The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	0	12661	4167153		Tupanvirus(100.0%)	1	NA	NA
WP_062623373.1|4963_12661_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	25.8	2.5e-149
>prophage 2
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	20331	34929	4167153		Tupanvirus(100.0%)	2	NA	NA
WP_062623371.1|20331_31107_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	25.3	2.0e-160
WP_039251325.1|31125_34929_+	non-ribosomal peptide synthase	NA	A0A2K9KZV5	Tupanvirus	26.4	1.8e-84
>prophage 3
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	38371	40012	4167153		Hepacivirus(100.0%)	1	NA	NA
WP_039251333.1|38371_40012_+	AMP-binding protein	NA	Q75ZG1	Hepacivirus	26.7	5.9e-48
>prophage 4
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	45565	50413	4167153		Bacillus_phage(33.33%)	5	NA	NA
WP_015417581.1|45565_46459_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	56.0	3.1e-83
WP_014418060.1|46465_46873_-	GtrA family protein	NA	NA	NA	NA	NA
WP_015417580.1|47149_47920_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_015417579.1|47916_49263_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	23.2	2.3e-13
WP_015417578.1|49252_50413_+	8-amino-7-oxononanoate synthase	NA	D2TEZ5	Emiliania_huxleyi_virus	27.1	1.2e-31
>prophage 5
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	59050	95077	4167153		Tupanvirus(100.0%)	3	NA	NA
WP_062623370.1|59050_70999_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.9	9.0e-114
WP_062623369.1|71043_87132_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	26.9	1.0e-88
WP_039251357.1|87220_95077_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.3	8.3e-100
>prophage 6
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	98430	100904	4167153		Bacillus_phage(33.33%)	3	NA	NA
WP_017417897.1|98430_99138_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.5	3.1e-38
WP_031379071.1|99140_100541_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	23.9	9.9e-12
WP_007410147.1|100592_100904_-	DUF4870 domain-containing protein	NA	A0A2H4J741	uncultured_Caudovirales_phage	41.7	5.9e-10
>prophage 7
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	105056	105677	4167153		Planktothrix_phage(100.0%)	1	NA	NA
WP_031379076.1|105056_105677_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.0	9.7e-28
>prophage 8
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	110013	112219	4167153		Bacillus_phage(100.0%)	2	NA	NA
WP_031379081.1|110013_111120_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	32.4	7.7e-52
WP_031379082.1|111883_112219_+	hypothetical protein	NA	A0A1P8CWM9	Bacillus_phage	55.7	9.2e-25
>prophage 9
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	118733	119735	4167153		Enterobacteria_phage(100.0%)	1	NA	NA
WP_015417557.1|118733_119735_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	27.3	1.4e-23
>prophage 10
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	126935	131329	4167153		Bacillus_phage(50.0%)	2	NA	NA
WP_053573356.1|126935_129359_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	33.1	5.7e-100
WP_007611767.1|129361_131329_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	1.4e-125
>prophage 11
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	146490	157096	4167153		Bacillus_phage(66.67%)	13	NA	NA
WP_003154004.1|146490_147111_+	repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.3	8.5e-16
WP_015417546.1|147450_147879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154009.1|148032_148482_+	YndM family protein	NA	NA	NA	NA	NA
WP_007410333.1|148509_149340_-	prohibitin family protein	NA	A0A172JI70	Bacillus_phage	73.1	2.2e-104
WP_007410334.1|149326_149476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039251404.1|149583_150405_-	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	43.0	1.4e-50
WP_003154017.1|150812_151247_-	dUTP diphosphatase	NA	A0A1P8CX51	Bacillus_phage	85.9	2.3e-68
WP_039251405.1|151624_154042_+	peptidase G2	NA	D6R401	Bacillus_phage	50.4	3.2e-220
WP_162492831.1|154210_154372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007410338.1|154656_155193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033574803.1|155530_156070_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003154022.1|156212_156311_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003154023.1|156475_157096_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	36.9	1.3e-19
>prophage 12
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	161450	169895	4167153		Bacillus_phage(33.33%)	6	NA	NA
WP_039254920.1|161450_161867_-	UPF0715 family protein	NA	O64087	Bacillus_phage	68.8	2.9e-20
WP_039251415.1|162049_162295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032871559.1|163682_164699_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	28.4	2.4e-31
WP_003154035.1|165657_165843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072589120.1|166656_166755_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_039251420.1|167297_169895_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	4.8e-44
