The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014856	Lysinibacillus sphaericus III(3)7, complete genome	4663526	142628	151040	4663526		Synechococcus_phage(33.33%)	8	NA	NA
WP_012292017.1|142628_143198_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.3	1.3e-23
WP_012292016.1|143197_144253_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.7	8.6e-61
WP_012292015.1|144346_145771_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	3.4e-52
WP_012292014.1|145746_147981_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.4	1.4e-156
WP_012292013.1|147967_148651_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012292012.1|148653_148902_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_012292011.1|148904_149615_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SS43	Cyanophage	41.0	3.4e-45
WP_012292010.1|149744_151040_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.5	4.7e-16
>prophage 2
NZ_CP014856	Lysinibacillus sphaericus III(3)7, complete genome	4663526	172922	180390	4663526		Bacillus_virus(33.33%)	8	NA	NA
WP_012291991.1|172922_173747_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	3.8e-72
WP_036160402.1|173765_175226_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.7	5.0e-115
WP_012291989.1|175538_175880_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012291988.1|175893_177195_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	40.5	1.8e-68
WP_012291987.1|177261_177762_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.6	3.2e-21
WP_012291986.1|177861_178593_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.6	1.1e-17
WP_012291985.1|178589_179342_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_012291984.1|179415_180390_+	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	51.1	1.1e-86
>prophage 3
NZ_CP014856	Lysinibacillus sphaericus III(3)7, complete genome	4663526	1313103	1374421	4663526	transposase,integrase	Bacillus_phage(54.55%)	38	1317063:1317121	1384337:1384395
WP_139015310.1|1313103_1314455_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	81.8	1.9e-124
WP_036160752.1|1315983_1320855_+	DNRLRE domain-containing protein	NA	I1TLF2	Bacillus_phage	26.6	3.4e-11
1317063:1317121	attL	TATTATGTCTGCGGATGTAAGTCTTTATCTATCTTCAACTAATGATCCAACTCCTATTA	NA	NA	NA	NA
WP_036160758.1|1323035_1325192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012292800.1|1326198_1326399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036160763.1|1327161_1327527_+	hypothetical protein	NA	I1TLF2	Bacillus_phage	45.1	2.3e-05
WP_012292803.1|1327513_1328989_+	DNRLRE domain-containing protein	NA	NA	NA	NA	NA
WP_012292804.1|1328991_1331979_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_012292805.1|1331991_1332360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012292806.1|1333048_1333303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080695165.1|1333387_1333891_+	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_012292809.1|1334068_1334683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139015351.1|1335247_1335673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012292811.1|1335800_1336277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036160766.1|1336948_1337242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139015311.1|1338735_1339053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139015312.1|1339401_1339596_+	hypothetical protein	NA	A0A1P8CWQ3	Bacillus_phage	67.3	2.3e-12
WP_080695166.1|1339547_1339808_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A1P8CWQ3	Bacillus_phage	65.4	2.0e-11
WP_012292817.1|1339849_1340257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139015313.1|1342535_1343414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012292822.1|1343952_1344414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036160769.1|1346318_1346894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036160771.1|1347480_1350093_-	hypothetical protein	NA	A0A0K2CYN4	Paenibacillus_phage	35.9	2.5e-133
WP_012292826.1|1350277_1352626_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	34.3	4.3e-20
