The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014696	Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 chromosome, complete genome	5284734	271725	330297	5284734	portal,plate,integrase,protease,terminase,tRNA	Salmonella_phage(42.31%)	60	271633:271651	286451:286469
271633:271651	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_072500801.1|271725_272706_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.1	2.9e-95
WP_004201298.1|272849_274844_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_004201301.1|274868_275459_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.2	3.3e-41
WP_004201303.1|275554_275776_+	regulator for prophage	NA	NA	NA	NA	NA
WP_004201304.1|275808_276318_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	87.6	2.2e-78
WP_004201305.1|276325_276511_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	77.0	1.2e-21
WP_004201306.1|276489_276831_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	83.2	8.7e-47
WP_004201308.1|276898_277135_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	61.9	3.7e-12
WP_004201309.1|277134_277341_+	hypothetical protein	NA	A0A1S6L007	Salmonella_phage	78.0	1.0e-13
WP_004201312.1|279239_279887_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_071592519.1|279883_280330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201314.1|280356_281379_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.1	2.3e-175
WP_131404997.1|281378_282254_-|terminase	terminase-like protein	terminase	A0A1S6KZW3	Salmonella_phage	91.1	1.8e-157
WP_004201316.1|282452_283655_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_004201317.1|283730_284303_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	2.1e-77
WP_004201318.1|284299_284662_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	83.1	1.1e-47
WP_004201321.1|284648_285155_+|plate	baseplate J/gp47 family protein	plate	E5G6N8	Salmonella_phage	68.1	5.6e-50
WP_032425742.1|286484_286622_+	hypothetical protein	NA	NA	NA	NA	NA
286451:286469	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_004179131.1|286599_288285_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_004201325.1|288552_288936_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_002896352.1|288942_289206_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_004201326.1|289408_289696_+	YbjC family protein	NA	NA	NA	NA	NA
WP_004201327.1|289679_290402_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_004201328.1|290516_291419_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	9.1e-35
WP_002896365.1|291507_291987_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_004201329.1|292335_293448_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_004201330.1|293609_294743_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_004201331.1|294753_295707_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896372.1|295703_296549_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_004201332.1|296606_297095_+	DUF2593 family protein	NA	NA	NA	NA	NA
WP_004201333.1|297136_298264_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	26.5	2.7e-20
WP_004201334.1|298342_299059_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	6.1e-34
WP_004201335.1|299055_300528_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	3.9e-27
WP_004201336.1|300611_301343_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004201338.1|301527_302196_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_004201339.1|302195_302912_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_002896390.1|302918_303650_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004201340.1|303670_304399_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	2.7e-29
WP_004201341.1|304625_305141_-	lipoprotein	NA	NA	NA	NA	NA
WP_004201342.1|305391_305664_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004201344.1|306023_307163_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004201345.1|307194_308025_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.5	1.8e-05
WP_002896399.1|308021_309035_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004201346.1|309122_310565_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004201348.1|310575_311577_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_004201349.1|311615_313334_-	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_004201350.1|313485_313920_+	DoxX family protein	NA	NA	NA	NA	NA
WP_004201351.1|314126_315095_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_004201352.1|315105_316758_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_004201354.1|316901_317801_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_004201355.1|317915_318611_-	aquaporin Z	NA	NA	NA	NA	NA
WP_004201356.1|319030_320689_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_004201357.1|320835_321951_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004201358.1|321947_323888_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.4e-37
WP_002896516.1|323964_324186_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|324511_324829_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_004201360.1|324859_327139_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	2.8e-165
WP_001040187.1|327262_327481_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004201362.1|327831_328536_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004201363.1|328575_330297_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.5	1.7e-13
>prophage 2
NZ_CP014696	Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 chromosome, complete genome	5284734	421004	498430	5284734	portal,plate,tail,integrase,terminase,protease,head,capsid	Enterobacteria_phage(37.14%)	81	417686:417703	504817:504834
417686:417703	attL	AAGGTCAGCAGCACGCCG	NA	NA	NA	NA
WP_002898458.1|421004_421664_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
WP_032425745.1|421932_423585_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004201449.1|424093_426520_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	45.3	4.2e-10