>prophage 13
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	179583	182563	4167153		Bacillus_phage(100.0%)	3	NA	NA
WP_033574792.1|179583_179994_-	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	89.7	4.1e-67
WP_039251434.1|180081_180540_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_031379094.1|182005_182563_-	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	82.7	4.7e-90
>prophage 14
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	188059	194272	4167153		Bacillus_phage(50.0%)	6	NA	NA
WP_015417523.1|188059_189028_-	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	40.9	8.0e-53
WP_039251438.1|189334_190093_+	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	50.0	3.1e-52
WP_039251439.1|190141_190762_-	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	47.9	2.1e-46
WP_012117608.1|190810_191800_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	83.0	1.1e-155
WP_007611605.1|191817_193920_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	85.7	0.0e+00
WP_015417520.1|193879_194272_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	59.1	3.8e-30
>prophage 15
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	198665	267527	4167153		Paenibacillus_phage(62.5%)	12	NA	NA
WP_039251443.1|198665_199373_-	poly-gamma-glutamate hydrolase family protein	NA	F8WQ53	Bacillus_phage	54.1	3.5e-50
WP_015239897.1|199628_199862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039251445.1|200040_201369_+	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	35.3	2.0e-30
WP_007410383.1|201561_201924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003154084.1|201957_202713_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_012117601.1|202772_203207_-	sporulation protein	NA	F8WPS9	Bacillus_phage	56.5	8.5e-39
WP_039254928.1|203495_204707_+	cytochrome P450	NA	NA	NA	NA	NA
WP_062623367.1|204843_212301_-	polyketide synthase dehydratase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	30.1	6.6e-38
WP_039251451.1|212314_228613_-	non-ribosomal peptide synthetase	NA	D0R7J2	Paenibacillus_phage	58.3	1.2e-121
WP_039251452.1|228602_239150_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.1	3.8e-39
WP_062623366.1|239167_252574_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	30.0	6.9e-38
WP_062623365.1|252575_267527_-	non-ribosomal peptide synthetase	NA	D0R7J2	Paenibacillus_phage	59.8	1.8e-127
>prophage 16
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	275260	275938	4167153		Streptococcus_phage(100.0%)	1	NA	NA
WP_003154103.1|275260_275938_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	26.3	1.4e-11
>prophage 17
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	280064	285209	4167153	integrase	Bacillus_phage(33.33%)	3	277734:277747	282716:282729
277734:277747	attL	TAAAGAAAAACAAG	NA	NA	NA	NA
WP_052250227.1|280064_280682_+|integrase	site-specific integrase	integrase	A0A1C8E994	Bacillus_phage	40.1	4.0e-34
WP_039251463.1|280733_282608_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	31.1	1.9e-66
WP_040238969.1|282623_285209_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.6	1.0e-38
282716:282729	attR	CTTGTTTTTCTTTA	NA	NA	NA	NA
>prophage 18
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	288233	296287	4167153		Bacillus_phage(40.0%)	7	NA	NA
WP_029325912.1|288233_289412_-	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	32.8	2.7e-47
WP_039251466.1|289424_290471_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	58.0	9.0e-10
WP_003154135.1|290728_290989_-	stage V sporulation protein SpoVS	NA	J9PTX7	Bacillus_phage	42.5	1.2e-08
WP_003154137.1|291188_291983_-	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_003154140.1|292043_293603_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_039251468.1|293895_295077_-	serine hydrolase	NA	A0A076YK70	Mycobacterium_phage	27.3	7.0e-11
WP_039251470.1|295243_296287_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	72.3	3.3e-137
>prophage 19
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	301333	303897	4167153		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_039251479.1|301333_302620_-	insulinase family protein	NA	A0A2H4UVM3	Bodo_saltans_virus	26.8	6.7e-07
WP_015417495.1|302616_303897_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	27.8	2.8e-45
>prophage 20
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	309920	312281	4167153		Mycobacterium_phage(100.0%)	1	NA	NA
WP_061861466.1|309920_312281_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	50.0	7.1e-87
>prophage 21
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	320673	321909	4167153		Bacillus_virus(100.0%)	1	NA	NA
WP_012117570.1|320673_321909_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	31.4	5.2e-49
>prophage 22
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	325753	337312	4167153	tRNA	Indivirus(33.33%)	10	NA	NA
