The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014316	Escherichia coli JJ1887 chromosome, complete genome	5081061	929383	1039951	5081061	terminase,portal,capsid,transposase,tail,protease,head,plate,holin,tRNA,integrase	Enterobacteria_phage(41.05%)	130	1025549:1025564	1044870:1044885
WP_000520781.1|929383_929704_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|929734_932011_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|932695_932914_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|933198_933903_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|933944_935666_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|935666_937433_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|937555_938521_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|939064_939559_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|939693_943800_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|943958_944570_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|944580_945924_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|946014_947307_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078916.1|947612_947753_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|947944_948205_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|948245_949355_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|949512_950697_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|950696_951209_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|951264_951639_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|951647_951803_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000979945.1|954608_955097_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|955125_955725_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_032152415.1|957059_957515_+	hypothetical protein	NA	Q858V4	Yersinia_virus	71.5	1.0e-50
WP_001554335.1|957516_958044_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_000972134.1|958072_958606_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_021538277.1|958608_960594_-|tail	phage tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	86.0	3.2e-173
WP_000071703.1|960596_961127_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|961119_962016_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213444.1|962019_962370_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001271941.1|962366_962948_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000356366.1|962944_963580_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|963572_964040_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|964063_965941_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|966079_966475_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|966471_966864_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|966860_967184_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|967186_967387_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|967386_967881_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|967982_968783_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|968828_969881_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|969904_970741_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|970895_972647_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|972646_973693_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|973707_974232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|974955_975453_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|975492_976335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|976418_976733_-	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|976737_977697_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|977773_980596_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|980602_980968_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_023142408.1|980964_981582_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
WP_000104290.1|981593_981893_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|981889_982156_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|982152_982356_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|982379_982790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|982883_982997_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|982993_983236_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|983247_983526_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|983536_983887_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|984024_984216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|984222_984645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|984649_985171_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|985275_985617_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|985686_986679_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|986978_989423_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|989433_990051_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|990052_990916_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|990951_991578_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|991891_993040_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|993136_993877_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|994068_996351_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|996405_997263_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|997668_999429_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|999558_1000251_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|1000449_1001538_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|1001608_1002892_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|1003147_1003720_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_064767240.1|1003779_1004220_+|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_023142129.1|1004230_1004692_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_000072165.1|1004698_1005313_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_000527461.1|1005312_1006644_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.8e-40
WP_000138756.1|1006646_1007225_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|1007217_1008321_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|1008311_1008659_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|1008713_1009310_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|1009306_1010461_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_012602373.1|1010448_1010664_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|1010660_1011545_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|1011544_1014496_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|1014571_1014730_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|1014653_1014989_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|1015086_1015368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|1015370_1015892_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|1015891_1017319_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|1017308_1017563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|1017559_1018024_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|1018023_1018470_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|1018471_1018810_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|1018819_1019773_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|1019787_1020903_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|1021117_1021576_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|1021578_1022400_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|1022380_1023877_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_001295924.1|1023876_1025409_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
WP_000124060.1|1025468_1026014_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
