The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	0	10856	2367908		Acinetobacter_phage(50.0%)	5	NA	NA
WP_005543414.1|1234_1798_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005543419.1|3460_6070_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.1	3.1e-19
WP_005552058.1|6142_7162_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_005593782.1|7175_8012_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_005538876.1|8249_10856_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	34.8	4.0e-91
>prophage 2
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	38531	41993	2367908		Catovirus(100.0%)	1	NA	NA
WP_005593786.1|38531_41993_-	acyl-[ACP]--phospholipid O-acyltransferase	NA	A0A1V0SBX8	Catovirus	23.4	1.4e-19
>prophage 3
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	46688	49154	2367908		Dickeya_phage(100.0%)	1	NA	NA
WP_005538858.1|46688_49154_-	glycogen/starch/alpha-glucan phosphorylase	NA	A0A140XAG6	Dickeya_phage	50.6	2.1e-17
>prophage 4
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	58224	109396	2367908	integrase,transposase,lysis,protease,tRNA	Vibrio_phage(16.67%)	47	62469:62484	83102:83117
WP_005538838.1|58224_58437_-	hypothetical protein	NA	G9I9L2	Pseudomonas_phage	38.6	8.4e-08
WP_005538841.1|58571_58808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061866516.1|58762_59974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005538140.1|60014_61961_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.9	1.4e-51
WP_005595366.1|62113_62416_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	47.9	2.9e-17
WP_005556438.1|62417_62711_+	putative addiction module antidote protein	NA	NA	NA	NA	NA
62469:62484	attL	AAAATGATGGCAATGT	NA	NA	NA	NA
WP_005538151.1|62747_64100_-	deoxyguanosinetriphosphate triphosphohydrolase family protein	NA	NA	NA	NA	NA
WP_005538152.1|64101_64794_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_005538154.1|64793_65204_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_061866595.1|65779_66781_+|integrase	site-specific integrase	integrase	A0A0M3LRG1	Mannheimia_phage	52.1	7.6e-91
WP_014702205.1|68152_68440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148660545.1|68667_69433_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.2	4.4e-14
WP_005542135.1|69461_70454_-	virulence protein RhuM/Fic/DOC family protein	NA	NA	NA	NA	NA
WP_005542137.1|70637_71342_+	dipeptidase PepE	NA	NA	NA	NA	NA
WP_005542139.1|71425_72883_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_005542140.1|73188_74289_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_005542142.1|74349_76830_+	trimethylamine-N-oxide reductase TorA	NA	NA	NA	NA	NA
WP_005542144.1|76900_77680_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_005542147.1|77909_79367_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_005542149.1|79581_79836_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_005551624.1|80127_80913_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_005542159.1|81073_81466_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_005542161.1|81482_81911_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005551622.1|82152_82749_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005594107.1|82761_84741_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	23.7	4.6e-15
83102:83117	attR	ACATTGCCATCATTTT	NA	NA	NA	NA
WP_005551615.1|84740_88406_-	exodeoxyribonuclease V subunit beta	NA	NA	NA	NA	NA
WP_005551614.1|88476_88833_-	DsrE family protein	NA	NA	NA	NA	NA
WP_005548745.1|89257_89788_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_005542113.1|89930_91715_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_005551610.1|91861_92308_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_005551608.1|92374_92584_-	cold shock domain-containing protein CspD	NA	A0A1J0GVA5	Vibrio_phage	53.1	9.5e-12
WP_005565219.1|92774_92939_-	YoaH family protein	NA	NA	NA	NA	NA
WP_005542108.1|92989_93703_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_005551602.1|93699_94014_-	YqcC family protein	NA	NA	NA	NA	NA
WP_032997062.1|94121_94904_+	Zn-ribbon-containing protein	NA	NA	NA	NA	NA
WP_005551600.1|94912_95752_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.8	1.6e-38
WP_061866517.1|95803_97054_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005542098.1|97046_97643_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_005594094.1|97599_98940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005594724.1|99116_99491_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158512147.1|99487_100294_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.8	1.8e-50
WP_005594911.1|100322_101444_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005544426.1|101817_102816_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005551543.1|102837_103917_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.0	4.4e-28
WP_005544430.1|103919_105614_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005594915.1|105635_106694_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.8	1.3e-27
WP_005553373.1|107452_109396_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.1	7.8e-116
>prophage 5
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	119153	125674	2367908		Bacteriophage(33.33%)	6	NA	NA
WP_005594929.1|119153_121199_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	36.5	9.3e-43
WP_005561556.1|121231_121774_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	1.4e-27
WP_005543083.1|121864_122821_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_005553586.1|122936_123704_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_014702216.1|123707_124580_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_005549113.1|124600_125674_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	49.0	5.6e-92
>prophage 6
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	133523	136187	2367908		Bacillus_virus(100.0%)	1	NA	NA
WP_005540874.1|133523_136187_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	1.8e-107
>prophage 7
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	139268	139556	2367908		Burkholderia_virus(100.0%)	1	NA	NA
WP_005540862.1|139268_139556_-	integration host factor subunit beta	NA	A4JWM7	Burkholderia_virus	40.0	7.9e-09
>prophage 8
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	145661	148436	2367908		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_005554018.1|145661_148436_+	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	23.9	1.0e-07
>prophage 9
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	168053	172246	2367908		Streptococcus_phage(50.0%)	3	NA	NA
WP_005540820.1|168053_169637_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.3	1.0e-28
WP_005594959.1|169993_170821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005540817.1|170908_172246_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	82.5	3.7e-56
>prophage 10
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	182036	187304	2367908		uncultured_Caudovirales_phage(25.0%)	5	NA	NA
WP_005543988.1|182036_183002_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	39.2	1.3e-60
WP_005594970.1|182991_183933_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_005543992.1|183945_184704_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.3	1.8e-12
WP_005543994.1|184810_186343_-	murein DD-endopeptidase MepM	NA	A0A2K9VGT1	Pontimonas_phage	51.3	1.1e-21
WP_005543995.1|186530_187304_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.6	3.1e-15
>prophage 11
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	204903	207065	2367908		Staphylococcus_phage(50.0%)	2	NA	NA
WP_005549736.1|204903_206028_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.0	5.8e-47
WP_005538261.1|206036_207065_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.1	6.8e-18
>prophage 12
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	211865	214562	2367908		Planktothrix_phage(50.0%)	2	NA	NA
WP_005538275.1|211865_212927_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	39.2	2.4e-26
WP_005538277.1|213071_214562_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.7	3.6e-52
>prophage 13
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	226207	226831	2367908		Pithovirus(100.0%)	1	NA	NA
WP_005538309.1|226207_226831_-	energy-coupling factor ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.5	2.8e-11
>prophage 14
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	230915	236164	2367908	tRNA	Bacillus_phage(33.33%)	5	NA	NA
WP_005538326.1|230915_232637_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.3	2.7e-67
WP_005538329.1|232649_233333_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_005573686.1|233416_233578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099308894.1|233570_234599_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	44.1	7.0e-07
WP_005550226.1|234655_236164_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	38.2	9.4e-85
>prophage 15
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	246837	249060	2367908		Ralstonia_phage(100.0%)	1	NA	NA
WP_014702257.1|246837_249060_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.8	3.0e-23
>prophage 16
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	262738	264163	2367908		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_032997085.1|262738_264163_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.7	1.1e-42
>prophage 17
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	272902	275293	2367908		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_061866521.1|272902_275293_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	43.7	1.2e-12
>prophage 18
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	283726	285025	2367908		unidentified_phage(100.0%)	1	NA	NA
WP_005542367.1|283726_285025_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.0	6.1e-24
>prophage 19
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	288520	290269	2367908		Bacillus_phage(100.0%)	1	NA	NA
WP_005542364.1|288520_290269_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.1	2.0e-54
>prophage 20
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	297407	301175	2367908		Bacillus_virus(50.0%)	3	NA	NA
WP_005543822.1|297407_298478_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	1.1e-26
WP_071805317.1|298705_299785_-	selenide, water dikinase SelD	NA	NA	NA	NA	NA
WP_005543814.1|300326_301175_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	24.5	3.4e-07
>prophage 21
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	310482	312975	2367908		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_005543783.1|310482_312975_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.1	1.8e-24
>prophage 22
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	329608	329950	2367908		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_005538694.1|329608_329950_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	46.4	5.0e-26
>prophage 23
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	339399	347236	2367908		Brazilian_cedratvirus(33.33%)	6	NA	NA
WP_005538718.1|339399_340071_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.9	1.1e-16
WP_005538720.1|340060_340552_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_005550639.1|340558_340870_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_005550641.1|341070_341736_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_005538728.1|342065_343100_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	39.4	1.4e-58
WP_014702270.1|343186_347236_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	32.3	1.4e-47
>prophage 24
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	365846	372256	2367908		Vibrio_phage(33.33%)	6	NA	NA
WP_005538768.1|365846_367313_+	PTS transporter subunit EIIBC	NA	A0A2I7SAJ6	Vibrio_phage	44.7	4.8e-09
WP_014702274.1|367844_368015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014702275.1|368011_369928_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.8	2.6e-23
WP_061866522.1|369943_371065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079254138.1|371458_371686_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_005542080.1|371776_372256_+	calcium-binding protein	NA	K4I3B7	Acinetobacter_phage	43.9	3.2e-23
>prophage 25
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	388769	390152	2367908		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_005540201.1|388769_390152_+	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	32.7	2.4e-26