WP_012292827.1|1353299_1354733_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_012292828.1|1355974_1356847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012292829.1|1357171_1357609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080695167.1|1357748_1357847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012292831.1|1358714_1360448_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_012292832.1|1361141_1361885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036160776.1|1362513_1362834_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_012292834.1|1362881_1363292_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_139015314.1|1364098_1364509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036160781.1|1364930_1366058_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_012292837.1|1366087_1367488_-	spore germination protein	NA	NA	NA	NA	NA
WP_036160788.1|1369930_1370824_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	25.7	1.4e-19
WP_012292840.1|1370829_1371663_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	26.5	3.0e-16
WP_080695238.1|1372604_1373579_+|integrase	tyrosine-type recombinase/integrase	integrase	W5RV39	Staphylococcus_phage	25.5	1.0e-07
WP_036160791.1|1373584_1374421_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.3	2.3e-24
1384337:1384395	attR	TATTATGTCTGCGGATGTAAGTCTTTATCTATCTTCAACTAATGATCCAACTCCTATTA	NA	NA	NA	NA
>prophage 4
NZ_CP014856	Lysinibacillus sphaericus III(3)7, complete genome	4663526	2065793	2082643	4663526	tail,holin,plate	Clostridium_phage(56.25%)	21	NA	NA
WP_012293468.1|2065793_2066126_+	hypothetical protein	NA	A0A290FZR5	Caldibacillus_phage	33.9	5.2e-12
WP_012293469.1|2066922_2067381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139015320.1|2067352_2067565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012293471.1|2067566_2068889_+	hypothetical protein	NA	X5JAJ1	Clostridium_phage	51.6	2.5e-126
WP_012293472.1|2068904_2069420_+|tail	phage tail tube protein	tail	A0A0A8WJ62	Clostridium_phage	58.4	4.5e-47
WP_012293473.1|2069480_2069915_+	hypothetical protein	NA	X5JAB6	Clostridium_phage	45.9	5.7e-27
WP_008174525.1|2069944_2070109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012293474.1|2070323_2072246_+	hypothetical protein	NA	A0A0A8WJT6	Clostridium_phage	23.8	3.7e-17
WP_036161043.1|2072238_2072922_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A8WFE5	Clostridium_phage	47.9	4.9e-41
WP_139015321.1|2072914_2073877_+	hydrolase	NA	H7BVH4	unidentified_phage	50.6	3.8e-87
WP_012293477.1|2073878_2074193_+	DUF2577 domain-containing protein	NA	A0A0A7RTJ2	Clostridium_phage	30.8	3.9e-09
WP_012293478.1|2074192_2074597_+	DUF2634 domain-containing protein	NA	A0A0A8WFW6	Clostridium_phage	52.8	4.7e-31
WP_012293479.1|2074596_2075682_+|plate	baseplate J/gp47 family protein	plate	A0A0A8WJT7	Clostridium_phage	48.4	1.4e-85
WP_012293480.1|2075674_2076223_+	DUF2313 domain-containing protein	NA	A0A0A8WII4	Clostridium_phage	32.9	2.6e-16
WP_012293481.1|2076222_2077848_+	hypothetical protein	NA	S6B1J7	Thermus_phage	50.7	1.2e-24
WP_012293482.1|2077861_2078281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051563194.1|2078455_2078761_+	hypothetical protein	NA	A0A0H3UZE6	Geobacillus_virus	38.6	1.3e-09
WP_012293484.1|2078773_2079040_+|holin	holin	holin	A0A2H4JAH4	uncultured_Caudovirales_phage	53.6	4.0e-15
WP_012293485.1|2079036_2079759_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A060AC40	Listeria_phage	49.1	2.9e-44
WP_012293486.1|2080188_2081601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012293487.1|2081815_2082643_+	M23 family metallopeptidase	NA	D6QWN5	uncultured_phage	38.4	4.3e-15
>prophage 5
NZ_CP014856	Lysinibacillus sphaericus III(3)7, complete genome	4663526	2983238	3033265	4663526	integrase,transposase,protease,tRNA	Paenibacillus_phage(16.67%)	43	2975966:2975982	3034024:3034040
2975966:2975982	attL	AAAAATCCTCTACCCAA	NA	NA	NA	NA
WP_012294431.1|2983238_2983862_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_036161646.1|2984180_2984603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012294433.1|2984910_2985873_+	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.0	4.7e-13
WP_012294434.1|2985949_2986582_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_081112813.1|2986798_2987170_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012294436.1|2987173_2987500_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	62.3	3.0e-28