1025549:1025564	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|1026013_1026325_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|1026324_1026651_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|1026647_1027298_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|1027281_1028022_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|1028024_1028375_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|1028505_1029234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|1029209_1029614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|1029612_1029828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|1030018_1030783_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|1030899_1031256_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|1031349_1031538_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|1031590_1031899_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|1031909_1032830_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|1032829_1033147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|1033162_1034932_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|1034942_1036109_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|1036111_1036381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|1036408_1036939_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|1037227_1037500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|1037509_1037806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|1037820_1038036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|1038032_1038716_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|1038712_1038943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|1038932_1039139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|1039140_1039590_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|1039561_1039951_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
1044870:1044885	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 2
NZ_CP014316	Escherichia coli JJ1887 chromosome, complete genome	5081061	1251277	1296986	5081061	terminase,portal,capsid,tail,head,integrase,lysis,tRNA,holin	Enterobacteria_phage(56.0%)	58	1249595:1249609	1278189:1278203
1249595:1249609	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|1251277_1252384_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1252437_1252899_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|1252908_1253562_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1253733_1254984_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1255097_1256240_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1256229_1256466_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1256605_1256845_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1256828_1257155_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1257154_1257376_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|1257474_1257756_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|1257766_1257958_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1257930_1258113_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1258109_1258790_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1258786_1259572_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|1259577_1259874_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|1259949_1260156_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000259990.1|1260751_1261507_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|1261545_1261776_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|1261845_1262385_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001435464.1|1262471_1263401_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_000788794.1|1263397_1264099_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|1264348_1268614_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|1268650_1269694_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|1270043_1270145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|1270141_1270597_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|1270596_1270767_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|1270759_1271050_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|1271046_1271409_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|1271405_1271546_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|1271542_1272232_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|1272553_1272859_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|1272845_1273322_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|1273538_1273721_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1273811_1274105_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1274585_1274912_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1275118_1275301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|1275864_1276410_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|1276384_1278310_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
1278189:1278203	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|1278306_1278513_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|1278509_1280111_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|1280091_1281411_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|1281420_1281753_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|1281808_1282834_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|1282875_1283274_+	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|1283285_1283639_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|1283650_1284229_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|1284225_1284621_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|1284628_1285369_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|1285384_1285807_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|1285788_1286223_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|1286215_1288777_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|1288773_1289103_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|1289102_1289801_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|1289805_1290549_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|1290485_1291088_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|1291148_1294631_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|1294689_1296711_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|1296707_1296986_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 3
NZ_CP014316	Escherichia coli JJ1887 chromosome, complete genome	5081061	1434946	1507908	5081061	terminase,portal,capsid,transposase,tail,protease,head,integrase,holin	Enterobacteria_phage(23.21%)	79	1431120:1431134	1437030:1437044
1431120:1431134	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|1434946_1436077_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1436054_1436303_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|1436367_1438839_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
1437030:1437044	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|1438931_1439123_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|1439119_1439308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|1439873_1440092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1440251_1440407_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|1440679_1441396_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|1441445_1441661_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|1441657_1442083_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|1442105_1443068_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|1443074_1443821_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|1443842_1444613_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|1444628_1445054_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|1445228_1445894_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|1446074_1446287_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|1446454_1446727_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|1446728_1447784_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|1447784_1448165_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|1448161_1448983_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|1449209_1449407_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|1449558_1450608_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|1451409_1451541_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|1451821_1452157_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|1452417_1454271_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|1454421_1454637