>prophage 26
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	396383	407313	2367908	protease	Bacillus_virus(40.0%)	7	NA	NA
WP_005594265.1|396383_398054_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.9	9.2e-41
WP_005540188.1|398157_399045_-	YadA-like family protein	NA	Q9LA60	Enterobacterial_phage	65.7	2.1e-15
WP_005540185.1|399535_401434_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.4	1.5e-92
WP_005540183.1|402025_404281_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.3	2.8e-85
WP_005540181.1|404564_405176_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_005540177.1|405240_406065_-	OmpA family protein	NA	NA	NA	NA	NA
WP_005540174.1|406254_407313_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.0	2.0e-20
>prophage 27
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	411562	412411	2367908		Streptococcus_phage(100.0%)	1	NA	NA
WP_005551816.1|411562_412411_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.7	1.9e-50
>prophage 28
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	419182	419752	2367908	transposase	Bacillus_phage(100.0%)	3	NA	NA
WP_005551806.1|419182_419377_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	45.7	4.7e-05
WP_005544187.1|419407_419542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005544186.1|419548_419752_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.3	5.0e-10
>prophage 29
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	429207	436054	2367908	tRNA	Phaeocystis_globosa_virus(25.0%)	7	NA	NA
WP_005551875.1|429207_430554_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	R4TVK3	Phaeocystis_globosa_virus	19.8	5.9e-06
WP_005539244.1|430581_431913_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	75.6	6.2e-165
WP_005539248.1|432037_432424_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_005539250.1|432617_433634_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	49.2	2.7e-91
WP_005539253.1|433639_433981_+	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_005539255.1|433987_435277_+	MFS transporter	NA	NA	NA	NA	NA
WP_005539257.1|435409_436054_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	34.1	1.6e-09
>prophage 30
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	439902	445712	2367908		Ostreococcus_lucimarinus_virus(33.33%)	6	NA	NA
WP_005539270.1|439902_441168_+	inorganic phosphate transporter	NA	M4QMY4	Ostreococcus_lucimarinus_virus	35.4	1.6e-61
WP_005539272.1|441236_441848_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_005552685.1|441847_443125_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	50.6	2.1e-93
WP_005540124.1|443186_443813_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_005540122.1|443809_444721_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_005540120.1|444761_445712_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	3.6e-42
>prophage 31
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	449997	451080	2367908		Streptococcus_phage(100.0%)	1	NA	NA
WP_005567583.1|449997_451080_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	45.0	1.5e-84
>prophage 32
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	456104	462548	2367908	tRNA	Salmonella_phage(20.0%)	8	NA	NA
WP_005540098.1|456104_456572_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	55.8	2.7e-46
WP_005540094.1|456639_457401_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-37
WP_005540091.1|457852_458107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005540089.1|458096_458387_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	59.1	6.7e-24
WP_005540087.1|458448_458787_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_005540084.1|459127_459580_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_005540081.1|459750_461139_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	77.0	2.7e-163
WP_005540076.1|461912_462548_+	WYL domain-containing protein	NA	A0A0R6PH67	Moraxella_phage	36.0	1.9e-31
>prophage 33
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	466151	476273	2367908	tRNA	uncultured_Mediterranean_phage(60.0%)	8	NA	NA
WP_005540068.1|466151_467498_+	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	31.8	4.4e-25
WP_005540062.1|468297_468837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005540061.1|468927_470019_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_005540058.1|470062_471199_-	histidinol-phosphate aminotransferase family protein	NA	A0A142C026	Faustovirus	22.9	3.6e-12
WP_005540054.1|471667_472819_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	1.5e-90
WP_005540052.1|473110_473410_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.9	1.4e-08
WP_005540050.1|473440_475291_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_005540048.1|475307_476273_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.0	4.7e-45
>prophage 34
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	483177	484683	2367908		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032997073.1|483177_484683_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.2e-16
>prophage 35
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	492800	500068	2367908		Vibrio_phage(60.0%)	6	NA	NA
WP_005540021.1|492800_493811_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	38.1	4.6e-43
WP_005540019.1|493813_494377_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_005540017.1|494422_497710_-	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	29.4	6.0e-92
WP_005540015.1|497706_498672_-	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	37.7	3.0e-52
WP_005544132.1|499007_499433_+	6-carboxytetrahydropterin synthase QueD	NA	E7DN67	Pneumococcus_phage	41.0	1.4e-22
WP_005551929.1|499438_500068_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A218M2Y8	Acidovorax_phage	36.9	1.3e-11
>prophage 36
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	504097	504580	2367908		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_005544145.1|504097_504580_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	26.8	1.7e-08
>prophage 37
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	509473	512338	2367908	tRNA	Klosneuvirus(100.0%)	1	NA	NA
WP_005552728.1|509473_512338_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.5	8.1e-146
>prophage 38
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	515820	518360	2367908		Cyanophage(33.33%)	4	NA	NA
WP_005541922.1|515820_516738_-	RimK family alpha-L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.2	6.6e-33
WP_005541921.1|516744_517479_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_005550468.1|517605_517869_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	53.2	5.0e-18
WP_005550467.1|518132_518360_-	LacZ protein	NA	L0N6M2	Herpes_simplex_virus	60.7	6.4e-14
>prophage 39
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	526860	527610	2367908		Escherichia_phage(100.0%)	1	NA	NA
WP_014702303.1|526860_527610_-	HTH-type transcriptional regulator UlaR	NA	A0A077SK06	Escherichia_phage	25.1	1.5e-11
>prophage 40
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	535276	537193	2367908		Ralstonia_phage(100.0%)	1	NA	NA
WP_014702275.1|535276_537193_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.8	2.6e-23
>prophage 41
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	549623	550238	2367908		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_005551731.1|549623_550238_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.3	5.1e-13
>prophage 42
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	554509	557974	2367908		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_005551736.1|554509_556411_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.8	2.0e-148
WP_005541126.1|556846_557974_+	molecular chaperone DnaJ	NA	A0A0P0YNN4	Yellowstone_lake_phycodnavirus	31.3	4.1e-24
>prophage 43
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	563341	564040	2367908		Escherichia_phage(100.0%)	1	NA	NA
WP_005541113.1|563341_564040_-	NAD-dependent deacetylase	NA	A0A1C3S788	Escherichia_phage	30.0	2.5e-16
>prophage 44
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	569021	571681	2367908		Cedratvirus(50.0%)	3	NA	NA
WP_005541104.1|569021_570320_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	35.3	4.0e-68
WP_005541102.1|570384_570675_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005541099.1|570697_571681_-	DnaJ domain-containing protein	NA	A0A1V0SIM1	Klosneuvirus	56.1	9.7e-14
>prophage 45
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	575971	577216	2367908		Saccharomonospora_phage(50.0%)	2	NA	NA
WP_005541091.1|575971_576556_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	39.5	5.9e-27
WP_005541088.1|576565_577216_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.6	1.1e-34
>prophage 46
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	581870	582917	2367908		Bacillus_virus(100.0%)	1	NA	NA
WP_005541082.1|581870_582917_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	1.5e-33
>prophage 47
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	586553	590203	2367908		Streptococcus_phage(50.0%)	4	NA	NA
WP_005541077.1|586553_587120_-	hypothetical protein	NA	A0A1X9I5D4	Streptococcus_phage	25.7	1.5e-22
WP_005541075.1|587255_587915_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_005541071.1|588126_588933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005541070.1|589195_590203_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	45.2	1.1e-73
>prophage 48
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	593229	594000	2367908	tRNA	Pandoravirus(100.0%)	1	NA	NA
WP_005541064.1|593229_594000_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	28.7	9.5e-17
>prophage 49
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	599033	604678	2367908		Gordonia_phage(25.0%)	7	NA	NA
WP_005541050.1|599033_600368_+	exodeoxyribonuclease VII large subunit	NA	A0A1B3AYB4	Gordonia_phage	31.5	1.5e-30
WP_005541048.1|600373_601228_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	27.4	1.3e-06
WP_005541046.1|601255_601789_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_005541044.1|601792_602518_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	1.7e-23
WP_005541043.1|602523_603042_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_005541041.1|603022_603598_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_005541038.1|603880_604678_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.8	4.7e-19
>prophage 50
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	610635	616388	2367908		Streptococcus_phage(33.33%)	5	NA	NA
WP_005541018.1|610635_611175_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.1	1.3e-25
WP_005541016.1|611171_611840_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_005541015.1|611904_612630_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	49.5	1.2e-45
WP_005541013.1|612738_614148_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_005541011.1|614534_616388_+	translational GTPase TypA	NA	A0A2K9L2P9	Tupanvirus	39.4	9.0e-21
>prophage 51
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	624050	627016	2367908		Bacillus_virus(50.0%)	3	NA	NA
WP_005548400.1|624050_624887_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.2	6.7e-24
WP_005595003.1|624939_625635_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_005548404.1|625627_627016_-	nicotinate phosphoribosyltransferase	NA	A0A1B0V392	Roseobacter_phage	50.9	7.7e-126
>prophage 52
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	637230	639535	2367908		Brevibacillus_phage(50.0%)	3	NA	NA
WP_005551151.1|637230_638124_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.5	1.2e-31
WP_005544020.1|638126_638567_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005544023.1|638629_639535_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	47.4	1.1e-64
>prophage 53
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	651643	654842	2367908		Vibrio_phage(50.0%)	2	NA	NA
WP_005544083.1|651643_652384_-	pyruvate formate lyase 1-activating protein	NA	M4MAG2	Vibrio_phage	36.7	5.0e-07
WP_005544085.1|652529_654842_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.8	2.8e-165
>prophage 54
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	662451	667469	2367908		Harp_seal_herpesvirus(25.0%)	5	NA	NA