WP_004201450.1|426584_426926_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_004201452.1|426969_428505_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_004201453.1|428905_429922_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004201454.1|429943_431518_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_004201455.1|431519_432548_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	37.2	2.3e-18
WP_032425746.1|432792_433692_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	5.2e-14
WP_004201457.1|433709_434543_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004201458.1|434804_435572_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_004201460.1|435585_435927_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_004201461.1|435942_436818_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_004201462.1|436783_439081_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	46.2	1.0e-05
WP_004201463.1|439131_439452_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_004201464.1|439472_440549_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_004201465.1|440858_443360_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	1.1e-10
WP_004201466.1|443397_444363_-	oxidoreductase	NA	NA	NA	NA	NA
WP_004201467.1|444419_445868_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004201468.1|445886_447011_-	ring-hydroxylating oxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004201469.1|447047_448655_-	BCCT family transporter	NA	NA	NA	NA	NA
WP_004201471.1|449177_450263_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_008805923.1|450345_451308_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004201473.1|451304_452585_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_004201474.1|452587_454075_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_002898590.1|454396_454954_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_025999163.1|454979_455732_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_002898595.1|455957_457379_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_004201476.1|457732_459124_+	APC family permease	NA	NA	NA	NA	NA
WP_002898600.1|459242_459365_-	small membrane protein	NA	NA	NA	NA	NA
WP_004201478.1|459621_459843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201480.1|459862_460651_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004201482.1|460766_461216_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004201483.1|461368_462616_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_004201484.1|462711_463719_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	52.5	4.5e-99
WP_004201485.1|463806_464109_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	61.0	2.6e-26
WP_004201487.1|464203_464536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085956521.1|464745_464925_+	DUF4761 domain-containing protein	NA	NA	NA	NA	NA
WP_004201494.1|464936_465176_+	DUF4754 family protein	NA	NA	NA	NA	NA
WP_032425755.1|465178_465451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425756.1|465519_465744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201497.1|465740_466322_+	3'-5' exoribonuclease	NA	A0A1Q1PW66	Pseudoalteromonas_phage	37.3	9.1e-28
WP_004201498.1|466330_467299_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	50.8	9.3e-78
WP_166742614.1|467285_467459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158513515.1|467469_467622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279597.1|467644_467806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101516551.1|467782_468058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201500.1|468158_470774_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	53.3	4.4e-199
WP_032425748.1|470986_471721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201502.1|472178_473231_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.0	2.1e-139
WP_004201504.1|475110_475944_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.1	5.5e-95
WP_004201505.1|475968_477018_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.8	4.4e-105
WP_004201506.1|477065_477980_+|terminase	phage terminase endonuclease small subunit M	terminase	B9A7B6	Serratia_phage	74.1	4.4e-85
WP_004201507.1|478082_478580_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	70.3	7.7e-60
WP_004201508.1|478579_478780_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	66.2	6.7e-15
WP_004201509.1|478770_479052_+	hypothetical protein	NA	B9A7B8	Serratia_phage	58.4	6.3e-19
WP_004201510.1|479048_479600_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	40.8	1.7e-28
WP_004201511.1|479596_479992_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_004201512.1|480136_480595_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.7	2.3e-34
WP_004201513.1|480591_481233_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	48.0	1.2e-44
WP_004201514.1|481232_481817_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	61.2	3.0e-63
WP_004201515.1|481813_482182_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	56.5	2.0e-28
WP_004201516.1|482168_483068_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	61.2	3.1e-91
WP_004201517.1|483060_483657_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	42.4	4.3e-41
WP_158513516.1|483661_486031_+	hypothetical protein	NA	A0A1U9WR19	Escherichia_phage	47.1	2.3e-08
WP_004204482.1|486033_486297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204483.1|486483_487665_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	53.1	6.1e-47
WP_004204484.1|487764_488619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004204486.1|488892_489381_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	59.9	2.0e-52
WP_050558924.1|489392_492329_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	45.1	5.3e-209
WP_104976625.1|492318_492495_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	69.0	2.3e-11
WP_004204489.1|492491_492791_-	hypothetical protein	NA	B9A7B2	Serratia_phage	77.1	5.3e-32
WP_004204490.1|492845_493361_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	71.2	2.4e-64