_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|1454641_1454986_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|1454951_1455224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|1455329_1455863_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|1456417_1456504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|1456725_1456911_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|1456996_1457212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|1457410_1457611_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|1457652_1458018_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|1458308_1458872_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|1458868_1460530_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|1460593_1462531_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|1462575_1462797_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|1462742_1465328_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|1465324_1465651_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1465660_1466011_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1466007_1466454_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1466450_1466795_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|1466861_1467578_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|1467592_1467967_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_123011843.1|1468062_1468272_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	98.6	3.3e-33
WP_000608644.1|1470531_1471794_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|1472049_1472925_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|1472971_1473304_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000807937.1|1474800_1475142_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|1475141_1475840_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|1475850_1476594_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|1476539_1477172_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|1477514_1480988_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001298859.1|1481628_1483170_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1483184_1483931_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_023363168.1|1484392_1487218_+|tail	tail protein	tail	Q858V4	Yersinia_virus	63.6	9.0e-04
WP_000972097.1|1487219_1487753_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|1487783_1488311_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_001513292.1|1488326_1489295_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	38.8	6.5e-47
WP_001421220.1|1489420_1489603_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|1489801_1490470_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1490526_1490796_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001348267.1|1491207_1491765_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000443082.1|1492413_1493220_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1493219_1494413_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|1494424_1495783_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_023149386.1|1495786_1497382_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|1497381_1498944_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1499035_1499080_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|1499217_1500099_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1500095_1500716_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|1500743_1502639_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1502851_1503727_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_023141019.1|1503932_1504919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|1504928_1505237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|1505293_1505884_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|1505880_1506639_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|1506858_1507908_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 4
NZ_CP014316	Escherichia coli JJ1887 chromosome, complete genome	5081061	1999076	2087321	5081061	terminase,portal,capsid,transposase,tail,plate,holin,tRNA,integrase	Escherichia_phage(22.73%)	103	2044773:2044832	2087383:2087507
WP_099156422.1|1999076_2000425_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
WP_000568520.1|2000534_2001545_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2001553_2002165_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|2002303_2002369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024911.1|2002439_2003042_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2003043_2003565_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2003599_2004340_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|2004368_2004821_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|2004813_2006586_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|2006895_2007462_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|2007458_2008277_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2008329_2008725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|2008765_2009509_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|2009505_2010477_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|2010512_2012942_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|2012966_2014067_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|2014454_2015201_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|2015214_2015781_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2015996_2017730_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|2017782_2018175_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|2018174_2020253_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|2020245_2021394_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|2021582_2022227_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2022237_2022627_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2022641_2023691_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|2023693_2024554_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|2024844_2026506_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2026650_2027154_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|2027174_2029139_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|2029143_2030070_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|2030066_2030954_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2031080_2031659_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2031661_2032012_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|2032791_2033220_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|2033226_2034651_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|2034625_2035426_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987895.1|2035592_2036582_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|2036593_2038108_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|2038177_2039167_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2039961_2040465_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2040542_2040794_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2040908_2040995_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|2041258_2041582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|2041753_2042251_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2042288_2042528_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|2042718_2043930_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2043980_2044646_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2044773:2044832	