WP_005539650.1|662451_663120_-	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	53.6	5.5e-53
WP_005539658.1|663405_663789_+	autonomous glycyl radical cofactor GrcA	NA	A0A2K9VG12	Escherichia_phage	71.0	1.5e-31
WP_005539660.1|663952_665749_+	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	43.2	1.3e-24
WP_005539663.1|665759_666782_+	signal peptidase I	NA	NA	NA	NA	NA
WP_005539664.1|666788_667469_+	ribonuclease III	NA	A0A1C9C5A7	Heterosigma_akashiwo_virus	33.8	3.5e-23
>prophage 55
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	671592	677861	2367908		Staphylococcus_phage(33.33%)	8	NA	NA
WP_005547235.1|671592_671856_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	53.2	5.5e-17
WP_005539673.1|671810_672179_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_005539760.1|672191_672326_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_005553467.1|672743_674105_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_005539763.1|674115_675216_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	29.8	2.4e-45
WP_005539765.1|675219_676296_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_005539767.1|676342_677098_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005547254.1|677285_677861_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	58.9	2.1e-45
>prophage 56
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	694983	695619	2367908		Indivirus(100.0%)	1	NA	NA
WP_005542805.1|694983_695619_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A1V0SE00	Indivirus	24.4	2.8e-06
>prophage 57
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	703785	730819	2367908	transposase	Bacillus_phage(33.33%)	30	NA	NA
WP_145916689.1|703785_704043_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155719819.1|704024_704501_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.6	1.4e-34
WP_081110847.1|704458_704545_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005540510.1|704640_705795_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.2	5.6e-130
WP_005540508.1|706002_706272_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_005540502.1|706367_707117_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_005594325.1|707169_708876_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_005543706.1|708866_710171_-	isochorismate synthase	NA	NA	NA	NA	NA
WP_005543708.1|710287_711502_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_005543710.1|711622_712354_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_005543712.1|712548_714093_+	sodium/proton antiporter NhaB	NA	NA	NA	NA	NA
WP_005543714.1|714116_714656_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_005543716.1|714698_714845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005543719.1|714855_716286_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_005543722.1|716306_716660_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_005543723.1|716756_717353_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_005543726.1|717442_717886_-	peptidoglycan-binding protein LysM	NA	J9QDY6	Clostridium_phage	46.3	2.0e-06
WP_005543727.1|717980_718808_+	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	37.6	1.5e-31
WP_014702515.1|719009_719801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005543732.1|720211_720856_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	53.1	1.4e-53
WP_005543734.1|720999_723264_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_061866533.1|723872_724856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005555157.1|724863_725925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005543742.1|725921_726677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005555155.1|726678_727956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005543747.1|727945_729334_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_061866534.1|729643_730018_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145916689.1|730059_730317_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155719819.1|730298_730775_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.6	1.4e-34
WP_081110847.1|730732_730819_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 58
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	747055	751664	2367908		Moraxella_phage(50.0%)	2	NA	NA
WP_032997113.1|747055_749470_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	51.5	1.1e-215
WP_005539319.1|749909_751664_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.9	1.5e-33
>prophage 59
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	761986	762832	2367908		Mollivirus(100.0%)	1	NA	NA
WP_061866535.1|761986_762832_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	35.7	3.9e-11
>prophage 60
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	766340	775847	2367908	tRNA	Catovirus(33.33%)	9	NA	NA
WP_005539290.1|766340_767573_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.1	5.7e-104
WP_005539288.1|767592_768249_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_005539285.1|768347_769517_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_005539283.1|769516_769840_-	YbjQ family protein	NA	NA	NA	NA	NA
WP_014702506.1|769878_770472_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A2P1DNP2	Cassava_brown_streak_virus	35.2	7.6e-14
WP_005539279.1|770584_770914_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005538061.1|771506_772451_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_005538058.1|772450_772945_-	signal peptidase II	NA	NA	NA	NA	NA
WP_005538052.1|773024_775847_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	27.6	3.3e-83
>prophage 61
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	785133	798646	2367908	tRNA,transposase	Serratia_phage(28.57%)	12	NA	NA
WP_005538010.1|785133_786081_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	48.9	3.3e-67
WP_005538006.1|786194_787019_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_005538002.1|787159_788197_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_005537998.1|788300_790316_+	NAD-dependent DNA ligase LigA	NA	A0A289ZTZ3	Serratia_phage	49.4	1.6e-140
WP_005537996.1|790384_790963_-	thymidine kinase	NA	A0A1Z1LZ42	Serratia_phage	52.1	4.7e-53
WP_005537993.1|790965_791199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005537989.1|791263_792292_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.5	6.8e-111
WP_005537983.1|792516_792732_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005537969.1|792853_794611_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	32.0	5.5e-44
WP_005537967.1|794686_796537_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.5	7.6e-36
WP_071805258.1|797503_797605_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005544546.1|798424_798646_+|transposase	transposase	transposase	Q716C2	Shigella_phage	55.1	6.7e-16
>prophage 62
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	813921	817347	2367908	tRNA	Streptococcus_phage(50.0%)	3	NA	NA
WP_005539458.1|813921_815313_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	25.5	5.0e-08
WP_061866536.1|815315_816299_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005539460.1|816354_817347_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	3.4e-51
>prophage 63
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	828896	830431	2367908	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_005539502.1|828896_829853_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	30.3	4.7e-05
WP_005539504.1|829918_830431_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.8	4.4e-18
>prophage 64
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	838955	840794	2367908		Dickeya_phage(50.0%)	3	NA	NA
WP_005543582.1|838955_839195_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	58.3	2.3e-06
WP_005543584.1|839223_839472_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_005543586.1|839522_840794_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	47.4	2.3e-92
>prophage 65
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	851985	852270	2367908		Bacillus_phage(100.0%)	1	NA	NA
WP_005595413.1|851985_852270_+	hypothetical protein	NA	A0A1B1P773	Bacillus_phage	43.7	1.0e-08
>prophage 66
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	868482	873399	2367908		Cyanophage(50.0%)	4	NA	NA
WP_032997192.1|868482_869967_+	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	38.4	3.0e-83
WP_005541226.1|870219_870918_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_005541228.1|870930_871389_+	virulence factor	NA	NA	NA	NA	NA
WP_005551473.1|871944_873399_+	decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.1	9.5e-42
>prophage 67
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	881436	882411	2367908		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_005540773.1|881436_882411_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	A0A2H4UV25	Bodo_saltans_virus	28.6	1.5e-06
>prophage 68
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	892094	906419	2367908		Lactococcus_phage(20.0%)	12	NA	NA
WP_005540798.1|892094_894500_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.2	6.6e-64
WP_005540800.1|894496_895234_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_005540804.1|895566_897009_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_005540806.1|897240_898323_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	35.3	1.8e-08
WP_005540807.1|898378_899497_-	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	41.0	2.5e-34
WP_005549026.1|899714_900164_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_005541294.1|900179_900410_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_005549024.1|900422_900749_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_005541284.1|900735_901113_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_005541282.1|901264_901888_-	repressor LexA	NA	A5LH73	Enterobacteria_phage	44.4	2.8e-11
WP_005553653.1|902095_904534_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_005541279.1|904574_906419_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.7	1.1e-26
>prophage 69
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	909871	916229	2367908	tRNA	uncultured_Mediterranean_phage(50.0%)	8	NA	NA
WP_005541270.1|909871_910366_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.5	2.6e-23
WP_005541268.1|910366_911650_-	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_005541265.1|911748_912510_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_005541263.1|912567_912864_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	76.1	1.1e-34
WP_005541261.1|912880_913156_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A0M3LQB1	Mannheimia_phage	75.8	7.3e-36
WP_005541259.1|913272_914640_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_005551449.1|914825_915902_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_032998892.1|915968_916229_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	56.6	2.1e-21
>prophage 70
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	924154	931447	2367908		Tupanvirus(25.0%)	4	NA	NA
WP_014167500.1|924154_925339_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.0	9.8e-13
WP_005543343.1|926032_926986_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	34.4	1.8e-28
WP_005551364.1|927040_929461_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	35.6	2.7e-118
WP_005595387.1|929557_931447_-	DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	36.8	3.5e-89
>prophage 71
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	947512	949372	2367908		Tupanvirus(100.0%)	1	NA	NA
WP_005543542.1|947512_949372_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.8	6.3e-14
>prophage 72
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	970012	972520	2367908		Oenococcus_phage(50.0%)	2	NA	NA
WP_005540426.1|970012_971881_-	SLC13 family permease	NA	Q6A201	Oenococcus_phage	23.5	3.2e-10
WP_005540424.1|971920_972520_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.3	1.3e-24
>prophage 73
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	981496	982216	2367908		Flavobacterium_phage(100.0%)	1	NA	NA
WP_005540404.1|981496_982216_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	43.7	2.8e-26
>prophage 74
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	994874	995435	2367908		Caulobacter_phage(100.0%)	1	NA	NA
WP_005549638.1|994874_995435_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	30.1	3.9e-20