WP_004204491.1|493360_494542_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	69.8	1.2e-156
WP_004204492.1|494695_495850_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	81.2	3.8e-179
WP_004204493.1|495894_496143_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_004204495.1|496419_496806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004204496.1|496975_497203_-	YccJ family protein	NA	NA	NA	NA	NA
WP_002898704.1|497223_497820_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_004204497.1|497947_498169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898708.1|498256_498430_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
504817:504834	attR	AAGGTCAGCAGCACGCCG	NA	NA	NA	NA
>prophage 3
NZ_CP014696	Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 chromosome, complete genome	5284734	614724	659227	5284734	holin,portal,tail,integrase,terminase,head,protease,capsid,tRNA	Klebsiella_phage(37.78%)	57	604278:604292	640440:640454
604278:604292	attL	TGGCGCCGCCCATCA	NA	NA	NA	NA
WP_004150803.1|614724_615831_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004206639.1|615887_616346_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004206640.1|616362_617013_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004206641.1|617253_618504_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_004206642.1|618616_619759_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	81.1	2.5e-170
WP_000089156.1|619748_619985_-	excisionase	NA	NA	NA	NA	NA
WP_071592590.1|620014_620287_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	47.1	1.7e-13
WP_004206644.1|620283_620562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206647.1|620554_620779_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	48.5	7.0e-13
WP_004206648.1|620775_621258_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.2	4.2e-71
WP_004206649.1|621250_621595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206650.1|621722_622508_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	49.8	4.2e-60
WP_004206651.1|622507_622807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206652.1|623169_623865_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
WP_001191665.1|623962_624205_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_004206654.1|624239_624701_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	6.4e-69
WP_023317571.1|624938_625151_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	72.7	2.2e-16
WP_004206655.1|625107_626022_+	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	57.1	1.1e-30
WP_004206656.1|626018_626828_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	1.6e-110
WP_004206657.1|626837_627215_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	6.7e-48
WP_061883672.1|627227_628208_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	67.5	7.1e-134
WP_004206703.1|628221_628800_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	3.8e-50
WP_004206702.1|629147_629558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206701.1|629554_630127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024176410.1|630310_630610_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_004206700.1|630606_631146_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	99.4	5.1e-102
WP_004206698.1|631142_631490_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	70.4	3.5e-35
WP_004206697.1|631486_631762_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	65.2	9.2e-23
WP_032426238.1|631712_631904_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	85.7	1.0e-20
WP_004206693.1|632645_633080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032426237.1|633202_633553_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.1	2.3e-50
WP_004206690.1|633710_634208_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.0	1.9e-63
WP_004206689.1|634211_635963_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	72.2	5.2e-252
WP_000923127.1|636110_637337_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	2.5e-208
WP_000999827.1|637329_637929_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_004206688.1|637938_639177_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	8.9e-158
WP_004206686.1|639254_639572_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	2.4e-22
WP_004206685.1|639641_639854_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	74.3	1.1e-15
WP_038433273.1|639855_640188_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	99.1	2.0e-56
WP_061883673.1|640180_640720_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	95.5	1.1e-91
640440:640454	attR	TGATGGGCGGCGCCA	NA	NA	NA	NA
WP_004206707.1|640716_641082_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	92.6	2.3e-61
WP_061883674.1|641138_641630_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	99.4	5.0e-88
WP_001177591.1|641673_642027_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_001333686.1|642059_642323_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	98.9	6.9e-44
WP_061883675.1|642811_645235_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	79.9	0.0e+00
WP_004207036.1|645234_645705_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.7	8.3e-64
WP_023317177.1|645701_646184_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	90.6	7.2e-79
WP_004207032.1|646194_646575_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	92.9	1.7e-67
WP_061883676.1|646571_649640_+	kinase	NA	A0A286S259	Klebsiella_phage	90.9	0.0e+00
WP_061883677.1|649696_652168_+	hypothetical protein	NA	J7HXC9	Pseudomonas_phage	33.9	2.0e-15
WP_004203698.1|652170_652434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004203699.1|652515_653358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110028628.1|653521_653719_+	helix-turn-helix domain-containing protein	NA	A0A286S1P7	Klebsiella_phage	83.7	1.2e-16
WP_002901812.1|653940_654360_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004203700.1|654361_655627_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.9	5.6e-208
