	NA
WP_042596553.1|5348459_5348693_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000078304.1|5348787_5349480_-	LrgB family protein	NA	NA	NA	NA	NA
WP_000673222.1|5349476_5349845_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_001125040.1|5350197_5351148_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000103951.1|5351198_5352494_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	1.1e-182
WP_001231141.1|5352524_5354054_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001231042.1|5354050_5354806_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001036332.1|5354838_5356023_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000161234.1|5356160_5357165_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001258185.1|5357191_5358220_-	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000869737.1|5358356_5358602_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_000647951.1|5358611_5359919_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
5360178:5360228	attL	ACGCGCCCAGAGGGATTCGAACCCCCGGCAGACGTGGTACCGGAAACCACC	NA	NA	NA	NA
WP_044798180.1|5360568_5361051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798181.1|5362477_5362837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798182.1|5362855_5363461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798184.1|5363482_5363878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798185.1|5363877_5364144_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_044798186.1|5366256_5366460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798188.1|5366571_5366844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798191.1|5367626_5368607_-|integrase	tyrosine-type recombinase/integrase	integrase	A7XX23	Thermus_virus	25.9	1.9e-09
5368836:5368886	attR	ACGCGCCCAGAGGGATTCGAACCCCCGGCAGACGTGGTACCGGAAACCACC	NA	NA	NA	NA
>prophage 16
NZ_CP014847	Bacillus thuringiensis strain HD12, complete sequence	5776895	5384941	5458076	5776895	holin,tail,head,protease,capsid,transposase,portal,bacteriocin,terminase	Bacillus_phage(56.0%)	80	NA	NA
WP_001267311.1|5384941_5385322_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000394721.1|5385433_5385886_-	DUF4275 family protein	NA	NA	NA	NA	NA
WP_000045589.1|5385945_5388822_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
WP_000400993.1|5388827_5390804_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_042596625.1|5390955_5391387_-	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_000025200.1|5391431_5392052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042596627.1|5392048_5392810_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000422656.1|5392909_5393137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538364.1|5393285_5393483_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000438421.1|5393718_5394741_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_001100014.1|5394892_5395786_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	1.9e-08
WP_001219215.1|5395837_5396206_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042596630.1|5396210_5396756_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_000637523.1|5396946_5397258_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000944606.1|5397323_5399039_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.4	5.3e-60
WP_000261257.1|5399265_5400468_-	membrane protein	NA	NA	NA	NA	NA
WP_002083587.1|5400559_5402044_-	PDZ domain-containing protein	NA	A0A0R6PIZ1	Moraxella_phage	27.2	1.9e-21
WP_000645028.1|5402114_5403008_-	cell division ABC transporter permease FtsX	NA	NA	NA	NA	NA
WP_000594331.1|5402997_5403684_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.4	1.5e-26
WP_000727971.1|5403968_5404292_-	cytochrome c-551	NA	NA	NA	NA	NA
WP_097807990.1|5404731_5405830_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_000579374.1|5405974_5408482_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_033669096.1|5408973_5409501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371030.1|5409542_5410181_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	1.3e-27
WP_042598540.1|5410184_5410949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042596633.1|5411020_5411716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000120041.1|5411702_5412491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000767072.1|5412522_5413092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000023375.1|5413209_5413683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000671187.1|5413955_5414498_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001990088.1|5414819_5415017_-	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	67.7	9.8e-19