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|2045117_2045537_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|2046751_2046976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531768.1|2047137_2047527_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|2047562_2049203_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|2049311_2049593_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|2049605_2050118_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000117510.1|2050135_2051638_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|2051634_2052024_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|2052023_2053208_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|2053200_2053827_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|2053829_2054750_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|2054746_2055088_-|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|2055090_2055993_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|2055973_2056510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2056506_2057187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|2057218_2057599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|2057595_2058015_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|2058049_2059084_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|2059142_2059472_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|2059471_2060779_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|2060778_2062353_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|2062349_2062583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|2062582_2064445_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|2064431_2064998_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|2065366_2065612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|2065671_2065866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|2065873_2066353_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|2066352_2066625_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|2066624_2067008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|2067120_2067792_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|2067791_2068085_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|2068081_2068678_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|2068755_2068935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2069086_2069728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|2069971_2070205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2070603_2071092_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|2071101_2071707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|2072169_2072868_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|2074054_2074978_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|2075152_2075941_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|2076622_2076847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2076843_2077155_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|2077151_2077388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|2077389_2077800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|2077838_2079254_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|2079243_2079999_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|2079995_2080220_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|2080259_2080736_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|2080794_2081025_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|2081123_2081537_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|2082547_2082868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|2082898_2085115_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|2085111_2085681_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|2085680_2085863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|2086072_2086336_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|2086304_2087321_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2087383:2087507	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 5
NZ_CP014316	Escherichia coli JJ1887 chromosome, complete genome	5081061	2105565	2183698	5081061	terminase,portal,capsid,transposase,tail,protease,head,holin,integrase	Escherichia_phage(40.0%)	95	2140341:2140356	2206700:2206715
WP_001347174.1|2105565_2106090_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_000879824.1|2106246_2107044_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|2107053_2107605_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|2107773_2108106_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|2108449_2108764_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994425.1|2108978_2110637_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2110629_2111625_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282677.1|2111617_2112304_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213308.1|2112303_2113677_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2113695_2114139_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620069.1|2114135_2115263_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2115367_2115832_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2115836_2116841_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282103.1|2116837_2117251_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001313947.1|2117253_2117619_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253318.1|2117618_2118356_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|2118365_2118635_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983988.1|2118643_2119429_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103992.1|2119718_2120342_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|2120385_2120628_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2120736_2120964_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491527.1|2121259_2122075_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001531784.1|2122071_2123766_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2123936_2124119_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2124197_2125115_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2125287_2126208_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|2126196_2126667_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157265.1|2126647_2128066_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001296176.1|2128132_2128828_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001330593.1|2128867_2129233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824383.1|2129798_2130914_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_000218217.1|2131506_2132358_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826711.1|2132465_2133824_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|2133823_2134495_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|2134627_2135041_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740067.1|2135149_2136154_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240063.1|2136154_2136790_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_099156434.1|2136873_2138222_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001007778.1|2138482_2139133_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000355363.1|2140216_2140504_-	hypothetical protein	NA	NA	NA	NA	NA
2140341:2140356	attL	TGCCCGAACATTTCGA	NA	NA	NA	NA
WP_000235978.1|2140514_2141219_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
WP_000654141.1|2141228_2141510_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001554173.1|2141509_2143888_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	76.1	1.9e-185
WP_000526135.1|2144008_2144467_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001228252.1|2144663_2145263_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_001554175.1|2145330_2148726_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_000741570.1|2148786_2149434_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	6.6e-112
WP_000140743.1|2149331_2150075_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
WP_001152448.1|2150080_2150779_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.8	3.8e-129
WP_001330090.1|2150778_2151135_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224009.1|2151112_2154340_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.7	0.0e+00
WP_071590020.1|2154386_2154647_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_001324129.1|2154688_2155075_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097526.1|2155074_2155779_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
WP_001206306.1|2155839_2156184_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_014639219.1|2156180_2156630_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