WP_007611467.1|325753_326695_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	29.8	6.9e-09
WP_042635200.1|326714_327644_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003154185.1|327728_328082_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_003154188.1|328098_328377_-	DUF503 domain-containing protein	NA	NA	NA	NA	NA
WP_062623360.1|328373_330515_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	25.7	4.5e-24
WP_003154192.1|330534_330837_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_003154193.1|330838_331114_-	glucose-induced regulator RulR	NA	NA	NA	NA	NA
WP_003154195.1|331127_332249_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_007409801.1|332288_332759_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_061861464.1|332998_337312_-	PolC-type DNA polymerase III	NA	A0A0A7RWA3	Clostridium_phage	31.8	6.3e-25
>prophage 23
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	342432	343215	4167153		Flavobacterium_phage(100.0%)	1	NA	NA
WP_007611457.1|342432_343215_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	40.7	4.3e-25
>prophage 24
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	347134	347899	4167153		Salisaeta_icosahedral_phage(100.0%)	1	NA	NA
WP_003154217.1|347134_347899_-	RNA polymerase sigma-28 factor SigD	NA	I1ZBD5	Salisaeta_icosahedral_phage	27.4	1.0e-07
>prophage 25
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	374145	380561	4167153	tRNA,protease	Erwinia_phage(33.33%)	5	NA	NA
WP_007611413.1|374145_375549_-	HslU--HslV peptidase ATPase subunit	NA	A0A2H5BJT2	Erwinia_phage	27.5	4.1e-42
WP_003154267.1|375565_376111_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_039251511.1|376126_377044_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	3.4e-29
WP_012117550.1|377113_378421_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_060675465.1|378485_380561_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.6	1.1e-104
>prophage 26
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	385968	386736	4167153		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_060675462.1|385968_386736_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.6	6.1e-24
>prophage 27
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	397978	399925	4167153		Micromonas_pusilla_virus(33.33%)	3	NA	NA
WP_007409760.1|397978_398728_-	ribonuclease III	NA	M4QMG4	Micromonas_pusilla_virus	35.9	5.4e-25
WP_003154310.1|398866_399100_-	acyl carrier protein	NA	M4M9G2	Vibrio_phage	44.9	7.1e-08
WP_003154312.1|399184_399925_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	2.0e-19
>prophage 28
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	411335	413279	4167153		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_062623348.1|411335_413279_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1B1IUU3	uncultured_Mediterranean_phage	35.6	5.9e-23
>prophage 29
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	416464	426453	4167153	tRNA	Prochlorococcus_phage(20.0%)	9	NA	NA
WP_062623345.1|416464_417418_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.8	8.2e-10
WP_003154343.1|417422_417905_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	45.0	4.9e-19
WP_014304990.1|417929_420341_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_062623344.1|420337_421558_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.7	2.3e-41
WP_003154346.1|421648_421852_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_025851320.1|421855_422470_-	guanylate kinase	NA	S4W1R9	Pandoravirus	32.6	2.4e-10
WP_003154355.1|422477_422747_-	extracellular matrix/biofilm regulator RemA	NA	NA	NA	NA	NA
WP_032856820.1|422823_423699_-	YicC family protein	NA	NA	NA	NA	NA
WP_062623343.1|423780_426453_-	calcium-translocating P-type ATPase, SERCA-type	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	29.8	1.0e-89
>prophage 30
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	430744	432500	4167153		Tupanvirus(100.0%)	2	NA	NA
WP_007611313.1|430744_431338_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	42.0	2.3e-26
WP_007409738.1|431351_432500_-	sulfate adenylyltransferase	NA	A0A2K9L4R9	Tupanvirus	30.1	9.8e-42
>prophage 31
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	440879	451262	4167153	tRNA	Halovirus(25.0%)	9	NA	NA
WP_007409730.1|440879_441974_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	38.7	1.8e-61
WP_060675452.1|441970_443257_-	dihydroorotase	NA	NA	NA	NA	NA
WP_062623340.1|443240_444155_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	38.6	1.7e-36
WP_025284702.1|444297_445608_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	35.2	6.5e-58
WP_003154392.1|445761_446307_-	bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_007611300.1|446495_447410_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_053573420.1|447411_447873_-	signal peptidase II	NA	NA	NA	NA	NA