WP_042596636.1|5415143_5415848_-	ComF family protein	NA	NA	NA	NA	NA
WP_042596638.1|5417016_5417850_+	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	84.0	4.1e-122
WP_042596639.1|5417910_5418249_+	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	99.1	3.7e-50
WP_042596641.1|5418271_5418814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042596643.1|5418865_5419918_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1C8E990	Bacillus_phage	98.9	4.2e-201
WP_042596645.1|5419914_5420145_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	97.4	1.1e-32
WP_042596647.1|5420207_5421476_-	DUF2479 domain-containing protein	NA	A0A1B0T696	Bacillus_phage	79.6	3.7e-191
WP_042596649.1|5421490_5423833_-	endopeptidase	NA	A0A1B1P7P0	Bacillus_phage	98.8	0.0e+00
WP_042596650.1|5423829_5424513_-	hypothetical protein	NA	A0A1C8EA72	Bacillus_phage	99.1	1.4e-128
WP_042596651.1|5424514_5428036_-|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	98.0	0.0e+00
WP_000383689.1|5428052_5428241_-	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	100.0	1.6e-31
WP_042596653.1|5428279_5428666_-	hypothetical protein	NA	A0A1B1P7Q6	Bacillus_phage	97.7	1.0e-64
WP_000151366.1|5428677_5429313_-	hypothetical protein	NA	A0A1C8E980	Bacillus_phage	99.1	1.6e-115
WP_042596400.1|5429324_5429702_-	hypothetical protein	NA	A0A1B1P7P3	Bacillus_phage	97.6	5.6e-63
WP_042596655.1|5429701_5430031_-	hypothetical protein	NA	A0A2H4JFJ3	uncultured_Caudovirales_phage	95.4	1.4e-54
WP_042596657.1|5430020_5430356_-	phage protein	NA	A0A1C8E986	Bacillus_phage	96.3	2.7e-53
WP_042596659.1|5430330_5430591_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	93.0	1.7e-39
WP_042596661.1|5430594_5431968_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	78.3	1.5e-150
WP_042596662.1|5431969_5432548_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	81.5	4.7e-85
WP_001236353.1|5432919_5434149_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_062804421.1|5434264_5435455_-|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	95.1	2.2e-209
WP_042596666.1|5435559_5437284_-|terminase	terminase large subunit	terminase	A0A1B2AQ28	Phage_Wrath	87.3	3.4e-304
WP_042598544.1|5437287_5437671_-	hypothetical protein	NA	A0A2H4J216	uncultured_Caudovirales_phage	68.9	7.5e-23
WP_000872542.1|5437958_5438324_-	HNH endonuclease	NA	A0A2H4JA38	uncultured_Caudovirales_phage	63.6	9.0e-42
WP_042596668.1|5438320_5438608_-	hypothetical protein	NA	A0A1C8EAA0	Bacillus_phage	71.6	5.3e-29
WP_042596670.1|5438604_5438826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042596672.1|5438865_5439069_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	83.1	4.0e-23
WP_042596674.1|5439195_5439591_-	phage protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	83.2	4.1e-56
WP_042596676.1|5439980_5441843_-	DNA primase	NA	A0A1B1P7L5	Bacillus_phage	98.5	0.0e+00
WP_155721732.1|5441879_5442050_-	hypothetical protein	NA	A0A1B1P7M8	Bacillus_phage	98.2	9.3e-26
WP_042596678.1|5442051_5443740_-	DNA polymerase	NA	A0A1B1P7M5	Bacillus_phage	98.6	0.0e+00
WP_042596680.1|5443957_5444449_-	DUF669 domain-containing protein	NA	A0A1B1P7N3	Bacillus_phage	88.3	4.1e-82
WP_033699193.1|5444448_5444790_-	hypothetical protein	NA	A0A1B1P7N6	Bacillus_phage	100.0	7.8e-56
WP_042596681.1|5444792_5446727_-	AAA family ATPase	NA	A0A1B1P7N0	Bacillus_phage	93.8	0.0e+00
WP_042596683.1|5446899_5447178_-	nuclease	NA	A0A1B1P7M6	Bacillus_phage	97.8	7.6e-49
WP_155721733.1|5447174_5447339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042596685.1|5447339_5447654_-	hypothetical protein	NA	A0A1B1P7L0	Bacillus_phage	82.7	1.1e-40
WP_042596686.1|5447646_5448879_-	DEAD/DEAH box helicase	NA	A0A1B1P7L4	Bacillus_phage	99.0	1.1e-235
WP_140161069.1|5448961_5449120_-	hypothetical protein	NA	A0A1B1P7L8	Bacillus_phage	92.3	1.3e-21
WP_001236353.1|5449491_5450721_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_042596688.1|5451027_5451261_-	hypothetical protein	NA	A0A1B1P7N2	Bacillus_phage	70.7	3.5e-23
WP_042596690.1|5451273_5451510_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JE95	uncultured_Caudovirales_phage	94.9	9.0e-35
WP_042596692.1|5451706_5452363_+	helix-turn-helix domain-containing protein	NA	A0A1B1P7L1	Bacillus_phage	92.2	4.2e-114
WP_080775444.1|5452381_5453737_+	recombinase family protein	NA	A0A2H4J992	uncultured_Caudovirales_phage	81.4	1.5e-211