WP_001147814.1|2156626_2156965_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|2156973_2157291_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766111.1|2157367_2158585_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	4.5e-162
WP_000999828.1|2158599_2159199_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923132.1|2159191_2160418_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	1.5e-202
WP_001140907.1|2160565_2162323_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_001554177.1|2162322_2162805_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	7.4e-84
WP_001135103.1|2162952_2163303_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	4.7e-64
WP_000738421.1|2163828_2164122_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2164212_2164395_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992101.1|2164611_2165145_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_000193269.1|2165208_2165559_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.9e-36
WP_000372595.1|2165563_2165779_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|2166086_2166275_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_023281677.1|2166534_2166870_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000562553.1|2167150_2167282_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_021538919.1|2168177_2168999_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	1.5e-76
WP_000139998.1|2169013_2169376_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001296186.1|2169376_2170435_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	7.5e-89
WP_023141427.1|2170436_2170709_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|2170876_2171032_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_011076332.1|2171290_2171509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224667.1|2172122_2172305_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_000761442.1|2172398_2172812_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	4.6e-58
WP_001151210.1|2172812_2173235_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_000095675.1|2173275_2174238_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693943.1|2174260_2174686_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391951.1|2174669_2174951_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|2175051_2175471_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379575.1|2175736_2175892_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171947.1|2176051_2176270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296188.1|2176273_2176438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2176837_2177026_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070254.1|2177022_2177214_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_023363203.1|2177306_2179778_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000096342.1|2179836_2180040_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533615.1|2180039_2181065_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001311896.1|2181300_2182098_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060157.1|2182435_2183698_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
2206700:2206715	attR	TGCCCGAACATTTCGA	NA	NA	NA	NA
>prophage 6
NZ_CP014316	Escherichia coli JJ1887 chromosome, complete genome	5081061	2270237	2276689	5081061	transposase	Acidithiobacillus_phage(16.67%)	9	NA	NA
WP_001298859.1|2270237_2271779_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|2271793_2272540_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|2272988_2273399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|2273619_2274438_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|2274437_2274683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|2274776_2275250_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|2275265_2275742_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2275804_2276026_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|2276044_2276689_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
>prophage 7
NZ_CP014316	Escherichia coli JJ1887 chromosome, complete genome	5081061	2307492	2313795	5081061		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|2307492_2308035_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|2308039_2308918_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|2308975_2309875_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|2309874_2310960_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|2311332_2312226_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|2312400_2313795_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 8
NZ_CP014316	Escherichia coli JJ1887 chromosome, complete genome	5081061	2407971	2417416	5081061		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|2407971_2409108_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|2409104_2411108_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|2411232_2411694_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2411734_2412205_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2412251_2412971_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2412967_2414653_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|2414874_2415606_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|2415665_2415773_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|2415753_2416485_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|2416489_2417416_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 9
NZ_CP014316	Escherichia coli JJ1887 chromosome, complete genome	5081061	2655193	2667558	5081061	integrase,transposase	Enterobacteria_phage(44.44%)	13	2655015:2655034	2669143:2669162
2655015:2655034	attL	ATTCCTGCAGGGGACACCAT	NA	NA	NA	NA
WP_000926944.1|2655193_2656369_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	63.0	2.8e-145
WP_000287253.1|2656348_2657299_-	sce7725 family protein	NA	NA	NA	NA	NA
WP_000019149.1|2657320_2658202_-	sce7726 family protein	NA	NA	NA	NA	NA
WP_000080195.1|2658755_2660369_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|2660399_2660750_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2660746_2661172_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000239754.1|2661509_2661746_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	66.7	9.0e-19
WP_000783295.1|2662000_2662273_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	50.0	3.2e-20
WP_000856856.1|2662555_2665243_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	35.0	4.2e-112
WP_001063904.1|2665239_2665650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839713.1|2665642_2665879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111085.1|2665875_2666466_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	49.2	4.4e-22
WP_000270796.1|2666553_2667558_-	oxidoreductase	NA	F1BUM2	Cronobacter_phage	48.3	1.1e-81
2669143:2669162	attR	ATTCCTGCAGGGGACACCAT	NA	NA	NA	NA
>prophage 10
NZ_CP014316	Escherichia coli JJ1887 chromosome, complete genome	5081061	2884917	2974122	5081061	terminase,portal,tail,protease,lysis,tRNA	Enterobacteria_phage(52.54%)	95	NA	NA
WP_000083664.1|2884917_2885655_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2885786_2887121_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001296304.1|2887153_2888035_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2888137_2888725_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2888780_2889164_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|2889468_2890158_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997384.1|2890205_2891243_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2891449_2891869_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001296305.1|2891937_2892636_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082935.1|2892667_2895328_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001312028.1|2895441_2896797_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001467872.1|2896842_2897166_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852119.1|2897162_2898461_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