WP_004203702.1|657493_658171_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	3.7e-81
WP_071592550.1|658417_659227_+	chaperonin	NA	A0A0F7L9X0	Escherichia_phage	82.9	7.9e-139
>prophage 4
NZ_CP014696	Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 chromosome, complete genome	5284734	1079061	1089947	5284734		Escherichia_phage(87.5%)	9	NA	NA
WP_004206001.1|1079061_1079682_-	aldolase	NA	A0A077SK32	Escherichia_phage	94.7	1.0e-109
WP_004206000.1|1079674_1080940_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	92.2	1.0e-217
WP_004205998.1|1080951_1081854_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	97.7	1.8e-155
WP_004205996.1|1082114_1082876_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	98.4	2.0e-131
WP_004205995.1|1082896_1083757_-	class A broad-spectrum beta-lactamase OKP-B-6	NA	A0A077SL40	Escherichia_phage	89.2	6.2e-142
WP_004205993.1|1084053_1084314_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004205990.1|1084400_1085489_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	96.7	1.9e-204
WP_004205989.1|1085519_1086785_-	MFS transporter	NA	NA	NA	NA	NA
WP_004205988.1|1086839_1089947_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
>prophage 5
NZ_CP014696	Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 chromosome, complete genome	5284734	1998308	2013553	5284734		Bacillus_phage(18.18%)	12	NA	NA
WP_012967600.1|1998308_1999691_-	O9 family phosphomannomutase RfbK2	NA	A0A127AWJ1	Bacillus_phage	25.8	4.2e-31
WP_004180506.1|1999714_2001130_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_004206790.1|2002204_2003209_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	6.8e-31
WP_000429184.1|2003608_2003731_+	small membrane protein	NA	NA	NA	NA	NA
WP_004206789.1|2004153_2005320_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004206788.1|2005500_2006055_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.8	1.0e-52
WP_004206787.1|2006069_2006960_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.2	3.7e-28
WP_000676431.1|2006991_2007861_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	9.8e-111
WP_004206786.1|2007887_2008952_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.6e-105
WP_061883680.1|2009110_2010481_-	O9 family phosphomannomutase RfbK1	NA	A0A127AWJ1	Bacillus_phage	26.0	8.4e-32
WP_012967599.1|2010504_2011920_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	3.1e-53
WP_004201522.1|2012146_2013553_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	3.6e-38
>prophage 6
NZ_CP014696	Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 chromosome, complete genome	5284734	2055545	2062468	5284734	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004201557.1|2055545_2057042_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	6.6e-30
WP_004201558.1|2057038_2057761_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004201559.1|2058079_2059441_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.2	1.5e-206
WP_017899357.1|2059683_2060580_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.3	1.8e-14
WP_004180550.1|2060820_2061594_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004175147.1|2061604_2062468_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 7
NZ_CP014696	Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 chromosome, complete genome	5284734	2272987	2342708	5284734	holin,portal,tail,head,protease,terminase,integrase,capsid,tRNA	Klebsiella_phage(34.69%)	83	2295714:2295738	2338168:2338192
WP_004201775.1|2272987_2273800_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_004201776.1|2273799_2274813_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004201779.1|2274876_2276013_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	1.6e-20
WP_017899511.1|2276123_2277101_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_004201783.1|2277187_2278363_-	MFS transporter	NA	NA	NA	NA	NA
WP_002913291.1|2278572_2279793_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_004201784.1|2279951_2281940_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_004201785.1|2282001_2282283_-	YfcL family protein	NA	NA	NA	NA	NA
WP_004201786.1|2282314_2282863_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_004201787.1|2282862_2283672_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_004201788.1|2283671_2284496_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_004201789.1|2284498_2285584_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.4	1.0e-88
WP_004201790.1|2285626_2286559_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004201792.1|2286726_2287278_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_004201794.1|2287297_2287783_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_004201795.1|2287992_2290137_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_004201796.1|2290136_2291447_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_004201797.1|2291605_2291890_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_004201798.1|2292263_2293586_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_004201799.1|2293644_2294406_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_004201800.1|2294695_2295625_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	83.7	3.6e-135
2295714:2295738	attL	TGTCCCCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_061128754.1|2296112_2296871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201801.1|2296963_2297332_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.0	8.6e-24
WP_071592526.1|2298292_2298715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_131404998.1|2299096_2299939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201804.1|2300013_2300277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061128757.1|2300279_2302751_-	hypothetical protein	NA	J7HXC9	Pseudomonas_phage	33.9	2.6e-15
WP_061883682.1|2302806_2305875_-	kinase	NA	A0A286S259	Klebsiella_phage	90.5	0.0e+00
WP_004207032.1|2305871_2306252_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	92.9	1.7e-67