WP_042596693.1|5453769_5454171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000499487.1|5454298_5455726_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	1.3e-11
WP_000400857.1|5455874_5456189_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000684725.1|5456361_5457204_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.3	3.6e-17
WP_000926669.1|5457440_5458076_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.6	8.1e-38
>prophage 1
NZ_CP014849	Bacillus thuringiensis strain HD12 plasmid pHD120038, complete sequence	38333	9910	38207	38333	capsid,terminase,head,protease,transposase,integrase,portal,holin	Bacillus_phage(78.79%)	37	7224:7237	21090:21103
7224:7237	attL	TTATAAATATGATC	NA	NA	NA	NA
WP_000390482.1|9910_10135_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	97.3	8.3e-30
WP_000373913.1|10210_10636_+|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	96.5	1.2e-69
WP_000405778.1|10635_11337_+	N-acetylmuramoyl-L-alanine amidase	NA	W8CZ46	Bacillus_phage	90.3	1.7e-121
WP_000119483.1|11882_12221_-	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	94.6	2.1e-48
WP_000043397.1|12274_12853_-	hypothetical protein	NA	H0USX9	Bacillus_phage	88.0	5.0e-95
WP_001137905.1|12858_13038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000649833.1|13046_13244_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_001257569.1|13426_13744_+	hypothetical protein	NA	H0USY0	Bacillus_phage	98.1	6.4e-52
WP_000170777.1|13740_13923_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_000891536.1|14038_15220_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.7	6.9e-216
WP_000551103.1|15161_15782_+	hypothetical protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_000710531.1|15791_16619_-	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.5	1.8e-101
WP_000237488.1|17000_18062_-|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.6	4.6e-171
WP_000896921.1|19026_19257_+	hypothetical protein	NA	H0UST5	Bacillus_phage	92.1	3.4e-31
WP_000466634.1|19403_20657_+	hypothetical protein	NA	H0UST6	Bacillus_phage	98.1	1.7e-212
WP_000004989.1|21077_21407_-	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	96.3	9.6e-51
21090:21103	attR	GATCATATTTATAA	NA	NA	NA	NA
WP_001236353.1|21776_23006_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_000368215.1|23387_23633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277642.1|23777_23966_+	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	3.4e-21
WP_000372558.1|24179_24854_+	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	66.5	4.6e-84
WP_000040038.1|25890_26664_+	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	47.4	4.9e-53
WP_000532218.1|26675_27557_+	DNA replication protein	NA	A0A1B1P7U2	Bacillus_phage	32.6	5.2e-27
WP_000159772.1|27776_28523_+	sigma-70 family RNA polymerase sigma factor	NA	Q2I8C6	Bacillus_phage	74.2	8.2e-98
WP_000726820.1|28607_29006_+	hypothetical protein	NA	A0A1B0T6B6	Bacillus_phage	97.0	1.0e-67
WP_001092478.1|29230_29518_+	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	92.6	8.9e-45
WP_000847100.1|29565_29751_+	hypothetical protein	NA	Q3HKX5	Bacillus_phage	50.0	5.1e-09
WP_102981940.1|29918_30017_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_000930965.1|30707_30932_+	hypothetical protein	NA	H0USV5	Bacillus_phage	91.9	2.3e-32
WP_000074276.1|31232_31451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804435.1|31470_31761_+	hypothetical protein	NA	A0A1B0T6C6	Bacillus_phage	88.5	1.9e-42
WP_000872554.1|31757_32150_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	96.2	6.9e-72
WP_000113444.1|32230_32656_+|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	94.3	5.3e-70
WP_000524246.1|34388_35561_+|portal	phage portal protein	portal	A0A1C8E972	Bacillus_phage	99.2	2.7e-220
WP_000603760.1|35729_35987_-	hypothetical protein	NA	A0A1C8E966	Bacillus_phage	70.6	2.2e-26
WP_000687903.1|36057_36639_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	96.4	1.4e-97
WP_001049344.1|36640_37945_+|capsid	phage major capsid protein	capsid	A0A2H4JFZ3	uncultured_Caudovirales_phage	91.1	5.5e-198
WP_000342229.1|37946_38207_+	hypothetical protein	NA	A0A1B2APX3	Phage_Wrath	96.5	1.4e-41
>prophage 1
NZ_CP014850	Bacillus thuringiensis strain HD12 plasmid pHD120039, complete sequence	39023	476	38644	39023	capsid,protease,head,tail,terminase,holin,portal	Bacillus_phage(55.56%)	49	NA	NA
WP_081206614.1|476_659_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	65.5	7.9e-15
WP_033698933.1|1280_1715_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	59.4	4.1e-17