WP_001235102.1|2904247_2906821_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040156.1|2906950_2907682_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079111.1|2907678_2908659_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2908793_2909531_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2909800_2910142_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2910245_2910293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200140.1|2910391_2911552_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225212.1|2911594_2912716_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|2912726_2913797_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|2914006_2914372_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|2914518_2915037_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969008.1|2915026_2916253_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589791.1|2916268_2916751_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2916827_2917175_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264790.1|2917216_2917984_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2918014_2918563_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2918581_2918830_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2918966_2920328_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189256.1|2920419_2921286_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2921306_2922593_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2922646_2923240_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2923362_2924241_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880939.1|2924326_2925988_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2926136_2926478_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2926539_2926830_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2926819_2927296_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2927427_2927910_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000429347.1|2928787_2929057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000461705.1|2929194_2929557_-	type II toxin-antitoxin system RnlB family antitoxin	NA	NA	NA	NA	NA
WP_024190590.1|2929549_2930620_-	type II toxin-antitoxin system RnlA family toxin	NA	NA	NA	NA	NA
WP_001597763.1|2930679_2930835_-	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	92.6	2.2e-05
WP_023363231.1|2931020_2931605_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.4	5.0e-103
WP_023363234.1|2931604_2934631_-|tail	tail protein	tail	U5N099	Enterobacteria_phage	80.7	6.1e-67
WP_023363237.1|2934695_2935295_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.7e-109
WP_023363240.1|2935361_2938760_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.4	0.0e+00
WP_125271823.1|2938820_2939429_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.0	4.8e-104
WP_023363246.1|2939365_2940109_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_023363250.1|2940113_2940812_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.0	6.8e-131
WP_000447253.1|2940821_2941151_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_023363253.1|2941150_2944216_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.7	0.0e+00
WP_032164532.1|2944187_2944517_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	2.9e-55
WP_001300035.1|2944525_2944912_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211106.1|2944972_2945716_-|tail	tail protein	tail	K7PGT7	Enterobacteria_phage	100.0	1.6e-133
WP_023363259.1|2945726_2946128_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	5.4e-72
WP_000677106.1|2946124_2946703_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_023363262.1|2946714_2946990_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	5.0e-45
WP_001097045.1|2946982_2947306_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	100.0	8.5e-52
WP_023363265.1|2947393_2949421_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_023363268.1|2949365_2950874_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.2	1.9e-287
WP_001072975.1|2950873_2951086_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_023363271.1|2951082_2953185_-|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_023363274.1|2953184_2953679_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	4.9e-83
WP_001139681.1|2954354_2954507_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_001300226.1|2954494_2954962_-|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	100.0	2.9e-77
WP_000992100.1|2954958_2955492_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_000193288.1|2955555_2955906_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.9e-36
WP_000839596.1|2955910_2956126_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|2956193_2957246_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|2957396_2957600_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000217632.1|2957823_2958249_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_001547994.1|2958529_2959282_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	100.0	2.8e-138
WP_001439745.1|2959295_2960285_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	9.5e-195
WP_015967850.1|2960292_2961102_-	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	100.0	6.0e-155
WP_000767124.1|2961121_2961511_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	100.0	7.1e-69
WP_023363277.1|2961507_2961834_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	99.1	3.5e-53
WP_000066917.1|2961830_2962484_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_023363280.1|2962483_2962972_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	2.0e-84
WP_000061525.1|2962974_2963793_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	1.2e-121
WP_000620696.1|2963789_2964014_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_001087357.1|2964010_2965162_-	peptidase	NA	A0A0P0ZE80	Stx2-converting_phage	97.4	1.1e-210
WP_000515841.1|2965158_2965710_-	hypothetical protein	NA	K7PGU3	Enterobacteria_phage	98.4	4.9e-100
WP_023363283.1|2965702_2965963_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	6.0e-40
WP_001311077.1|2966060_2966753_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_000135680.1|2967475_2967838_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_023277820.1|2967903_2968728_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	4.3e-148
WP_023363286.1|2968856_2969393_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	4.1e-99
WP_001596853.1|2969383_2969746_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	97.5	1.5e-65
WP_001331173.1|2969742_2969958_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001331174.1|2970017_2970224_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001596854.1|2970184_2971351_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.2	1.8e-147
WP_001596855.1|2971409_2973143_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_023363292.1|2973222_2974122_+	DNA adenine methylase	NA	A0A0C5AMX6	Cyanophage	23.2	2.5e-08
>prophage 11
NZ_CP014316	Escherichia coli JJ1887 chromosome, complete genome	5081061	3042833	3049973	5081061		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|3042833_3045395_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|3045500_3046157_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001272542.1|3046207_3047005_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_000847996.1|3047170_3048079_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|3048075_3049338_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|3049334_3049973_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 12
NZ_CP014316	Escherichia coli JJ1887 chromosome, complete genome	5081061	3106081	3173465	5081061	tRNA,plate,transposase	uncultured_Caudovirales_phage(21.43%)	52	NA	NA
WP_000889999.1|3106081_3106864_-|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_000206991.1|3106863_3107193_-	YqcC family protein	NA	NA	NA	NA	NA
WP_000342445.1|3107814_3108360_-	SecY-interacting protein	NA	NA	NA	NA	NA
WP_000100405.1|3108427_3109276_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	6.1e-41
WP_000627995.1|3109387_3110752_+	nucleotide 5'-monophosphate nucleosidase	NA	NA	NA	NA	NA
WP_000450473.1|3111308_3112598_+	HAAAP family serine/threonine permease SdaC	NA	NA	NA	NA	NA
WP_000626404.1|3112655_3114023_+	L-serine ammonia-lyase II	NA	NA	NA	NA	NA