WP_004207033.1|2306381_2306651_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_004207034.1|2306631_2307000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004207035.1|2307009_2307492_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	89.4	6.1e-78
WP_032441040.1|2307488_2307959_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.7e-64
WP_008806075.1|2307958_2310406_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	64.3	2.6e-265
WP_061883683.1|2310984_2311248_-	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	95.4	1.1e-41
WP_001177591.1|2311280_2311634_-|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_004104226.1|2311677_2312169_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	99.4	2.5e-87
WP_004886973.1|2312225_2312591_-	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	93.4	7.8e-62
WP_061883684.1|2312587_2313127_-	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	98.9	1.1e-93
WP_004184710.1|2313119_2313452_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	100.0	3.1e-57
WP_004886705.1|2313453_2313651_-	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	96.9	5.4e-25
WP_004886703.1|2313722_2314049_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	72.2	3.6e-42
WP_004886700.1|2314048_2314300_-	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	66.0	5.3e-09
WP_004886697.1|2314342_2315560_-|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	81.4	3.9e-182
WP_032426228.1|2315569_2316418_-|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	85.0	4.6e-129
WP_004886691.1|2316430_2317738_-|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.6	1.0e-212
WP_004886689.1|2317737_2319480_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.6	2.6e-139
WP_004177162.1|2319433_2319898_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	61.4	3.7e-48
WP_004886686.1|2320080_2320422_-	HNH endonuclease	NA	A0A2I6PIG1	Escherichia_phage	73.9	1.0e-47
WP_004104246.1|2320745_2320991_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.4e-35
WP_004886681.1|2321133_2321475_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_032426227.1|2321563_2321761_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	86.0	8.0e-21
WP_004886677.1|2321711_2321987_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	46.1	1.0e-13
WP_004886674.1|2321983_2322331_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	78.3	1.5e-38
WP_004886672.1|2322327_2322867_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	9.7e-101
WP_024176410.1|2322863_2323163_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	83.8	4.5e-39
WP_125330507.1|2323978_2324305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004886669.1|2324572_2325394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004886665.1|2325418_2325904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004886660.1|2325952_2326294_-	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	2.5e-54
WP_061883685.1|2326312_2327293_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.6	4.2e-134
WP_004184734.1|2327305_2327683_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
WP_004202055.1|2327692_2328502_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	2.0e-110
WP_004202054.1|2328498_2329452_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	75.5	2.8e-103
WP_004184738.1|2329441_2329621_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
WP_004202053.1|2329858_2330311_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.2	5.9e-67
WP_004202052.1|2330339_2330603_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	46.6	1.8e-12
WP_004184740.1|2330704_2331181_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	2.0e-12
WP_004202051.1|2331351_2332506_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	28.2	1.5e-34
WP_004202050.1|2332915_2333215_+	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	4.2e-13
WP_004202049.1|2333214_2334000_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.8	1.3e-61
WP_004202047.1|2334127_2334472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202044.1|2334464_2334839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202043.1|2335050_2335689_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	63.1	1.1e-47
WP_004202042.1|2335696_2335885_+	hypothetical protein	NA	G3CFG7	Escherichia_phage	63.0	2.6e-13
WP_032425785.1|2335970_2336330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_131405000.1|2336322_2336643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004202039.1|2336797_2337973_-|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.8	2.8e-201
WP_050558921.1|2338606_2339635_+	MASE4 domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.2	7.7e-06
2338168:2338192	attR	TGTCCCCTTAGTTAAATGGATATAA	NA	NA	NA	NA
WP_050558920.1|2339653_2339944_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_004202038.1|2340062_2340545_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_025999167.1|2340908_2341769_+	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	8.5e-06
WP_004202035.1|2341799_2342708_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	23.8	2.3e-09
>prophage 8
NZ_CP014696	Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 chromosome, complete genome	5284734	2520184	2599235	5284734	lysis,portal,plate,tail,head,terminase,integrase,capsid,tRNA	Salmonella_phage(72.0%)	87	2564737:2564783	2599986:2600032
WP_004201818.1|2520184_2520922_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004201817.1|2521053_2522385_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.6	3.1e-47
WP_002914084.1|2522431_2522815_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_004201816.1|2523126_2523816_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.6	5.5e-56