WP_080695197.1|2987441_2987609_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_012294438.1|2987712_2988369_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080695198.1|2990018_2990459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012294440.1|2990957_2991938_+	hypothetical protein	NA	A0A2I7SC07	Paenibacillus_phage	28.0	7.6e-19
WP_012294441.1|2992098_2992428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051563241.1|2992452_2992785_+	DUF4288 domain-containing protein	NA	NA	NA	NA	NA
WP_036161659.1|2993815_2994253_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012294444.1|2994249_2995431_+	glucosyltransferase	NA	Q6QXI9	Agrotis_segetum_granulosis_virus	27.0	9.5e-08
WP_031415857.1|2996337_2997360_+	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	26.3	1.3e-16
WP_036161662.1|2997649_2998576_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012294449.1|2999190_3000690_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.2	9.9e-10
WP_139015334.1|3001733_3002882_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012294451.1|3003080_3003221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012294452.1|3003811_3005698_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012294454.1|3006139_3007813_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.5	1.4e-73
WP_036161666.1|3007913_3009089_+	MFS transporter	NA	NA	NA	NA	NA
WP_012294457.1|3009345_3010446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036161669.1|3010453_3012226_+	DNA helicase RecQ	NA	A0A0G2Y8K9	Acanthamoeba_polyphaga_mimivirus	35.4	3.5e-70
WP_012294459.1|3012303_3012825_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_012294460.1|3013001_3013952_+	LCP family protein	NA	NA	NA	NA	NA
WP_012294461.1|3014016_3015216_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_012294462.1|3015694_3016870_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_012294463.1|3017181_3017997_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_031415877.1|3018247_3018568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012294465.1|3018826_3019621_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_012294466.1|3019982_3020858_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_012294467.1|3020910_3021765_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_080695199.1|3021826_3022792_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_012294469.1|3022745_3024233_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_036161672.1|3024311_3024725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012294471.1|3025064_3026027_+	tyrosine recombinase XerC	NA	A0A160DCT0	Gordonia_phage	29.6	8.5e-15
WP_012294472.1|3026080_3026578_+	DinB family protein	NA	NA	NA	NA	NA
WP_004230023.1|3027172_3027322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012294474.1|3027525_3027696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012294475.1|3028073_3029795_+	phosphodiesterase	NA	G3MA91	Bacillus_virus	33.9	2.6e-14
WP_036161675.1|3030127_3031564_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	38.8	4.9e-99
WP_012294477.1|3032095_3033265_-|transposase	transposase	transposase	D2XQ03	Bacillus_virus	49.7	1.8e-96
3034024:3034040	attR	TTGGGTAGAGGATTTTT	NA	NA	NA	NA
>prophage 6
NZ_CP014856	Lysinibacillus sphaericus III(3)7, complete genome	4663526	3243524	3249536	4663526		Pneumococcus_phage(50.0%)	6	NA	NA
WP_012294683.1|3243524_3244064_-	hypothetical protein	NA	E7DND6	Pneumococcus_phage	27.0	1.0e-04
WP_036161829.1|3244109_3244838_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	43.4	4.7e-50
WP_012294685.1|3244830_3245304_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	72.2	3.3e-60
WP_012294686.1|3245306_3245966_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	56.3	6.6e-67
WP_031418567.1|3246085_3246586_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	61.1	4.4e-47
WP_012294688.1|3247181_3249536_+	peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.0	6.4e-72
>prophage 7
NZ_CP014856	Lysinibacillus sphaericus III(3)7, complete genome	4663526	3815849	3889227	4663526	transposase,head,tRNA,coat,tail,holin,plate,capsid,portal,integrase,terminase,protease	Vibrio_phage(18.92%)	88	3854704:3854726	3879726:3879748
WP_080695219.1|3815849_3816092_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0N9SIX5	Staphylococcus_phage	62.9	9.0e-14