>prophage 75
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1002572	1008584	2367908		Streptococcus_phage(33.33%)	4	NA	NA
WP_005543329.1|1002572_1004675_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.4	1.5e-59
WP_014167500.1|1004738_1005923_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.0	9.8e-13
WP_005594082.1|1005992_1006934_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005594081.1|1007096_1008584_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	2.0e-18
>prophage 76
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1014361	1014883	2367908	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_145916693.1|1014361_1014883_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.0	7.6e-42
>prophage 77
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1020832	1021570	2367908		Vibrio_phage(100.0%)	1	NA	NA
WP_005540527.1|1020832_1021570_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	56.6	2.3e-60
>prophage 78
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1036750	1038367	2367908		Staphylococcus_phage(100.0%)	1	NA	NA
WP_005549983.1|1036750_1038367_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	49.7	6.2e-135
>prophage 79
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1042044	1045126	2367908		Bacillus_phage(50.0%)	3	NA	NA
WP_005541993.1|1042044_1042317_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	60.0	2.5e-20
WP_005562331.1|1042463_1043240_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_005541995.1|1043293_1045126_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	2.1e-131
>prophage 80
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1051641	1056304	2367908		Staphylococcus_phage(50.0%)	4	NA	NA
WP_032997144.1|1051641_1052487_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.3	4.7e-49
WP_005542006.1|1052669_1053563_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005542009.1|1053651_1054467_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_061866545.1|1054804_1056304_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	45.8	1.1e-82
>prophage 81
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1061694	1077960	2367908	tRNA	Bacillus_phage(37.5%)	17	NA	NA
WP_005542017.1|1061694_1062390_-	response regulator	NA	W8CYM9	Bacillus_phage	37.0	2.9e-33
WP_005542018.1|1062431_1062845_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_005542019.1|1062910_1063936_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	44.3	2.5e-73
WP_005546151.1|1064061_1064286_+	YejL family protein	NA	NA	NA	NA	NA
WP_005542021.1|1064290_1066030_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_061866547.1|1066289_1067279_+	amidohydrolase family protein	NA	A0A076FFX9	Aureococcus_anophage	28.8	7.9e-32
WP_005549569.1|1067376_1068171_-	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005542026.1|1068352_1068778_+	universal stress protein UspA	NA	NA	NA	NA	NA
WP_005542027.1|1068977_1071602_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.1	1.3e-78
WP_005542029.1|1071724_1071907_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	58.8	2.4e-11
WP_005542031.1|1071938_1073303_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	25.5	1.9e-28
WP_005542033.1|1073378_1074266_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.3	2.8e-60
WP_005542035.1|1074420_1074738_+	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_005542039.1|1074824_1075559_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_014702356.1|1075576_1076134_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_005549562.1|1076133_1076553_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_005542971.1|1076649_1077960_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.9	1.3e-130
>prophage 82
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1095950	1097009	2367908		Planktothrix_phage(100.0%)	1	NA	NA
WP_005542913.1|1095950_1097009_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	3.0e-29
>prophage 83
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1105528	1106845	2367908		Streptococcus_phi-m46.1-like_phage(100.0%)	1	NA	NA
WP_005542875.1|1105528_1106845_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	26.3	8.1e-32
>prophage 84
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1111115	1114214	2367908		Leptospira_phage(100.0%)	1	NA	NA
WP_005542864.1|1111115_1114214_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.5	1.7e-51
>prophage 85
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1119584	1129691	2367908		Xanthomonas_phage(28.57%)	13	NA	NA
WP_005542853.1|1119584_1120448_+	protein YibB	NA	A0A292GL11	Xanthomonas_phage	30.3	3.8e-06
WP_005542849.1|1120454_1121459_-	capsular polysaccharide synthesis protein	NA	A0A0N7KVT5	Yellowstone_lake_phycodnavirus	30.2	2.1e-08
WP_005542847.1|1121467_1122316_-	glycosyltransferase family 25 protein	NA	A0A1D8KPY1	Synechococcus_phage	27.1	5.6e-10
WP_005542845.1|1122573_1122786_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_005542843.1|1122848_1123541_+	glycosyltransferase family 25 protein	NA	A0A1V0SJT4	Klosneuvirus	31.0	1.3e-12
WP_005542841.1|1123541_1124564_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_005542839.1|1124573_1125626_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_005554465.1|1125628_1126444_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.9	1.1e-18
WP_005542835.1|1126525_1126696_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_005542826.1|1126707_1126944_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_005549324.1|1127130_1127790_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_005540229.1|1127967_1129167_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.4	5.1e-41
WP_005540230.1|1129235_1129691_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	3.6e-48
>prophage 86
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1141989	1142844	2367908		Vibrio_phage(100.0%)	1	NA	NA
WP_005543958.1|1141989_1142844_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	48.6	7.5e-63
>prophage 87
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1146419	1154301	2367908	transposase	Emiliania_huxleyi_virus(20.0%)	7	NA	NA
WP_005543943.1|1146419_1148591_+	SEC-C domain-containing protein	NA	V5LQX0	Emiliania_huxleyi_virus	53.1	4.8e-05
WP_005543941.1|1148804_1149371_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	28.8	2.0e-11
WP_014702365.1|1149560_1150046_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	56.9	9.2e-42
WP_005543937.1|1150215_1153047_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.1	0.0e+00
WP_061866548.1|1153124_1153499_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145916692.1|1153540_1153798_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_145916693.1|1153779_1154301_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.0	7.6e-42
>prophage 88
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1161052	1166031	2367908	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_005540005.1|1161052_1163641_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.3	7.0e-189
WP_005539999.1|1164416_1164710_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005555177.1|1164693_1165113_-	nucleotidyltransferase substrate binding protein	NA	NA	NA	NA	NA
WP_005539995.1|1165203_1166031_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	S4TT53	Salmonella_phage	41.5	1.9e-07
>prophage 89
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1169819	1171187	2367908		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_005539979.1|1169819_1171187_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.4	2.6e-110
>prophage 90
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1181887	1182415	2367908		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_005538517.1|1181887_1182415_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	65.1	1.4e-59
>prophage 91
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1186266	1187598	2367908		Erwinia_phage(100.0%)	1	NA	NA
WP_061866549.1|1186266_1187598_+	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	30.4	5.4e-44
>prophage 92
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1191212	1193435	2367908		Ralstonia_phage(100.0%)	1	NA	NA
WP_014702257.1|1191212_1193435_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.8	3.0e-23
>prophage 93
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1197589	1203440	2367908		Streptococcus_phage(50.0%)	8	NA	NA
WP_005544483.1|1197589_1198075_-	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	44.7	1.7e-35
WP_005544482.1|1198114_1198579_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_005544481.1|1198580_1199366_-	threonine/serine exporter ThrE family protein	NA	NA	NA	NA	NA
WP_094978692.1|1199447_1199696_+	hypothetical protein	NA	A0A1X9I5D0	Streptococcus_phage	57.7	4.9e-07
WP_005544479.1|1199676_1200336_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	47.2	1.5e-15
WP_005544478.1|1200400_1201033_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005544477.1|1201058_1201928_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_005544476.1|1202150_1203440_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.3	2.1e-16
>prophage 94
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1210533	1211765	2367908		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_005544466.1|1210533_1211262_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.7	3.1e-17
WP_005544465.1|1211534_1211765_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	51.5	2.3e-11
>prophage 95
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1214916	1216173	2367908		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_005544462.1|1214916_1216173_+	ATP-dependent RNA helicase RhlB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.9	4.2e-38
>prophage 96
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1220205	1222284	2367908		Synechococcus_phage(50.0%)	2	NA	NA
WP_005544451.1|1220205_1221063_+	septal ring lytic transglycosylase RlpA family protein	NA	H2BCY4	Synechococcus_phage	42.7	2.8e-09
WP_005544450.1|1221093_1222284_+	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	46.2	1.4e-91
>prophage 97
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1229539	1239114	2367908		Cedratvirus(25.0%)	12	NA	NA
WP_005539607.1|1229539_1230307_+	amino acid ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.1	1.2e-16
WP_005546333.1|1230311_1230599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005539603.1|1230601_1230964_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_005539601.1|1230960_1231338_-	sulfurtransferase complex subunit TusD	NA	NA	NA	NA	NA
WP_005539599.1|1231341_1232010_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_005539597.1|1232089_1232815_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_005566162.1|1232903_1233125_+	SlyX family protein	NA	NA	NA	NA	NA
WP_005539592.1|1233185_1233914_-	redoxin family protein	NA	A0A1D8KSL1	Synechococcus_phage	56.2	9.2e-46
WP_005539591.1|1234072_1234972_+	DNA-binding transcriptional regulator OxyR	NA	NA	NA	NA	NA
WP_005539586.1|1234983_1235604_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_041160754.1|1235714_1237373_-	thiol reductant ABC exporter subunit CydC	NA	F2Y1V5	Organic_Lake_phycodnavirus	25.6	3.5e-24
WP_005539584.1|1237365_1239114_-	ABC transporter ATP-binding protein/permease	NA	G9BWD6	Planktothrix_phage	25.7	4.4e-09
>prophage 98
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1261384	1264865	2367908		Tupanvirus(50.0%)	3	NA	NA
WP_005539543.1|1261384_1262755_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	31.8	6.6e-29
WP_005539538.1|1262886_1263978_-	YdcF family protein	NA	NA	NA	NA	NA
WP_005551767.1|1264115_1264865_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	25.8	1.2e-08
>prophage 99
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1288609	1291600	2367908		Enterococcus_phage(33.33%)	3	NA	NA
WP_005549347.1|1288609_1289467_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.9	3.1e-24
WP_005544371.1|1289555_1291190_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.7	1.2e-186
WP_005544374.1|1291309_1291600_-	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	40.0	1.2e-12
>prophage 100
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1300304	1309412	2367908		Hokovirus(20.0%)	7	NA	NA
WP_032997153.1|1300304_1301708_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.1	4.4e-52