WP_004201815.1|2523872_2524943_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|2525146_2525572_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_004201814.1|2525641_2526340_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004201813.1|2526374_2529026_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_004201812.1|2529146_2530502_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004201811.1|2530543_2530867_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_004201810.1|2530870_2532169_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004206837.1|2538018_2540592_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_004206838.1|2540720_2541452_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_004206840.1|2541448_2542429_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|2542560_2543298_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|2543569_2543905_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|2544011_2544059_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_004206841.1|2544159_2545320_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_004206842.1|2545316_2546189_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004206843.1|2546251_2547373_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_004206844.1|2547382_2548453_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	1.1e-90
WP_032426247.1|2548795_2549305_+	YfiR family protein	NA	NA	NA	NA	NA
WP_004206845.1|2549297_2550521_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004206846.1|2550534_2551017_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004206847.1|2551025_2552384_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_004206848.1|2552438_2552900_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_032426250.1|2552886_2553027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002914145.1|2553019_2553367_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|2553406_2554174_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|2554205_2554754_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|2554772_2555021_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|2555280_2556645_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|2556808_2557600_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|2557619_2558906_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_004174800.1|2559025_2559616_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|2559740_2560619_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004206849.1|2560705_2562367_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004206850.1|2562513_2562855_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004206851.1|2562924_2563215_-	RnfH family protein	NA	NA	NA	NA	NA
WP_029497287.1|2563204_2563681_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|2563791_2564274_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
2564737:2564783	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004206852.1|2564877_2565249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206853.1|2565306_2565525_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	73.6	1.7e-27
WP_004206854.1|2565591_2566689_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.4	7.9e-174
WP_004206855.1|2566685_2567171_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.0	2.0e-57
WP_072500820.1|2567167_2569561_-|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	39.4	9.0e-106
WP_002896220.1|2569787_2569907_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004206857.1|2569921_2570221_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	2.8e-33
WP_002896201.1|2570273_2570789_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_004206858.1|2570798_2571971_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	92.8	7.3e-210
WP_004206859.1|2572120_2573311_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	52.1	1.6e-50
WP_004206860.1|2573322_2573619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206861.1|2573630_2575955_-	hypothetical protein	NA	K4I6L2	Salmonella_phage	38.5	6.4e-16
WP_004206862.1|2575960_2576557_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	56.4	7.5e-54
WP_004206863.1|2576549_2577458_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.2	1.1e-107
WP_004206864.1|2577444_2577807_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	4.4e-49
WP_004206865.1|2577803_2578376_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	71.7	1.0e-76
WP_050558933.1|2578453_2579344_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	74.2	1.5e-119
WP_004206866.1|2579306_2579753_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.5	4.0e-60
WP_004206867.1|2579745_2580177_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	88.1	1.7e-68
WP_072500821.1|2580139_2580298_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	90.4	1.0e-18
WP_004206869.1|2580272_2580701_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.9	1.5e-56
WP_004206870.1|2580697_2581213_-	lysozyme	NA	E5G6N1	Salmonella_phage	75.3	9.0e-72
WP_014884902.1|2581193_2581409_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
WP_000868184.1|2581412_2581616_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_004206872.1|2581615_2582083_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.1	3.7e-48
WP_004206873.1|2582181_2582835_-|terminase	small terminase subunit	terminase	E5G6M7	Salmonella_phage	56.6	1.8e-56
WP_004206874.1|2582838_2583987_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	68.8	4.6e-132
WP_004206875.1|2584002_2584830_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	57.0	9.1e-74
WP_061883686.1|2584979_2586839_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	81.9	2.9e-301
WP_004206878.1|2586838_2587891_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.3	7.9e-155
WP_004205801.1|2587935_2588274_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_004205800.1|2588273_2589248_-	hypothetical protein	NA	A4PE73	Ralstonia_virus	42.1	1.6e-53
WP_032426145.1|2589701_2590742_+	DUF262 domain-containing protein	NA	A0A193GZU5	Escherichia_phage	28.1	1.0e-05
WP_131405007.1|2590738_2591410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071592577.1|2591448_2591664_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	63.0	5.3e-10
WP_004205798.1|2591981_2592170_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	1.8e-25