WP_012295236.1|3816218_3816443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295237.1|3816458_3817580_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_031417022.1|3817580_3818273_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_012295240.1|3818437_3818797_-	cytochrome c	NA	NA	NA	NA	NA
WP_036162150.1|3819110_3819674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295242.1|3819906_3821034_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	2.4e-37
WP_012295243.1|3821066_3822899_-	DNA primase	NA	A0A1S5RH72	Helicobacter_phage	34.8	6.6e-48
WP_008178459.1|3823106_3823919_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_008178461.1|3823936_3824569_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012295244.1|3825248_3826634_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	31.1	2.2e-48
WP_031417025.1|3826684_3828403_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_036162156.1|3829151_3830555_+	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_036162158.1|3830579_3831368_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_036162160.1|3831559_3832477_-	GTPase Era	NA	NA	NA	NA	NA
WP_008179431.1|3832463_3832877_-	cytidine deaminase	NA	NA	NA	NA	NA
WP_012295251.1|3832942_3833293_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_012295252.1|3833293_3833767_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_012295253.1|3833775_3835896_-	HD family phosphohydrolase	NA	NA	NA	NA	NA
WP_031417032.1|3836119_3837076_-	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.9	3.2e-46
WP_012295255.1|3837078_3838191_-	stage IV sporulation protein	NA	NA	NA	NA	NA
WP_012295256.1|3838192_3838441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295257.1|3838496_3838976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008179446.1|3839001_3840006_-	flotillin-like protein FloA	NA	NA	NA	NA	NA
WP_031417037.1|3840009_3841338_-	membrane protein	NA	NA	NA	NA	NA
WP_004227078.1|3841639_3841813_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_036162163.1|3842322_3843660_+	ATP synthase subunit J	NA	NA	NA	NA	NA
WP_012295261.1|3843686_3844343_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_031417041.1|3844390_3844960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295262.1|3844984_3845248_-|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_036162165.1|3845244_3845469_-|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_012295263.1|3845595_3846267_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_012295264.1|3846791_3847331_-	hypothetical protein	NA	A0A2H4JA12	uncultured_Caudovirales_phage	67.9	2.0e-21
WP_051563278.1|3847331_3847931_-	hypothetical protein	NA	A0A1S5QTS6	Bacillus_phage	48.7	2.0e-46
WP_036162167.1|3847872_3849168_-	cell division protein FtsK	NA	A0A2H4J9G1	uncultured_Caudovirales_phage	57.5	4.7e-133
WP_036162170.1|3849550_3850444_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012295268.1|3850617_3850821_+	helix-turn-helix transcriptional regulator	NA	A0A0A0RVA6	Bacillus_phage	45.5	8.6e-10
WP_012295269.1|3850929_3851400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036162175.1|3851505_3851844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036162852.1|3851837_3852062_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_080695220.1|3852204_3852900_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A060AC40	Listeria_phage	50.3	1.1e-43
WP_012295273.1|3852896_3853286_-|holin	holin	holin	Q8SBN5	Clostridium_phage	52.1	2.9e-22
WP_012295274.1|3853338_3854595_-	DNA (cytosine-5-)-methyltransferase	NA	A0A141E1L1	Streptococcus_phage	60.5	2.4e-134
3854704:3854726	attL	TTCAAATTCCCAAGCGTTTGGGA	NA	NA	NA	NA
WP_012295275.1|3854873_3855314_-	hypothetical protein	NA	S5MUI6	Brevibacillus_phage	29.7	3.0e-07
WP_080695221.1|3855332_3856688_-|tail	phage tail protein	tail	A0A2H4J194	uncultured_Caudovirales_phage	53.4	8.0e-43
WP_012295277.1|3856668_3857316_-|tail	phage tail protein I	tail	A0A059WLJ8	Vibrio_phage	31.1	5.0e-19
WP_012295278.1|3857308_3858439_-|plate	baseplate J/gp47 family protein	plate	A0A067ZJB4	Vibrio_phage	38.8	2.4e-69
WP_036162860.1|3858428_3858713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051563280.1|3858731_3859406_-	SH3 domain-containing protein	NA	A0A067ZI88	Vibrio_phage	40.9	3.6e-20
WP_012295281.1|3859416_3859608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295282.1|3859607_3860624_-	bacteriophage regulatory protein	NA	A0A0C5AJ59	Bacteriophage	33.3	4.2e-44