WP_016099127.1|1997_2255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033698928.1|2245_2620_+	hypothetical protein	NA	A0A2H4J3C8	uncultured_Caudovirales_phage	39.1	1.6e-06
WP_000666398.1|2585_2921_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	1.6e-53
WP_033698926.1|3424_5080_+|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	96.7	0.0e+00
WP_050428367.1|5145_6252_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	90.1	6.3e-187
WP_000216402.1|6235_7012_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	2.5e-57
WP_033698924.1|7031_8195_+|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	95.9	4.7e-209
WP_033698922.1|8207_8504_+	hypothetical protein	NA	D2XR19	Bacillus_phage	89.6	6.6e-43
WP_033698920.1|8505_8856_+|head	phage head closure protein	head	D2XR20	Bacillus_phage	85.3	2.4e-52
WP_033698918.1|8857_9202_+	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	79.6	2.8e-45
WP_033698916.1|9198_9534_+	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	96.3	5.0e-55
WP_033698914.1|9534_10128_+|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	90.8	2.4e-100
WP_000415932.1|10134_10497_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.8	8.9e-42
WP_000897022.1|10727_11963_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	73.1	6.2e-151
WP_033698912.1|12240_14619_+	membrane protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	47.7	6.5e-48
WP_062804264.1|14660_16130_+|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	79.3	1.1e-234
WP_062804265.1|16126_20971_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	83.9	0.0e+00
WP_033699583.1|20987_21365_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	65.6	2.5e-42
WP_042596564.1|21402_21828_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	90.8	3.6e-66
WP_033699580.1|21827_22784_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	98.4	5.1e-185
WP_000742862.1|23099_23666_-	hypothetical protein	NA	A6XML2	Bacillus_virus	45.7	5.9e-24
WP_001016124.1|23805_24024_+	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	91.7	9.5e-31
WP_000100788.1|24048_24339_+	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	90.7	9.3e-42
WP_033699578.1|24356_25190_-	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	82.7	7.4e-124
WP_033698958.1|25443_26847_-	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	1.5e-113
WP_000289677.1|26990_27209_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033698956.1|27224_27908_-	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	35.1	4.6e-23
WP_000385074.1|28057_28330_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033698954.1|28812_29565_+	antirepressor	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	80.6	1.8e-105
WP_001186272.1|29576_29765_+	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	96.8	6.1e-26
WP_033698952.1|29791_30217_+	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	97.2	6.3e-71
WP_000178948.1|30234_30948_+	hypothetical protein	NA	A0A0S2MV99	Bacillus_phage	98.7	3.6e-127
WP_033698950.1|30947_31163_+	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	98.6	2.5e-31
WP_033698948.1|31095_31434_+	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	98.2	4.0e-52
WP_033698946.1|31527_32481_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	89.9	2.4e-147
WP_033698944.1|32492_32972_+	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	95.0	1.2e-81
WP_000139235.1|32964_33195_+	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	100.0	2.5e-34
WP_001245738.1|33218_33776_+	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	70.8	2.0e-64
WP_033698942.1|33814_34249_+	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	90.3	7.6e-72
WP_001268031.1|34307_34598_+	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	93.8	2.5e-50
WP_001093039.1|34744_35536_+	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_050428366.1|35618_35951_+	DUF1653 domain-containing protein	NA	NA	NA	NA	NA
WP_033698937.1|36272_36968_+	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	81.5	5.4e-112
WP_000590881.1|37007_37319_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	84.5	1.0e-41
WP_000540086.1|37354_37882_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	97.7	4.1e-96
WP_015670520.1|37878_38205_+	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	98.1	4.7e-58
WP_003308641.1|38242_38644_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	99.2	1.1e-67
>prophage 1