WP_004205797.1|2592353_2594762_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.8	0.0e+00
WP_004205795.1|2594742_2595630_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	73.7	2.6e-119
WP_004205794.1|2595626_2595854_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	90.7	1.9e-34
WP_004205793.1|2595853_2596087_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	88.3	4.3e-29
WP_004144796.1|2596154_2596493_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004205792.1|2596456_2596657_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	5.9e-19
WP_004205791.1|2596664_2597174_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.2	1.9e-77
WP_104976623.1|2597275_2597449_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.2	6.2e-25
WP_004151019.1|2597571_2598201_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004205789.1|2598203_2599235_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.1	1.0e-191
2599986:2600032	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 9
NZ_CP014696	Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 chromosome, complete genome	5284734	5084669	5091528	5284734	tRNA,integrase	Moumouvirus(16.67%)	8	5084601:5084614	5089793:5089806
5084601:5084614	attL	CTGCGTCCTGTCTG	NA	NA	NA	NA
WP_004204706.1|5084669_5086055_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|5086100_5086313_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|5086314_5087181_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004202336.1|5087762_5088977_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	53.4	4.7e-127
WP_022064553.1|5089120_5089846_+	hypothetical protein	NA	NA	NA	NA	NA
5089793:5089806	attR	CTGCGTCCTGTCTG	NA	NA	NA	NA
WP_022064554.1|5090073_5090271_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.4	6.6e-07
WP_004202341.1|5090270_5090705_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	57.9	2.9e-31
WP_004202342.1|5090718_5091528_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	42.4	3.1e-26
>prophage 1
NZ_CP014697	Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence	152001	16023	80470	152001	integrase,bacteriocin,transposase	Salmonella_phage(15.38%)	64	17944:17961	87667:87684
WP_004207017.1|16023_19008_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	54.2	3.5e-301
17944:17961	attL	ATTCAGGCATGGTACATC	NA	NA	NA	NA
WP_000732276.1|19251_19527_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522993.1|19554_19962_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000281123.1|20000_21683_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	1.9e-38
WP_001277463.1|21700_22066_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|22062_22299_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_050558936.1|22282_22366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|22469_23174_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001568067.1|23271_23553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|23725_24061_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_040190672.1|24676_24811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072500838.1|24895_25054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152292.1|25104_25962_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|25954_26032_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004199332.1|26248_26527_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_009485932.1|26847_27327_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004152296.1|27667_27946_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004114613.1|29368_29746_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	91.3	1.6e-57
WP_004114612.1|29742_30090_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.5	4.1e-60
WP_004206763.1|31830_32376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152301.1|32590_32938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178053.1|32957_33554_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_004206764.1|33710_34436_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.0	1.6e-05
WP_102001417.1|34479_36981_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_004206766.1|37044_37437_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_032426241.1|37870_38350_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_032426242.1|38387_38918_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	32.6	2.6e-05
WP_004206769.1|39542_40376_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	33.7	2.6e-20
WP_004206770.1|40422_40929_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004206771.1|40997_41246_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004206772.1|41294_41837_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	75.8	1.0e-49
WP_072500839.1|41867_41957_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_032426243.1|42511_42832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206775.1|42866_43121_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	51.3	6.1e-13
WP_004206777.1|43357_43783_-	antirestriction protein	NA	NA	NA	NA	NA
WP_004206779.1|44303_44534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309980.1|44748_45174_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_004206782.1|45173_46445_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	8.6e-156
WP_004206783.1|46523_46775_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_016156495.1|46828_47134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206785.1|48287_49259_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	1.0e-148
WP_000523812.1|49258_50425_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_000200070.1|51175_52186_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	3.0e-87
WP_001515717.1|52882_53623_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_001493056.1|56464_57073_+	type 3 fimbria major subunit MrkA	NA	NA	NA	NA	NA
WP_000820820.1|57266_57968_+	molecular chaperone	NA	NA	NA	NA	NA