WP_036162178.1|3860620_3860836_-	hypothetical protein	NA	A0A067ZJB1	Vibrio_phage	37.5	6.1e-06
WP_051563282.1|3860828_3863780_-|tail	phage tail tape measure protein	tail	A0A0N9SJR9	Paenibacillus_phage	62.4	1.7e-98
WP_012295286.1|3863928_3864327_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_012295287.1|3864354_3864876_-|tail	phage major tail tube protein	tail	A0A0E3Y6F4	Fusobacterium_phage	33.5	3.8e-25
WP_036162181.1|3864893_3866324_-	hypothetical protein	NA	A0A0C5AEE8	Bacteriophage	41.5	2.0e-100
WP_012295288.1|3866325_3866631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295289.1|3866620_3867112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295290.1|3867111_3867663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080695222.1|3867675_3868017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295292.1|3868000_3868366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295293.1|3868377_3869403_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	38.1	1.1e-57
WP_012295294.1|3869406_3869772_-|head	head decoration protein	head	NA	NA	NA	NA
WP_012295295.1|3869772_3870840_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	49.0	1.8e-45
WP_012295296.1|3870826_3872404_-|portal	phage portal protein	portal	A0A0C5AJ48	Bacteriophage	58.3	2.4e-155
WP_036162184.1|3872419_3872653_-	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	49.4	1.1e-13
WP_036162186.1|3872628_3874464_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	52.6	3.5e-174
WP_012295298.1|3874423_3875002_-	hypothetical protein	NA	A0A0E3Y4U4	Fusobacterium_phage	28.0	4.2e-09
WP_012295299.1|3875151_3875346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295301.1|3875740_3876322_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	52.1	5.6e-46
WP_012295302.1|3876318_3876786_-	hypothetical protein	NA	A0A1B1P7B2	Bacillus_phage	36.2	5.4e-15
WP_012295303.1|3876791_3877127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295304.1|3877221_3877380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295306.1|3877762_3878482_-	hypothetical protein	NA	A0A068EMK6	Bacillus_phage	30.7	3.9e-20
WP_012295307.1|3878556_3878925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295308.1|3878914_3879121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295309.1|3879120_3879978_-	DUF3102 domain-containing protein	NA	A0A2H4J025	uncultured_Caudovirales_phage	45.6	3.3e-18
3879726:3879748	attR	TCCCAAACGCTTGGGAATTTGAA	NA	NA	NA	NA
WP_012295310.1|3879974_3881516_-	hypothetical protein	NA	A0A0E3XCJ0	Enterococcus_phage	32.8	6.4e-12
WP_051563285.1|3881528_3882002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295313.1|3881976_3882909_-	hypothetical protein	NA	Q0SPI6	Clostridium_phage	37.9	1.0e-33
WP_012295314.1|3883196_3883547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012295315.1|3883540_3883714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155726286.1|3883968_3884124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051563287.1|3884310_3884676_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WJK5	Clostridium_phage	43.4	1.2e-17
WP_036162189.1|3884721_3885084_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WJK5	Clostridium_phage	33.0	8.2e-11
WP_036162191.1|3885091_3885271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139015344.1|3885760_3887674_+	recombinase family protein	NA	A0A0A7RUB1	Clostridium_phage	49.7	1.0e-144
WP_036162193.1|3887877_3889227_+|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP014856	Lysinibacillus sphaericus III(3)7, complete genome	4663526	4327000	4336336	4663526	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
WP_036162332.1|4327000_4328182_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	21.6	2.5e-08
WP_012295731.1|4328326_4330744_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.8	0.0e+00
WP_031416439.1|4331105_4332848_-	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.1	5.8e-46
WP_012295733.1|4332905_4333253_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_036162335.1|4333399_4334578_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	49.2	5.8e-106
WP_031416441.1|4334804_4335761_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	75.2	5.1e-60
WP_012295735.1|4335757_4336336_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	49.5	2.9e-42