WP_005541162.1|1301731_1302523_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_005541160.1|1302519_1303272_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	2.9e-18
WP_005594844.1|1303319_1306253_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_005541155.1|1306262_1307150_+	GDP-mannose 4,6-dehydratase	NA	A0A0N7KVW3	Yellowstone_lake_phycodnavirus	28.4	3.0e-14
WP_005541152.1|1307151_1308345_+	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	25.0	2.6e-05
WP_005541150.1|1308377_1309412_+	GDP-mannose 4,6-dehydratase	NA	A0A1J0F996	Only_Syngen_Nebraska_virus	57.5	1.1e-113
>prophage 101
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1318345	1319860	2367908		Staphylococcus_phage(100.0%)	1	NA	NA
WP_162493034.1|1318345_1319860_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.6	1.1e-16
>prophage 102
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1326186	1327035	2367908		Salicola_phage(100.0%)	1	NA	NA
WP_005548833.1|1326186_1327035_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.7	1.0e-40
>prophage 103
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1340744	1341671	2367908		Synechococcus_phage(100.0%)	1	NA	NA
WP_005538486.1|1340744_1341671_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	38.4	9.3e-35
>prophage 104
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1367375	1373740	2367908		Leptospira_phage(33.33%)	6	NA	NA
WP_005544248.1|1367375_1368266_-	tyrosine recombinase XerC	NA	S5W9T9	Leptospira_phage	27.9	5.5e-16
WP_005544246.1|1368275_1369100_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_005544245.1|1369178_1369358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005544243.1|1369357_1370386_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	42.4	2.9e-69
WP_005544242.1|1370568_1371069_+	surface-adhesin E family protein	NA	NA	NA	NA	NA
WP_005549506.1|1371169_1373740_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	33.5	4.2e-125
>prophage 105
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1380321	1381956	2367908		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_005539152.1|1380321_1381956_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.9	2.1e-154
>prophage 106
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1388706	1399690	2367908		Escherichia_phage(66.67%)	9	NA	NA
WP_005548990.1|1388706_1389321_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	34.0	8.7e-21
WP_005593726.1|1389354_1390194_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	29.5	9.7e-15
WP_005539131.1|1390195_1390813_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	55.8	2.7e-70
WP_005548993.1|1390823_1393259_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.4	8.3e-224
WP_032997026.1|1393633_1393735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005593724.1|1393749_1396551_-	DNA polymerase I	NA	A0A142F1Q9	Bacillus_phage	34.5	1.5e-80
WP_005548103.1|1396767_1397331_+	porin family protein	NA	NA	NA	NA	NA
WP_005539105.1|1397434_1397665_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_005539108.1|1397674_1399690_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	38.5	7.8e-119
>prophage 107
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1408265	1408670	2367908	transposase	Burkholderia_virus(100.0%)	1	NA	NA
WP_158511711.1|1408265_1408670_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.9	6.5e-17
>prophage 108
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1417679	1418444	2367908		Shigella_phage(100.0%)	1	NA	NA
WP_005703567.1|1417679_1418444_-	phage antirepressor Ant	NA	A0A088CBR4	Shigella_phage	38.6	2.8e-16
>prophage 109
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1422314	1474507	2367908	integrase,transposase,tRNA	Shigella_phage(33.33%)	48	1459962:1459981	1480586:1480605
WP_005594650.1|1422314_1423559_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	40.6	5.9e-85
WP_005544391.1|1424454_1424682_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_005544393.1|1424678_1427411_-	YdbH family protein	NA	NA	NA	NA	NA
WP_005544395.1|1427516_1428134_-	MarC family protein	NA	NA	NA	NA	NA
WP_005550792.1|1428214_1430140_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	31.9	6.8e-72
WP_005544399.1|1430287_1431346_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.3	1.4e-114
WP_005544401.1|1431427_1431886_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_005544402.1|1431958_1432348_+	RidA family protein	NA	NA	NA	NA	NA
WP_005544404.1|1432416_1434414_-	transketolase	NA	NA	NA	NA	NA
WP_041160763.1|1434546_1435500_-	transaldolase	NA	A0A0E3G6C9	Synechococcus_phage	35.2	1.2e-08
WP_143247878.1|1441817_1442042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071805258.1|1442135_1442237_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005544546.1|1443055_1443277_+|transposase	transposase	transposase	Q716C2	Shigella_phage	55.1	6.7e-16
WP_005541001.1|1443580_1444885_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_005541000.1|1445290_1446622_-	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	32.1	2.8e-48
WP_005549887.1|1446711_1447419_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_005540997.1|1447493_1448183_-	nicotinamide riboside transporter PnuC	NA	U5J9C5	Bacillus_phage	36.5	2.2e-36
WP_005540996.1|1448563_1449223_+|tRNA	bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA	tRNA	NA	NA	NA	NA
WP_005540748.1|1450802_1451363_+	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_005540740.1|1451375_1451810_+	DUF2489 domain-containing protein	NA	NA	NA	NA	NA
WP_005540738.1|1451828_1453196_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_005540737.1|1453269_1453713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005540735.1|1453885_1454653_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_005540733.1|1454764_1455622_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_005540730.1|1456063_1456393_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_005540728.1|1456373_1457375_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_005540727.1|1457473_1457950_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_005540726.1|1458073_1458541_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_005540725.1|1458584_1459931_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
1459962:1459981	attL	AAAGTGCGGTCAGAAAAAAC	NA	NA	NA	NA
WP_005540723.1|1460228_1460990_+	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_005540721.1|1461108_1462497_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_005551725.1|1462520_1462793_+	DUF997 family protein	NA	NA	NA	NA	NA
WP_061866556.1|1462789_1464226_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_005540715.1|1464244_1464787_+	Fic family protein	NA	NA	NA	NA	NA
WP_005540713.1|1464799_1465684_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_005540711.1|1465928_1466978_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_005540710.1|1466971_1467271_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_005540709.1|1467885_1468440_-	DUF5358 domain-containing protein	NA	NA	NA	NA	NA
WP_005540708.1|1468588_1468912_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_005595258.1|1469140_1470514_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_005540705.1|1470910_1471183_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_005540704.1|1471182_1471395_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_005540698.1|1471384_1472008_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_071805270.1|1472393_1472810_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	35.7	1.7e-12
WP_109091990.1|1472850_1473018_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005540696.1|1473014_1473287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155719822.1|1473363_1474227_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	40.4	3.8e-46
WP_071805258.1|1474405_1474507_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
1480586:1480605	attR	GTTTTTTCTGACCGCACTTT	NA	NA	NA	NA
>prophage 110
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1480635	1530643	2367908	tRNA,protease,transposase	uncultured_virus(23.08%)	46	NA	NA
WP_005542551.1|1480635_1481217_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	61.3	2.0e-59
WP_005542555.1|1481226_1482459_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	55.9	1.6e-127
WP_005542557.1|1482521_1482845_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_061866558.1|1483303_1484149_-	DUF817 domain-containing protein	NA	NA	NA	NA	NA
WP_005542563.1|1484221_1486381_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	53.5	2.0e-205
WP_005542565.1|1486467_1486680_-	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	62.1	7.1e-15
WP_005542572.1|1488390_1488645_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	64.0	5.9e-24
WP_005542575.1|1488893_1493162_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	7.0e-69
WP_005542577.1|1493264_1497293_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	26.2	3.0e-21
WP_005542578.1|1497563_1497935_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_005542581.1|1497986_1498478_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_005542586.1|1498833_1499523_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_005542594.1|1499527_1499956_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_005547787.1|1500111_1500663_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_005542598.1|1500664_1501075_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_005542600.1|1501512_1502217_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_005579995.1|1502276_1502531_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	52.4	5.3e-09
WP_005542602.1|1502464_1502854_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_005542604.1|1502859_1503141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014702332.1|1503232_1503409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061866559.1|1503417_1504428_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_005539198.1|1504430_1506551_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_005539200.1|1506573_1507701_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_005539203.1|1507730_1507925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005594882.1|1508078_1508768_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_061866560.1|1508764_1509988_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_005540457.1|1509980_1511390_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_005550263.1|1511416_1511869_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_005540460.1|1511990_1512545_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A0F6R5Z1	Sinorhizobium_phage	29.8	1.7e-07
WP_005594879.1|1513010_1513484_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_032997160.1|1513777_1515907_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_005550269.1|1515991_1516894_+	lipoprotein NlpI	NA	NA	NA	NA	NA
WP_005540468.1|1517005_1518808_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.4	3.9e-53
WP_005540470.1|1518890_1519502_-	UDP-glucose 6-dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	52.7	4.0e-50
WP_014702489.1|1519558_1519714_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_005540471.1|1519806_1520910_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005540473.1|1521041_1522316_+	GntP family permease	NA	NA	NA	NA	NA
WP_005594873.1|1522312_1523452_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.7	3.9e-51
WP_005540477.1|1523522_1524062_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	32.4	6.2e-15
WP_005540479.1|1524300_1525662_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_014702492.1|1525778_1526312_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_032997155.1|1526369_1527761_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_005540485.1|1527949_1528450_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_032998660.1|1528500_1529406_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_005540487.1|1529574_1530291_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_005582243.1|1530388_1530643_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 111
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1536942	1537593	2367908		Bacillus_virus(100.0%)	1	NA	NA
WP_005537850.1|1536942_1537593_-	cell division ATP-binding protein FtsE	NA	G3M9Y6	Bacillus_virus	31.1	3.5e-20
>prophage 112