WP_001214578.1|3114044_3114890_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	1.2e-09
WP_001531913.1|3114994_3116143_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_000440772.1|3116170_3116818_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000528587.1|3117364_3118681_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000724161.1|3118713_3120489_+	L-fucose isomerase	NA	NA	NA	NA	NA
WP_001296331.1|3120597_3122016_+	L-fuculokinase	NA	NA	NA	NA	NA
WP_000920840.1|3122017_3122440_+	L-fucose mutarotase	NA	NA	NA	NA	NA
WP_000642344.1|3122497_3123229_+	L-fucose operon activator	NA	NA	NA	NA	NA
WP_001045520.1|3123272_3124373_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_000203905.1|3124365_3124761_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_000044405.1|3124779_3125697_-	glycine cleavage system transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_000750398.1|3126047_3126275_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_001296332.1|3126466_3127672_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.2	4.6e-74
WP_000184272.1|3127671_3128115_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117716.1|3128165_3128972_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.9e-16
WP_000678650.1|3129048_3130146_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_001296334.1|3131286_3131787_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001296335.1|3131845_3133384_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000690901.1|3133401_3134739_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000712316.1|3134735_3135401_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_001243155.1|3135413_3137066_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000997068.1|3137123_3137615_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000147344.1|3137805_3140442_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.4	3.2e-96
WP_001576295.1|3140453_3142778_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.0	1.9e-15
WP_000587242.1|3142789_3145153_+	hypothetical protein	NA	A7IYC3	Corynebacterium_phage	27.3	8.8e-05
WP_001531916.1|3145149_3146007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021543768.1|3146470_3148849_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.0	1.9e-15
WP_000093702.1|3148851_3149673_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_000522562.1|3149716_3150244_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_000622634.1|3150240_3152109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354273.1|3152214_3154728_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	45.3	4.1e-08
WP_000764086.1|3154749_3155352_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001378343.1|3155454_3155904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145241.1|3155981_3157196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298859.1|3159015_3160557_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|3160571_3161318_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_012896833.1|3163163_3164774_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001531920.1|3164779_3166198_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000199056.1|3166190_3166613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342475.1|3167172_3168933_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_023363303.1|3168896_3169976_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000080195.1|3170304_3171918_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|3171948_3172299_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3172295_3172721_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000106968.1|3173036_3173465_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 13
NZ_CP014316	Escherichia coli JJ1887 chromosome, complete genome	5081061	3301782	3363871	5081061	integrase,protease,tRNA,transposase	Staphylococcus_phage(33.33%)	53	3302991:3303008	3363268:3363285
WP_001296354.1|3301782_3302541_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|3302970_3303891_-	agmatinase	NA	NA	NA	NA	NA
3302991:3303008	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000758881.1|3304026_3304758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3304903_3306880_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3306888_3307020_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|3307155_3307371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3307674_3308829_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3309264_3310659_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001296359.1|3310735_3311233_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|3311327_3312035_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3312114_3312846_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|3312858_3313809_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000126441.1|3313845_3314481_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|3314480_3314897_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|3315011_3315992_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3316009_3316714_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3316731_3317298_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|3317294_3317585_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|3317592_3318186_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|3318178_3319315_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|3319629_3320616_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|3320660_3321164_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|3321163_3322465_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|3322520_3323528_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|3323644_3324691_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3324866_3325586_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|3325606_3325747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|3325769_3326096_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|3326095_3326815_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|3326975_3328028_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|3328055_3328331_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3328395_3329475_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|3329676_3330933_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839781.1|3330981_3333117_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|3333509_3334217_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|3334595_3335861_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|3336116_3337160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|3338853_3339405_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000006213.1|3341895_3342129_+	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_023146305.1|3342595_3342811_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
WP_099156432.1|3342779_3343906_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_001513409.1|3343996_3344110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110186.1|3345943_3346204_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|3346245_3346806_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|3346845_3347274_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|3347991_3349185_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|3349320_3351045_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|3351045_3351993_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|3351992_3353735_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|3353731_3355009_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|3355090_3357292_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001034083.1|3358235_3362123_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|3362719_3363871_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
3363268:3363285	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
>prophage 1
NZ_CP014321	Escherichia coli JJ1887 plasmid pJJ1887-4, complete sequence	107507	42290	100762	107507	integrase,protease,transposase	Macacine_betaherpesvirus(25.0%)	58	31463:31522	94597:95366
31463:31522	attL	CTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAA	NA	NA	NA	NA