WP_004207004.1|57979_60466_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_032426258.1|60456_61431_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001283944.1|61445_62096_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000994520.1|62157_62874_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004207007.1|63015_63600_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_072500841.1|64637_65606_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	2.2e-180
WP_003846917.1|65721_66975_-	lactose permease	NA	NA	NA	NA	NA
WP_004206570.1|71475_73149_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	45.1	7.9e-133
WP_004206571.1|73307_73886_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	37.7	3.9e-23
WP_004206572.1|74061_75267_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_004206574.1|75277_75583_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206575.1|75711_76410_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.9	3.8e-89
WP_004206577.1|76495_76816_+	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	44.8	2.9e-20
WP_004206579.1|76860_78150_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	1.7e-167
WP_004206580.1|78162_78588_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	1.9e-51
WP_072500842.1|78701_78980_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004206581.1|79310_79604_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	1.4e-48
WP_004152282.1|79702_80470_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
87667:87684	attR	GATGTACCATGCCTGAAT	NA	NA	NA	NA
>prophage 2
NZ_CP014697	Klebsiella quasipneumoniae strain ATCC 700603 isolate K6 plasmid pKQPS1, complete sequence	152001	95132	148034	152001	integrase,transposase	Bacillus_phage(25.0%)	53	87708:87736	132752:132780
87708:87736	attL	GGCTTTGTTGAATAAATCAGATTTCGGGT	NA	NA	NA	NA
WP_004206598.1|95132_95933_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.4	2.1e-51
WP_072200967.1|95971_96319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206600.1|96680_97490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206601.1|97486_98407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343464.1|98432_98552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032426215.1|98976_100065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206605.1|100075_101449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206607.1|101633_102962_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_004206608.1|102969_103545_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_001261282.1|104010_104241_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|104237_104654_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|104727_106290_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|106274_107297_+	helicase UvrD	NA	NA	NA	NA	NA
WP_014343466.1|107368_107491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032426221.1|107840_108749_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_004187110.1|108934_109285_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
WP_004187113.1|109432_109864_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|110114_111590_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|111582_112263_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|112452_113838_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_004206613.1|113866_114220_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_001485328.1|114333_115626_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_000574021.1|115636_118783_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.6	8.0e-62
WP_000758228.1|118869_119310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032426217.1|119436_121893_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|121933_122131_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|122164_122902_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|123190_123640_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|123873_125691_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_008322812.1|125690_126587_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|126626_127007_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|127011_127941_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|127995_128676_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|128672_130073_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004118347.1|130288_130723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023280920.1|131755_132724_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	1.1e-182
WP_072202995.1|133174_134143_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	3.8e-172
132752:132780	attR	ACCCGAAATCTGATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_000227969.1|135195_136272_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_004206671.1|137710_138139_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004206670.1|138171_138597_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	6.6e-52
WP_004206668.1|138609_139899_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	3.3e-171
WP_004206667.1|139946_141698_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004206665.1|141715_142078_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004206664.1|142129_142480_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.1e-23
WP_004193994.1|142837_143086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032415728.1|143082_144294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206662.1|144427_144919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206661.1|144979_145183_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004206660.1|145196_145427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|145871_146138_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|146125_146608_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_072500845.1|146902_147871_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	97.8	1.6e-183
WP_086071112.1|147926_148034_+|transposase	transposase domain-containing protein	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	9.7e-13