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1544184	1545435	2367908		Musca_hytrovirus(100.0%)	1	NA	NA
WP_005541822.1|1544184_1545435_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	23.8	1.5e-16
>prophage 113
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1555435	1557979	2367908	transposase	Paenibacillus_phage(50.0%)	3	NA	NA
WP_155719823.1|1555435_1556201_+|transposase	IS5-like element ISAac2 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.3	2.2e-13
WP_005538644.1|1556514_1556991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005554789.1|1557322_1557979_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	45.7	7.3e-42
>prophage 114
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1561725	1564857	2367908		Bacillus_phage(50.0%)	3	NA	NA
WP_033001820.1|1561725_1562364_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	32.1	9.0e-13
WP_005538631.1|1562421_1562688_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_005538628.1|1562733_1564857_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	35.8	2.0e-11
>prophage 115
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1575868	1580439	2367908	transposase	Burkholderia_virus(33.33%)	6	NA	NA
WP_079254141.1|1575868_1576075_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	51.6	4.1e-07
WP_005542458.1|1576354_1577071_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.4	1.0e-17
WP_005542457.1|1577072_1577348_-	RNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005542456.1|1577766_1579269_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_032997114.1|1579270_1579363_+	methionine/alanine import family NSS transporter small subunit	NA	NA	NA	NA	NA
WP_005550621.1|1579794_1580439_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	45.5	1.3e-43
>prophage 116
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1586016	1592407	2367908		uncultured_Mediterranean_phage(25.0%)	8	NA	NA
WP_005544515.1|1586016_1586757_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.6	2.0e-64
WP_005550735.1|1586784_1587360_+	DedA family protein	NA	NA	NA	NA	NA
WP_005566078.1|1587374_1587566_+	membrane lipoprotein lipid attachment site-containing protein	NA	NA	NA	NA	NA
WP_005541855.1|1587582_1588752_+	murein hydrolase activator NlpD	NA	NA	NA	NA	NA
WP_005541857.1|1588902_1589070_-	hypothetical protein	NA	A0A222YXG1	Escherichia_phage	61.1	1.1e-10
WP_005541862.1|1589381_1590527_-	glycoside hydrolase dispersin B	NA	NA	NA	NA	NA
WP_005541864.1|1590662_1591088_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	38.7	8.7e-20
WP_005552844.1|1591099_1592407_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	31.0	9.8e-30
>prophage 117
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1608309	1609323	2367908		Enterobacteria_phage(100.0%)	1	NA	NA
WP_005551199.1|1608309_1609323_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	28.4	7.1e-20
>prophage 118
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1613236	1615084	2367908		Ectocarpus_siliculosus_virus(100.0%)	1	NA	NA
WP_005542646.1|1613236_1615084_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.3	4.3e-31
>prophage 119
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1628992	1635434	2367908		Pseudomonas_phage(50.0%)	6	NA	NA
WP_005542678.1|1628992_1631209_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	34.0	6.8e-15
WP_005542679.1|1631241_1631550_+	trp operon repressor	NA	NA	NA	NA	NA
WP_005542681.1|1631527_1632301_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_005542689.1|1632357_1632558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005552797.1|1632994_1633336_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_005542694.1|1633496_1635434_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.6	9.7e-42
>prophage 120
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1640670	1641438	2367908		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_005542705.1|1640670_1641438_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	A0A2R8FG22	Brazilian_cedratvirus	23.5	1.5e-14
>prophage 121
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1648629	1651774	2367908		Moumouvirus(50.0%)	3	NA	NA
WP_005542724.1|1648629_1649658_+	alcohol dehydrogenase catalytic domain-containing protein	NA	M1PHA2	Moumouvirus	23.6	1.1e-23
WP_005542726.1|1649736_1650951_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_005542734.1|1651075_1651774_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	50.7	8.0e-55
>prophage 122
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1654777	1659889	2367908		Vibrio_phage(50.0%)	5	NA	NA
WP_005542750.1|1654777_1655401_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	34.7	7.2e-23
WP_005542751.1|1655646_1656327_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_005549421.1|1656328_1657462_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_005560556.1|1657598_1657943_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_005539077.1|1658008_1659889_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.6	2.6e-116
>prophage 123
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1683990	1684725	2367908		Planktothrix_phage(100.0%)	1	NA	NA
WP_005546806.1|1683990_1684725_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.4	2.9e-31
>prophage 124
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1689516	1690284	2367908	transposase	Paenibacillus_phage(100.0%)	1	NA	NA
WP_061866571.1|1689516_1690284_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.2	2.9e-13
>prophage 125
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1726837	1729438	2367908		Klosneuvirus(100.0%)	1	NA	NA
WP_005538609.1|1726837_1729438_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	25.7	3.7e-28
>prophage 126
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1736793	1742756	2367908		Escherichia_phage(80.0%)	7	NA	NA
WP_005538584.1|1736793_1737426_-	aldolase	NA	A0A077SK32	Escherichia_phage	57.8	2.5e-63
WP_005566199.1|1737422_1738667_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	52.9	2.8e-111
WP_005551831.1|1738669_1739575_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	70.8	1.1e-107
WP_005538577.1|1739767_1740526_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	52.1	6.4e-58
WP_005538573.1|1740601_1740940_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_005538572.1|1741078_1742122_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_005538571.1|1742123_1742756_+	dTMP kinase	NA	H9EB73	Vibrio_phage	33.1	8.9e-13
>prophage 127
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1751890	1755016	2367908		Streptococcus_phage(50.0%)	2	NA	NA
WP_005542520.1|1751890_1753549_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	34.8	1.3e-79
WP_014702467.1|1753756_1755016_+	murein hydrolase activator EnvC	NA	A0A7K9	Microcystis_virus	38.7	7.8e-08
>prophage 128
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1761961	1762999	2367908		Planktothrix_phage(100.0%)	1	NA	NA
WP_005542501.1|1761961_1762999_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	36.3	1.8e-31
>prophage 129
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1775228	1781756	2367908	tRNA	Vibrio_phage(66.67%)	7	NA	NA
WP_005594039.1|1775228_1776608_-|tRNA	cysteine--tRNA ligase	tRNA	H2EDD6	Moumouvirus	35.0	3.9e-45
WP_005543917.1|1776707_1777220_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_005594036.1|1777310_1777469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061866579.1|1777461_1777743_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_005543913.1|1777745_1778534_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_005543910.1|1778560_1779028_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	A0A2D0YLR2	Vibrio_phage	58.9	4.2e-52
WP_005543907.1|1779629_1781756_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	63.0	1.2e-258
>prophage 130
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1787392	1792855	2367908		Catovirus(50.0%)	2	NA	NA
WP_061866580.1|1787392_1789180_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	26.6	1.2e-43
WP_005540627.1|1789378_1792855_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.6	3.2e-205
>prophage 131
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1797921	1799376	2367908		Tupanvirus(100.0%)	1	NA	NA
WP_005540613.1|1797921_1799376_-	catalase	NA	A0A2K9L572	Tupanvirus	38.2	1.3e-96
>prophage 132
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1804484	1859291	2367908	capsid,integrase,tail,plate,holin,terminase,tRNA	Haemophilus_phage(92.31%)	76	1806040:1806088	1850566:1850614
WP_005543044.1|1804484_1805930_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
1806040:1806088	attL	ATGGCATTCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCAAATT	NA	NA	NA	NA
WP_015971208.1|1806107_1807154_-|integrase	site-specific integrase	integrase	Q7Y5X7	Haemophilus_phage	100.0	5.0e-202
WP_015971210.1|1807390_1807705_-	hypothetical protein	NA	Q7Y5X5	Haemophilus_phage	100.0	4.2e-56
WP_019518340.1|1807759_1808416_-	hypothetical protein	NA	Q7Y5X4	Haemophilus_phage	99.5	8.7e-128
WP_015971212.1|1808482_1808968_-	hypothetical protein	NA	Q7Y5X3	Haemophilus_phage	100.0	1.4e-85
WP_015971213.1|1809000_1809183_-	hypothetical protein	NA	Q776W8	Haemophilus_phage	100.0	1.3e-25
WP_045009144.1|1809175_1809682_-	hypothetical protein	NA	Q7Y5X2	Haemophilus_phage	100.0	3.1e-93
WP_015971215.1|1809795_1810689_-	ATP-binding protein	NA	Q7Y5X1	Haemophilus_phage	100.0	2.1e-164
WP_015971216.1|1810700_1811000_-	hypothetical protein	NA	Q776W7	Haemophilus_phage	100.0	2.4e-48
WP_015971217.1|1811002_1811257_-	hypothetical protein	NA	Q776W6	Haemophilus_phage	100.0	4.5e-40
WP_015971218.1|1811246_1811522_-	hypothetical protein	NA	Q776W5	Haemophilus_phage	100.0	1.6e-43
WP_015971219.1|1811608_1812265_-	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	100.0	2.4e-122
WP_005545968.1|1812708_1812933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019518460.1|1813026_1813440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019518459.1|1813439_1813619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167555040.1|1813941_1814079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019518457.1|1814645_1815170_+	hypothetical protein	NA	Q7Y5W8	Haemophilus_phage	98.9	2.6e-90
WP_019518456.1|1815525_1815960_-	hypothetical protein	NA	Q7Y5W7	Haemophilus_phage	100.0	1.9e-70
WP_015971223.1|1815967_1816855_-	hypothetical protein	NA	Q7Y5W6	Haemophilus_phage	100.0	8.9e-168
WP_015971224.1|1816912_1817629_-	helix-turn-helix domain-containing protein	NA	Q7Y5W5	Haemophilus_phage	100.0	1.7e-132
WP_015971225.1|1817738_1817927_+	helix-turn-helix domain-containing protein	NA	Q7Y5W4	Haemophilus_phage	100.0	6.9e-30
WP_026161203.1|1817947_1818244_+	hypothetical protein	NA	Q7Y5W3	Haemophilus_phage	100.0	1.1e-48
WP_015971227.1|1818295_1819015_+	phage antirepressor KilAC domain-containing protein	NA	Q7Y5W2	Haemophilus_phage	100.0	7.1e-131
WP_015971228.1|1819014_1819173_+	hypothetical protein	NA	Q776W3	Haemophilus_phage	100.0	1.7e-21
WP_019518455.1|1819169_1819970_+	hypothetical protein	NA	Q7Y5W1	Haemophilus_phage	90.2	4.2e-132
WP_061866581.1|1819969_1821427_+	AAA family ATPase	NA	Q7Y5V9	Haemophilus_phage	99.8	6.6e-277
WP_015971231.1|1821429_1821924_+	DNA adenine methylase	NA	Q7Y5V8	Haemophilus_phage	100.0	1.8e-93
WP_026161202.1|1822002_1822428_+	recombination protein NinB	NA	Q7Y5V7	Haemophilus_phage	99.3	1.3e-76
WP_019518453.1|1822424_1822652_+	hypothetical protein	NA	Q776W2	Haemophilus_phage	100.0	9.6e-34
WP_015971234.1|1822651_1822831_+	hypothetical protein	NA	D0UIL0	Aggregatibacter_phage	93.2	1.3e-25
WP_005541307.1|1822805_1823021_+	hypothetical protein	NA	Q776W0	Haemophilus_phage	100.0	5.5e-31
WP_015971235.1|1823020_1823590_+	recombination protein NinG	NA	Q7Y5V6	Haemophilus_phage	100.0	1.3e-106
WP_015971236.1|1823589_1823961_+	antitermination protein Q	NA	Q7Y5V5	Haemophilus_phage	100.0	2.4e-66
WP_015971237.1|1824250_1825147_+	phage repressor protein/antirepressor Ant	NA	Q7Y5V4	Haemophilus_phage	100.0	3.1e-168
WP_015971238.1|1825310_1825757_+|holin	phage holin family protein	holin	Q7Y5V3	Haemophilus_phage	100.0	3.8e-74
WP_005541594.1|1825753_1826122_+	hypothetical protein	NA	Q7Y5V2	Haemophilus_phage	100.0	1.8e-58
WP_015971239.1|1826030_1826396_+	hypothetical protein	NA	Q7Y5V1	Haemophilus_phage	100.0	4.3e-60
WP_015971240.1|1826464_1827046_+	glycoside hydrolase family 19 protein	NA	Q7Y5V0	Haemophilus_phage	100.0	4.7e-109