NZ_CP014851	Bacillus thuringiensis strain HD12 plasmid pHD120112, complete sequence	112429	39470	75029	112429	transposase	Bacillus_phage(44.44%)	25	NA	NA
WP_000275580.1|39470_40766_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|40755_41508_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_102981899.1|41483_41999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062804462.1|42027_42651_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	32.1	3.6e-14
WP_155721738.1|43724_44681_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	38.7	6.9e-33
WP_062804463.1|45303_47085_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	4.9e-56
WP_062804464.1|47086_48832_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	2.7e-43
WP_062804465.1|49075_50392_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	42.5	1.6e-93
WP_062804466.1|50667_51534_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_062804467.1|51530_52397_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_062804468.1|52640_53714_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_062804469.1|53710_54664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062804470.1|54686_55946_-	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_062804471.1|55947_56955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062804474.1|59406_59901_+	kinase	NA	NA	NA	NA	NA
WP_062804475.1|60624_61800_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_062804476.1|62896_64327_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_001193610.1|64561_65194_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001125133.1|65268_66231_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_001226079.1|66294_66870_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	32.8	4.0e-20
WP_000844996.1|67017_69981_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	40.1	2.6e-211
WP_001053971.1|70182_71619_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_062804477.1|72043_72397_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062804478.1|72398_72839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102981963.1|74240_75029_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP014852	Bacillus thuringiensis strain HD12 plasmid pHD120161, complete sequence	161353	32052	78183	161353	holin,portal,terminase,transposase	Bacillus_phage(58.97%)	58	NA	NA
WP_062804521.1|32052_33957_+	hypothetical protein	NA	A0A2H4J270	uncultured_Caudovirales_phage	33.1	1.9e-10
WP_062804522.1|33969_34350_+	hypothetical protein	NA	G3MAB0	Bacillus_virus	33.3	1.3e-11
WP_062804523.1|34365_35316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000152793.1|35329_35578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804524.1|35740_36934_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_000439586.1|37229_37727_+|holin	holin	holin	A0A0M4R5G6	Bacillus_phage	42.8	1.2e-25
WP_062804525.1|37806_38865_+	SH3 domain-containing protein	NA	A0A1B1P7Q1	Bacillus_phage	75.4	2.6e-150
WP_062804526.1|39215_39422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804527.1|39414_39627_+	hypothetical protein	NA	A0A1Z1LZP5	Bacillus_phage	91.4	6.2e-27
WP_062804528.1|40028_40223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000540832.1|40241_40850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062804529.1|41161_42298_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	41.0	2.1e-73
WP_062804530.1|42294_42540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804531.1|42591_42828_-	hypothetical protein	NA	A0A1B1P789	Bacillus_phage	50.6	1.7e-17
WP_062804532.1|42921_43287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062804533.1|43283_44267_-	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	37.7	5.2e-52
WP_081206626.1|44423_44867_-	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_062804535.1|45290_45500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804536.1|46016_46391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062804537.1|46531_46810_-	hypothetical protein	NA	A0A0S2MVK9	Bacillus_phage	79.1	1.1e-36
WP_062804538.1|47870_48827_-	helix-turn-helix domain-containing protein	NA	A0A2H4IYS0	uncultured_Caudovirales_phage	40.7	1.8e-12
WP_062804539.1|49199_49466_+	hypothetical protein	NA	D2XQ08	Bacillus_virus	78.8	1.9e-33
WP_061663796.1|50043_50640_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_002084061.1|50817_51138_-	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	57.1	3.1e-06
WP_016099414.1|51630_52788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003281825.1|53316_53661_-	helix-turn-helix transcriptional regulator	NA	A0A2R2ZGW9	Clostridioides_phage	27.6	1.3e-05