WP_001067855.1|42290_42995_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000476108.1|44914_46225_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000950177.1|46217_47291_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000922702.1|47296_48121_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_001271561.1|48131_49019_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000338039.1|49008_49887_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_000796505.1|50431_50626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001077068.1|50858_51749_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000710783.1|51773_52154_+	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_001022265.1|52186_53152_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000562172.1|53197_53950_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001387467.1|54554_54839_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421272.1|54838_55114_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105060.1|55219_55513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|55708_56878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361402.1|58917_59940_-	helicase UvrD	NA	NA	NA	NA	NA
WP_001128474.1|59924_61490_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001034044.1|61564_61981_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261286.1|61977_62208_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001542068.1|62558_66383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001034046.1|66427_66844_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261278.1|66840_67071_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000528932.1|67335_67836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000905949.1|67848_68622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|68832_70446_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|70476_70827_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|70823_71249_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_031325939.1|71310_72462_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000151784.1|72495_73008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813634.1|73553_73772_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|73773_74079_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016982.1|74079_74886_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|75659_76415_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|77002_78169_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817036.1|78168_79140_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_106426161.1|79937_80879_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086185.1|81292_81976_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001104873.1|81976_82198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274437.1|82211_82646_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001671341.1|84012_84315_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271753.1|84361_84784_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027516.1|84780_84972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|86006_86237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170728.1|86288_87650_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_012783964.1|87696_88260_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
WP_032140903.1|88704_88896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290793.1|89123_89651_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	54.3	6.7e-46
WP_000006004.1|89706_89940_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
WP_001145469.1|89998_91957_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	4.7e-20
WP_000845901.1|92011_92446_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276234.1|92442_93162_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001299721.1|93173_93362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|93441_93600_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001067855.1|93950_94655_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000616807.1|96701_97355_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
94597:95366	attR	TTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCGTGAAATTGCCCGGCCCTCAGACGATAATTTTCATGAAGAAATGGTGGAGCAGTACGGGCGCGTTCGTCGTTTCCTGCCCCATCTGCTGAATACCGTTAAATTTTCATCCGCACCTGCCGGGGTTACCACTCTGAATGCCTGTGACTACCTCAGCCGGGAGTTCAGCTCACGGCGGCAGTTTTTTGACGACGCACCAACGGAAATTATCAGTCGGTCATGGAAACGGCTGGTGATTAACAAGGAAAAACATATCACCCGCAGGGGATACACGCTCTGCTTTCTCAGTAAACTGCAGGATAGTCTGAGGCGGAGGGATGTCTACGTTACCGGCAGTAACCGGTGGGGAGATCCTCGTGCAAGATTACTACAGGGTGCTGACTGGCAGGCAAACCGGATTAAGGTTTATCGTTCTTTGGGGCACCCGACAGACCCGCAGGAAGCAATAAAATCTCTGGGTCATCAGCTTGATAGTCGTTACAGACAGGTTGCTGCACGTCTTTGCGAAAATGAGGCTGTCGAACTCGATGTTTCTGGCCCGAAGCCCCGGTTGACAATTTCTCCCCTCGCCAGTCTTGATGAGCCGGACAGTCTGAAACGACTGAGCAAAATGATCAGTGATCTACTCCCTCCGGTGGATTTAACGGAGTTGCTGCTCGA	NA	NA	NA	NA
WP_000557619.1|97447_97705_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|97637_98039_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|100057_100762_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP014320	Escherichia coli JJ1887 plasmid pJJ1887-5, complete sequence	130603	58872	96162	130603	transposase,integrase	Escherichia_phage(40.0%)	35	95387:95402	97341:97356
WP_000179213.1|58872_59148_+|transposase	IS1 family transposase	transposase	Q71TE9	Escherichia_phage	98.9	2.0e-46
WP_001119356.1|59066_59570_+|transposase	IS1 family transposase	transposase	U5P0U6	Shigella_phage	99.4	3.7e-94
WP_000562370.1|60267_60588_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|60580_60967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|60974_61661_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|61638_62262_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|62343_63549_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|63661_64255_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_061856962.1|64768_65986_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	2.0e-226
WP_087758690.1|66007_67127_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_039052454.1|68110_68887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039052447.1|68888_71153_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_039052448.1|71495_72476_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	97.2	2.9e-180
WP_039052449.1|73984_74377_-	plasmid stability protein	NA	NA	NA	NA	NA
WP_039052450.1|74381_75353_-	plasmid segregation protein parM	NA	A0A222YXF2	Escherichia_phage	42.6	9.7e-67
WP_000633913.1|75581_76226_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|76219_76495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157916581.1|77114_77354_-	resolvase	NA	NA	NA	NA	NA
WP_039052451.1|77460_78069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039052452.1|78138_78489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246635.1|79166_80162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991831.1|80165_81098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586223.1|81390_81576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024187432.1|81576_82479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586225.1|82480_83350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586226.1|83406_84972_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001586228.1|85258_85771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545985.1|85804_86938_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_001403958.1|87905_88391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001586230.1|88781_91403_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.7	5.9e-18
WP_001261274.1|91601_91832_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000348883.1|92418_92949_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001275013.1|92952_93222_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_123002471.1|94109_95099_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.7	2.5e-102
95387:95402	attL	ACCACAGCTTATATAA	NA	NA	NA	NA
WP_001586233.1|95421_96162_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.9	5.4e-25
WP_001586233.1|95421_96162_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.9	5.4e-25
97341:97356	attR	ACCACAGCTTATATAA	NA	NA	NA	NA