WP_015971241.1|1827048_1827381_+	DUF2570 domain-containing protein	NA	Q7Y5U9	Haemophilus_phage	100.0	7.4e-51
WP_005537516.1|1827577_1827844_+	hypothetical protein	NA	Q776V9	Haemophilus_phage	100.0	8.3e-45
WP_061866582.1|1828000_1828561_+|terminase	terminase small subunit	terminase	Q7Y5U8	Haemophilus_phage	98.4	4.7e-74
WP_032998433.1|1828586_1829969_+|terminase	phage terminase large subunit	terminase	Q7Y5U7	Haemophilus_phage	100.0	1.9e-270
WP_015971244.1|1829970_1831284_+	DUF1073 domain-containing protein	NA	Q7Y5U6	Haemophilus_phage	100.0	6.4e-247
WP_032998434.1|1831333_1833607_+|capsid	minor capsid protein	capsid	Q7Y5U5	Haemophilus_phage	100.0	0.0e+00
WP_005579230.1|1833603_1833822_+	hypothetical protein	NA	Q776X0	Haemophilus_phage	100.0	1.4e-34
WP_015971247.1|1834238_1835351_+	DUF2213 domain-containing protein	NA	Q7Y5U2	Haemophilus_phage	100.0	8.3e-171
WP_015971248.1|1835364_1835814_+	hypothetical protein	NA	Q7Y5U1	Haemophilus_phage	100.0	1.9e-73
WP_005541375.1|1835825_1836740_+	DUF2184 domain-containing protein	NA	Q7Y5U0	Haemophilus_phage	100.0	8.3e-169
WP_015971249.1|1836750_1837110_+	DUF4054 domain-containing protein	NA	Q7Y5T9	Haemophilus_phage	100.0	2.1e-59
WP_015971250.1|1837110_1837557_+	hypothetical protein	NA	Q7Y5T8	Haemophilus_phage	100.0	3.1e-76
WP_005541582.1|1837553_1837925_+	hypothetical protein	NA	Q776V7	Haemophilus_phage	100.0	1.3e-64
WP_026161200.1|1837989_1838352_+	hypothetical protein	NA	Q7Y5T6	Haemophilus_phage	99.2	6.6e-61
WP_015971252.1|1838356_1839865_+	DUF3383 domain-containing protein	NA	Q7Y5T5	Haemophilus_phage	100.0	3.0e-280
WP_015971253.1|1839914_1840346_+	DUF3277 family protein	NA	Q7Y5T4	Haemophilus_phage	100.0	1.7e-76
WP_015971255.1|1840345_1840765_+	hypothetical protein	NA	Q776V6	Haemophilus_phage	100.0	1.3e-73
WP_015971256.1|1840915_1843024_+|tail	tail length tape measure protein	tail	Q7Y5T2	Haemophilus_phage	100.0	8.6e-302
WP_015971257.1|1843027_1843795_+	hypothetical protein	NA	Q7Y5T0	Haemophilus_phage	100.0	1.6e-128
WP_026161199.1|1843811_1844120_+	hypothetical protein	NA	Q7Y5S9	Haemophilus_phage	100.0	6.0e-55
WP_015971259.1|1844406_1845261_+	hypothetical protein	NA	Q7Y5S8	Haemophilus_phage	100.0	6.2e-158
WP_015971260.1|1845257_1845902_+|plate	baseplate protein	plate	Q7Y5S7	Haemophilus_phage	100.0	8.0e-102
WP_005545972.1|1845898_1846258_+	hypothetical protein	NA	Q7Y5S5	Haemophilus_phage	100.0	5.2e-66
WP_015971261.1|1846288_1847431_+|plate	baseplate J/gp47 family protein	plate	Q7Y5S4	Haemophilus_phage	100.0	3.9e-208
WP_061866583.1|1847430_1848018_+	DUF2612 domain-containing protein	NA	Q7Y5S3	Haemophilus_phage	93.3	3.4e-99
WP_167555043.1|1848349_1849513_+|tail	tail fiber protein	tail	Q7Y5S2	Haemophilus_phage	99.7	4.2e-210
WP_061866584.1|1849512_1850124_+	DUF4376 domain-containing protein	NA	Q7Y5S1	Haemophilus_phage	100.0	1.8e-114
WP_015971265.1|1850104_1850365_+	hypothetical protein	NA	Q776W9	Haemophilus_phage	100.0	4.0e-44
WP_005543045.1|1850901_1851111_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	58.7	4.8e-16
1850566:1850614	attR	ATGGCATTCAAGAGGTCGTCGGTTCGATCCCGATTATCTCCACCAAATT	NA	NA	NA	NA
WP_005543047.1|1851209_1852142_-	ribokinase	NA	NA	NA	NA	NA
WP_005543049.1|1852223_1853096_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	24.9	4.3e-05
WP_005543052.1|1853117_1854083_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_005543054.1|1854079_1855588_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.2	4.5e-18
WP_005543056.1|1855598_1856018_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_005594017.1|1856237_1856837_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_005543061.1|1856839_1857637_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_005543064.1|1857645_1858443_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_005543066.1|1858439_1859291_+	thymidylate synthase	NA	H9EB68	Vibrio_phage	77.4	1.2e-132
>prophage 133
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1864750	1874569	2367908	tRNA	Ralstonia_phage(20.0%)	10	NA	NA
WP_167555041.1|1864750_1866844_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	27.8	2.9e-23
WP_014702274.1|1866840_1867011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005593716.1|1867291_1868404_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_005549475.1|1868576_1870637_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	24.0	2.3e-25
WP_005542240.1|1870770_1870965_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_005542241.1|1870964_1871306_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_005542243.1|1871317_1873177_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.6	1.6e-110
WP_005542245.1|1873197_1873719_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_005542247.1|1873730_1874054_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	6.8e-25
WP_005542252.1|1874185_1874569_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.2	9.1e-53
>prophage 134
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1887915	1889334	2367908		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_005539796.1|1887915_1888911_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	40.5	1.2e-67
WP_005550389.1|1889010_1889334_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	52.8	3.9e-20
>prophage 135
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1898963	1900942	2367908		Bacillus_virus(100.0%)	2	NA	NA
WP_005552257.1|1898963_1899962_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	31.3	3.3e-17
WP_005552256.1|1899958_1900942_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	2.4e-12
>prophage 136
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1904914	1905397	2367908		Staphylococcus_phage(100.0%)	1	NA	NA
WP_005554152.1|1904914_1905397_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.1	1.6e-25
>prophage 137
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1909529	1910501	2367908		Indivirus(100.0%)	1	NA	NA
WP_005554148.1|1909529_1910501_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	22.3	4.6e-08
>prophage 138
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1923331	1927647	2367908	tRNA,transposase	Pseudomonas_phage(33.33%)	4	NA	NA
WP_005539900.1|1923331_1924057_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	S5VMD2	Pseudomonas_phage	31.0	8.4e-23
WP_005539902.1|1924128_1924656_-	isoprenylcysteine carboxyl methyltransferase family protein	NA	NA	NA	NA	NA
WP_061866586.1|1924863_1926642_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.3	9.6e-12
WP_158512147.1|1926840_1927647_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.8	1.8e-50
>prophage 139
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1931363	1933642	2367908		Bacillus_virus(50.0%)	3	NA	NA
WP_005542300.1|1931363_1931936_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	27.8	3.8e-10
WP_005542299.1|1931999_1932614_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_005545577.1|1932628_1933642_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.1	3.7e-08
>prophage 140
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1951902	1953165	2367908		Aeromonas_phage(100.0%)	1	NA	NA
WP_005537928.1|1951902_1953165_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.8	1.6e-101
>prophage 141
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1958026	1960150	2367908		Bacillus_phage(100.0%)	1	NA	NA
WP_005537924.1|1958026_1960150_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.0	4.9e-47
>prophage 142
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	1988110	2001095	2367908		uncultured_Caudovirales_phage(40.0%)	10	NA	NA
WP_005540330.1|1988110_1989001_-	ironABC transporter ATP-binding protein AfeB	NA	G9BWD6	Planktothrix_phage	25.5	2.6e-10
WP_005540327.1|1989000_1989882_-	iron ABC transporter substrate-binding protein AfeA	NA	NA	NA	NA	NA
WP_014702540.1|1989979_1990309_-	TusE/DsrC/DsvC family sulfur relay protein	NA	NA	NA	NA	NA
WP_005540319.1|1990394_1991057_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	49.4	3.9e-27
WP_005540317.1|1991372_1991807_+	CRISPR-associated endonuclease Cas3''	NA	NA	NA	NA	NA
WP_005540313.1|1993759_1996636_+	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	42.1	1.1e-195
WP_061866589.1|1996665_1997259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005540309.1|1997242_1998184_+	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_005540307.1|1998197_1999934_+	site-specific DNA-methyltransferase	NA	A0A220NUF4	Escherichia_phage	47.1	9.7e-102
WP_005540305.1|2000060_2001095_+	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	55.3	2.2e-93
>prophage 143
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2013278	2024769	2367908	tRNA	Planktothrix_phage(25.0%)	8	NA	NA
WP_005540276.1|2013278_2013926_+	thiamine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.4	3.6e-25
WP_005540274.1|2013971_2014976_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_005540269.1|2015691_2016171_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_005595076.1|2016174_2018919_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.4	1.0e-84
WP_005540265.1|2019011_2019629_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_005540264.1|2019641_2020982_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	42.7	4.6e-83
WP_005540262.1|2021478_2023146_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_005540260.1|2023452_2024769_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.0	1.2e-96
>prophage 144
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2028713	2029832	2367908		Bacillus_virus(100.0%)	1	NA	NA
WP_005542484.1|2028713_2029832_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	36.8	4.4e-31
>prophage 145
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2036220	2041204	2367908		Moraxella_phage(33.33%)	4	NA	NA
WP_005542489.1|2036220_2038278_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.1	1.5e-85
WP_005542490.1|2038355_2039864_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_005542491.1|2039928_2040489_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	37.1	7.2e-06
WP_005542492.1|2040565_2041204_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	32.0	4.9e-27
>prophage 146
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2077680	2080814	2367908		Bacillus_phage(50.0%)	2	NA	NA
WP_005542219.1|2077680_2079855_+	DNA helicase II	NA	A7KV33	Bacillus_phage	35.9	6.5e-111
WP_005542220.1|2079986_2080814_-	DNA ligase	NA	A0A1X9VNU1	Mimivirus	29.9	5.1e-32
>prophage 147
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2087895	2094335	2367908		Organic_Lake_phycodnavirus(33.33%)	7	NA	NA
WP_005549377.1|2087895_2088699_+	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	29.7	1.4e-18
WP_005549378.1|2088700_2089843_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_005542405.1|2089860_2090664_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_005542406.1|2090663_2091452_+	TIGR01619 family protein	NA	NA	NA	NA	NA
WP_005542407.1|2091476_2092505_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	50.0	1.1e-92
WP_005542409.1|2092666_2093407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005542410.1|2093681_2094335_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	45.9	1.3e-43
>prophage 148
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2099679	2104235	2367908		Organic_Lake_phycodnavirus(66.67%)	3	NA	NA
WP_005542419.1|2099679_2101413_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.1	1.9e-20
WP_032998675.1|2101412_2103176_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y1V6	Organic_Lake_phycodnavirus	30.1	9.5e-12
WP_005542421.1|2103281_2104235_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	43.6	7.8e-61
>prophage 149
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2107961	2111935	2367908		Vibrio_phage(33.33%)	6	NA	NA
WP_005542427.1|2107961_2108618_+	GTP cyclohydrolase I FolE	NA	Q6WI31	Vibrio_phage	49.3	1.7e-51
WP_005542428.1|2108718_2110161_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	NA	NA	NA	NA
WP_005542429.1|2110320_2110797_+	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_005542430.1|2110872_2111175_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_005542431.1|2111342_2111642_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	47.9	1.2e-20
WP_005542432.1|2111638_2111935_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	48.9	4.5e-15