WP_000667089.1|53883_54087_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061663798.1|54183_54879_+	Rha family transcriptional regulator	NA	A0A0S2MVD8	Bacillus_phage	47.0	5.5e-48
WP_061663800.1|55288_55636_+	hypothetical protein	NA	A0A0S2MVM3	Bacillus_phage	56.5	2.1e-24
WP_061663801.1|55824_56325_+	hypothetical protein	NA	A0A0A7AQW2	Bacillus_phage	73.0	2.2e-62
WP_000139415.1|56293_56710_+	hypothetical protein	NA	A0A0S2MVI0	Bacillus_phage	65.0	6.9e-46
WP_061663802.1|56712_57180_+	hypothetical protein	NA	A0A0S2MVF1	Bacillus_phage	58.7	1.0e-45
WP_061663833.1|57387_57669_+	hypothetical protein	NA	A0A0S2MVD9	Bacillus_phage	56.2	2.8e-19
WP_061663803.1|57665_58115_+	hypothetical protein	NA	A0A0S2MVJ1	Bacillus_phage	78.6	1.5e-67
WP_062804540.1|58111_58693_+	dUTPase	NA	A0A0S2MVD0	Bacillus_phage	88.1	4.1e-97
WP_080451625.1|58705_59263_+	hypothetical protein	NA	A0A0S2MVC3	Bacillus_phage	96.2	2.8e-103
WP_062804541.1|59318_59498_+	hypothetical protein	NA	A0A1B1P8C9	Bacillus_phage	64.4	3.2e-16
WP_016124028.1|59529_59772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804542.1|59820_60300_+	hypothetical protein	NA	A0A1I9S6E8	Bacillus_phage	59.0	2.5e-52
WP_062804543.1|60989_61520_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	82.4	4.6e-79
WP_062804544.1|61519_61858_+	zinc-finger domain-containing protein	NA	A0A0S2MV86	Bacillus_phage	46.2	4.0e-20
WP_062804545.1|62003_62504_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2MVE1	Bacillus_phage	84.2	5.5e-74
WP_001263205.1|62976_63201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804546.1|63690_64095_+	helix-turn-helix domain-containing protein	NA	A0A142F1N8	Bacillus_phage	53.3	8.0e-07
WP_062804547.1|64094_64310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000576168.1|64469_65042_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	48.3	5.4e-41
WP_000390790.1|65093_65273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804548.1|65294_66143_+|terminase	terminase	terminase	A0A0A8WJN3	Clostridium_phage	46.7	3.4e-31
WP_062804549.1|66135_67542_+	DEAD/DEAH box helicase family protein	NA	A0A0A8WEW2	Clostridium_phage	63.7	2.6e-169
WP_001280906.1|67611_69090_+|portal	phage portal protein	portal	A0A222YY66	Streptomyces_phage	26.7	7.1e-45
WP_000496051.1|69203_69722_+	hypothetical protein	NA	Q1WDG7	Streptomyces_phage	35.2	2.2e-09
WP_000540226.1|69835_71035_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	39.3	1.1e-54
WP_000537550.1|71055_72045_+	hypothetical protein	NA	H7BVA6	unidentified_phage	44.8	7.3e-70
WP_081206624.1|72215_72380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062804550.1|72379_72916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042596154.1|73046_75995_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.2	3.2e-81
WP_042596152.1|76037_76583_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	42.1	1.3e-31
WP_001236353.1|76953_78183_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
>prophage 1
NZ_CP014853	Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence	345196	38417	104119	345196	holin,protease,integrase,transposase	Bacillus_phage(42.86%)	46	37852:37869	98391:98408
37852:37869	attL	CGATATATTTAATAATTT	NA	NA	NA	NA
WP_042598641.1|38417_39101_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000566724.1|39867_40413_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001053971.1|40652_42089_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_042597678.1|43370_43853_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_042597676.1|44636_46016_+	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	39.8	2.1e-83
WP_001214984.1|46076_46805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003308690.1|47230_48367_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	39.9	5.8e-71
WP_000756630.1|48363_48606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001155296.1|48701_49076_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	48.4	4.0e-29
WP_001057793.1|49123_49465_-	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	37.5	1.2e-08
WP_000914525.1|51277_51793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043954.1|52282_52555_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	66.7	1.2e-22
WP_003308768.1|52799_52994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843047.1|53331_53610_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	3.0e-13