>prophage 150
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2116469	2127075	2367908	tRNA	Aureococcus_anophage(20.0%)	10	NA	NA
WP_005542436.1|2116469_2118215_+	ABC transporter ATP-binding protein/permease	NA	A0A076FI99	Aureococcus_anophage	25.1	1.1e-07
WP_005542438.1|2118328_2118808_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_005542439.1|2118868_2119840_+	oxidoreductase	NA	NA	NA	NA	NA
WP_005550377.1|2120445_2122179_-|tRNA	arginine--tRNA ligase	tRNA	A0A1V0SIS8	Klosneuvirus	35.6	6.6e-82
WP_014702560.1|2122275_2122863_+	VOC family protein	NA	NA	NA	NA	NA
WP_005542443.1|2122904_2123360_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_005542444.1|2123500_2124583_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	44.4	5.1e-08
WP_005542445.1|2124622_2125522_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_005542446.1|2125531_2126386_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.4	4.0e-48
WP_005542447.1|2126565_2127075_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.3	9.1e-16
>prophage 151
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2132102	2137147	2367908	transposase	Bacillus_phage(50.0%)	7	NA	NA
WP_155719825.1|2132102_2133623_-	DNA polymerase IV	NA	A0A1B1P773	Bacillus_phage	38.3	2.1e-23
WP_061866548.1|2133664_2134039_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_143106533.1|2134161_2134350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005544663.1|2134523_2134973_+	type VI secretion protein ImpA	NA	NA	NA	NA	NA
WP_109091998.1|2135039_2135111_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_162200194.1|2135205_2135358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005544504.1|2135680_2137147_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.3	2.2e-99
>prophage 152
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2144349	2145168	2367908		Tupanvirus(100.0%)	1	NA	NA
WP_005542338.1|2144349_2145168_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	1.8e-13
>prophage 153
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2155273	2161435	2367908	tRNA	Wolbachia_phage(33.33%)	5	NA	NA
WP_005594151.1|2155273_2157124_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	42.6	1.3e-67
WP_061866590.1|2157123_2158611_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	39.0	1.1e-08
WP_005551345.1|2158607_2159102_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_005543005.1|2159257_2161051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005543003.1|2161075_2161435_-	GtrA family protein	NA	I1TED9	Salmonella_phage	46.7	4.6e-22
>prophage 154
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2171143	2173587	2367908		Enterobacteria_phage(66.67%)	4	NA	NA
WP_005540924.1|2171143_2171488_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q708N9	Streptococcus_phage	45.6	3.8e-10
WP_005540929.1|2171571_2171838_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005540930.1|2172052_2172721_+	cytolethal distending toxin subunit Aa-CdtA	NA	A5LH52	Enterobacteria_phage	43.8	8.5e-30
WP_005540931.1|2172735_2173587_+	cytolethal distending toxin nuclease subunit Aa-CdtB	NA	A5LH53	Enterobacteria_phage	48.7	1.6e-65
>prophage 155
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2181560	2185543	2367908		Diachasmimorpha_longicaudata_entomopoxvirus(50.0%)	4	NA	NA
WP_005540958.1|2181560_2182109_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	39.2	1.5e-27
WP_005540960.1|2182180_2183221_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_005540961.1|2183441_2183699_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_061866591.1|2183815_2185543_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
>prophage 156
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2200507	2209021	2367908	tRNA,transposase	Acinetobacter_phage(20.0%)	11	NA	NA
WP_005549452.1|2200507_2201074_+	anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	34.7	2.2e-26
WP_005539956.1|2201229_2202174_+	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	31.2	4.7e-26
WP_005583862.1|2202337_2202670_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_005539954.1|2202937_2203813_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_005555043.1|2204052_2205984_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	3.8e-131
WP_081110847.1|2206045_2206132_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_143106501.1|2206089_2206566_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.6	2.4e-34
WP_145916689.1|2206547_2206805_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_005594724.1|2206846_2207221_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005542265.1|2207386_2208166_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_071805301.1|2208478_2209021_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.5	1.1e-14
>prophage 157
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2214018	2214999	2367908		Tupanvirus(100.0%)	1	NA	NA
WP_005538890.1|2214018_2214999_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	31.5	1.2e-11
>prophage 158
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2230140	2235875	2367908	tRNA	Escherichia_phage(60.0%)	5	NA	NA
WP_005538918.1|2230140_2232075_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	43.8	7.4e-42
WP_005538920.1|2232094_2233279_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	45.1	2.5e-08
WP_005538922.1|2233500_2235171_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	78.5	1.6e-258
WP_005538924.1|2235281_2235569_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2L1IV28	Escherichia_phage	47.8	2.2e-19
WP_005538926.1|2235578_2235875_+	HigA family addiction module antidote protein	NA	A0A2P1MXE5	Escherichia_phage	43.8	4.3e-10
>prophage 159
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2242616	2250022	2367908	transposase	Burkholderia_virus(20.0%)	7	NA	NA
WP_071805333.1|2242616_2242853_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	49.3	2.9e-09
WP_005544527.1|2243048_2244233_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005544530.1|2244247_2244934_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.6	4.1e-35
WP_005550094.1|2244933_2246184_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_167555046.1|2246299_2247364_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	47.4	3.6e-83
WP_005544554.1|2247509_2248916_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	68.4	4.4e-169
WP_005544553.1|2248939_2250022_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	30.2	1.7e-32
>prophage 160
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2253134	2253608	2367908		Staphylococcus_phage(100.0%)	1	NA	NA
WP_005537755.1|2253134_2253608_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	48.0	1.2e-30
>prophage 161
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2257098	2263177	2367908		Pseudomonas_phage(50.0%)	6	NA	NA
WP_005537767.1|2257098_2257347_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	55.6	1.3e-12
WP_005537768.1|2257416_2257686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005537770.1|2257707_2258838_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	77.8	3.0e-168
WP_005552896.1|2258858_2259812_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_005537774.1|2259813_2260872_-	nucleotidyltransferase domain-containing protein	NA	A0A2H4J138	uncultured_Caudovirales_phage	31.4	1.3e-24
WP_061866592.1|2260906_2263177_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	66.4	4.3e-299
>prophage 162
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2268319	2269360	2367908		Bacillus_virus(100.0%)	1	NA	NA
WP_005537795.1|2268319_2269360_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	33.8	2.7e-30
>prophage 163
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2275784	2276903	2367908		Planktothrix_phage(100.0%)	1	NA	NA
WP_005537806.1|2275784_2276903_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	G9BWD6	Planktothrix_phage	35.5	7.8e-28
>prophage 164
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2280498	2285481	2367908	tRNA	Bacillus_phage(50.0%)	5	NA	NA
WP_032999032.1|2280498_2282436_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.9	1.2e-97
WP_005543657.1|2282438_2283161_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_005543658.1|2283192_2283750_+	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_005543661.1|2283792_2284398_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_005543662.1|2284398_2285481_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	29.1	7.6e-28
>prophage 165
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2293956	2299542	2367908	tRNA	Morganella_phage(20.0%)	6	NA	NA
WP_005594687.1|2293956_2294892_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	38.5	2.6e-53
WP_061866593.1|2295005_2296436_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	28.4	3.8e-35
WP_005543509.1|2296477_2296858_-	SufE family protein	NA	NA	NA	NA	NA
WP_005543506.1|2296854_2298054_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	33.7	4.4e-61
WP_005543504.1|2298059_2298560_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	41.1	6.2e-25
WP_005543502.1|2298576_2299542_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	83.9	3.9e-124
>prophage 166
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2304921	2305671	2367908		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_005543490.1|2304921_2305671_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.8	4.6e-16
>prophage 167
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2309619	2314468	2367908	transposase	Paenibacillus_phage(66.67%)	5	NA	NA
WP_005565741.1|2309619_2310408_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.5	1.0e-13
WP_032997120.1|2310413_2311400_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_005543479.1|2311612_2312308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155719826.1|2312807_2313548_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.3	3.6e-13
WP_155719827.1|2313676_2314468_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.2	4.6e-14
>prophage 168
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2319048	2321076	2367908	tRNA,protease	Pseudomonas_phage(50.0%)	2	NA	NA
WP_005537579.1|2319048_2319510_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	56.0	1.6e-27
WP_005537580.1|2319672_2321076_-|tRNA	asparagine--tRNA ligase	tRNA	A0A1V0SDB6	Indivirus	37.8	8.2e-83
>prophage 169
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2326227	2327745	2367908		Staphylococcus_phage(100.0%)	1	NA	NA
WP_014702195.1|2326227_2327745_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	28.7	7.4e-21
>prophage 170
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2333958	2336764	2367908		Staphylococcus_phage(50.0%)	2	NA	NA
WP_005544319.1|2333958_2334948_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1X9SII8	Staphylococcus_phage	52.6	1.0e-95
WP_005544317.1|2335078_2336764_-	ribonucleoside-diphosphate reductase subunit alpha	NA	Q2XUY0	environmental_halophage	58.5	1.4e-198
>prophage 171
NZ_CP012959	Aggregatibacter actinomycetemcomitans strain 624 chromosome, complete genome	2367908	2348495	2361475	2367908	tRNA,protease	Acinetobacter_phage(42.86%)	13	NA	NA
WP_005543449.1|2348495_2349926_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.1	2.3e-32
WP_005543446.1|2349934_2350207_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	41.5	8.0e-11
WP_005543444.1|2350222_2350501_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_005543441.1|2350595_2351597_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	36.5	2.2e-50
WP_005543439.1|2351608_2352001_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_005543437.1|2352074_2352665_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	43.3	1.2e-35
WP_005543435.1|2352675_2354223_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_005543432.1|2354388_2354943_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005543430.1|2354942_2355878_-	KpsF/GutQ family sugar isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	33.6	1.2e-40
WP_005548951.1|2356560_2357436_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_005543396.1|2357775_2358765_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.8	1.6e-32
WP_005543399.1|2358784_2361175_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_005543400.1|2361178_2361475_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	2.7e-12