WP_000476895.1|54217_55861_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001006162.1|56068_57292_+	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	66.6	9.4e-152
WP_000019016.1|57776_58103_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	52.1	1.4e-22
WP_001021547.1|58313_59357_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	22.6	2.0e-09
WP_042597656.1|59588_59939_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_062804555.1|59960_60473_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000107151.1|61746_62979_+	WXG100 family type VII secretion target	NA	A0A2H4J389	uncultured_Caudovirales_phage	58.4	1.7e-63
WP_000551583.1|62991_63447_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000790830.1|63484_63877_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_000773981.1|64359_64854_+	DNA ligase	NA	NA	NA	NA	NA
WP_102981878.1|65155_65575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464269.1|65877_66384_+	hypothetical protein	NA	A0A222YXL7	Bacillus_phage	42.0	6.0e-20
WP_000528740.1|66980_67364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001208694.1|67477_67747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000289206.1|68198_68636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000031290.1|68640_68979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029058.1|69646_70885_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_102981877.1|71299_74569_+	toxin	NA	NA	NA	NA	NA
WP_000071993.1|74596_78214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084207.1|78274_82651_+	toxin	NA	NA	NA	NA	NA
WP_000380669.1|82855_85621_+	toxin	NA	S5W9C6	Leptospira_phage	33.6	1.6e-05
WP_001095852.1|85677_88461_+	toxin	NA	NA	NA	NA	NA
WP_000277805.1|89120_89768_+	S-layer protein	NA	NA	NA	NA	NA
WP_000044003.1|89760_91731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000412998.1|91749_92748_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_155721739.1|95897_96065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062804556.1|96445_97288_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000495520.1|99389_99794_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
98391:98408	attR	AAATTATTAAATATATCG	NA	NA	NA	NA
WP_000980776.1|100809_102297_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	72.0	9.1e-48
WP_000892196.1|102830_103253_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	75.8	3.5e-53
WP_102981879.1|103497_103725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080546909.1|103966_104119_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP014853	Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence	345196	151842	194512	345196	holin,transposase	Bacillus_phage(60.0%)	22	NA	NA
WP_001236353.1|151842_153072_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	48.5	1.7e-84
WP_000405159.1|153529_157024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062804558.1|157489_158608_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.2	3.4e-172
WP_142948921.1|158965_159178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042972943.1|160364_160616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000889412.1|160941_161364_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	77.4	9.1e-54
WP_000598574.1|163213_163618_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_001243453.1|164327_165377_+	Fic family protein	NA	NA	NA	NA	NA
WP_000954718.1|165624_166467_-	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
WP_060852711.1|169992_171126_-	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_000975320.1|171157_172387_-	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_062804560.1|172448_173768_-	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_003308422.1|177427_178423_-	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_001053955.1|179167_180604_-|transposase	IS4-like element IS231A family transposase	transposase	NA	NA	NA	NA
WP_062804561.1|181125_182562_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_003308354.1|183131_183395_-	1-phosphatidylinositol phosphodiesterase	NA	NA	NA	NA	NA
WP_042596018.1|185741_186089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075551.1|186176_187070_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_001043045.1|188110_188365_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	48.9	1.2e-13
WP_000448514.1|188417_188609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003308343.1|191659_191911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000499525.1|193315_194512_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