WP_007409725.1|447974_448346_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_062623339.1|448496_451262_-|tRNA	isoleucine--tRNA ligase	tRNA	H2EEZ0	Moumouvirus	27.0	3.3e-83
>prophage 32
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	457230	465297	4167153		Bacillus_phage(50.0%)	5	NA	NA
WP_015417427.1|457230_458028_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.5	2.5e-12
WP_003154420.1|458156_458939_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.1	2.2e-45
WP_007409714.1|459079_459799_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	41.4	8.1e-18
WP_039251558.1|459856_460786_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_039251560.1|461001_465297_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	33.6	5.9e-23
>prophage 33
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	486353	486929	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_003154450.1|486353_486929_-	sporulation-specific transcriptional regulator GerR	NA	A0A1D6X8E5	Bacillus_phage	29.5	2.8e-05
>prophage 34
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	490308	497102	4167153		Catovirus(25.0%)	10	NA	NA
WP_007409696.1|490308_491088_-	patatin family protein	NA	A0A1V0SCG0	Catovirus	27.4	4.3e-09
WP_040238175.1|491267_492494_+	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
WP_007409694.1|492512_492995_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	39.9	1.6e-25
WP_007409693.1|492999_493554_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003154470.1|493852_494125_-	YlbG family protein	NA	NA	NA	NA	NA
WP_003154472.1|494183_494633_-	YlbF family regulator	NA	NA	NA	NA	NA
WP_003154475.1|494703_494943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409691.1|494958_495369_-	YlbD family protein	NA	NA	NA	NA	NA
WP_039251566.1|495533_496574_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.0	3.4e-17
WP_017417724.1|496658_497102_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	34.7	1.8e-12
>prophage 35
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	511809	516485	4167153		Vibrio_phage(50.0%)	5	NA	NA
WP_015417407.1|511809_513138_-	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	33.6	7.6e-54
WP_014417659.1|513292_513916_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_007409677.1|514018_514228_+	YlaI family protein	NA	NA	NA	NA	NA
WP_039251570.1|514269_514590_-	YlaH-like family protein	NA	NA	NA	NA	NA
WP_007409675.1|514646_516485_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	38.8	3.8e-19
>prophage 36
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	528831	530244	4167153		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_033574600.1|528831_530244_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.6	7.5e-44
>prophage 37
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	534266	535358	4167153		Mycobacterium_phage(100.0%)	1	NA	NA
WP_015417396.1|534266_535358_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	28.0	7.2e-10
>prophage 38
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	539292	546672	4167153		Paenibacillus_phage(100.0%)	1	NA	NA
WP_039251579.1|539292_546672_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	33.2	7.4e-42
>prophage 39
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	552406	568106	4167153		Paenibacillus_phage(100.0%)	2	NA	NA
WP_040238182.1|552406_559411_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	30.2	3.6e-38
WP_062623330.1|559403_568106_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.1	1.0e-34
>prophage 40
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	572925	585180	4167153		Paenibacillus_phage(100.0%)	1	NA	NA
WP_062623328.1|572925_585180_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.6	1.6e-33
>prophage 41
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	589137	589692	4167153		Synechococcus_phage(100.0%)	1	NA	NA
WP_003154544.1|589137_589692_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.0	1.6e-13
>prophage 42
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	597663	597948	4167153		Paenibacillus_phage(100.0%)	1	NA	NA
WP_003154557.1|597663_597948_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	50.0	2.6e-12
>prophage 43
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	601817	603437	4167153		Tupanvirus(100.0%)	1	NA	NA
WP_015417383.1|601817_603437_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.5	8.4e-47
>prophage 44
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	609671	610364	4167153		Planktothrix_phage(100.0%)	1	NA	NA
WP_007409637.1|609671_610364_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	1.0e-33
>prophage 45
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	618908	619367	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_015417374.1|618908_619367_-	redoxin domain-containing protein	NA	A0A127AW88	Bacillus_phage	47.2	1.9e-33
>prophage 46
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	622788	624627	4167153		Bacillus_phage(100.0%)	3	NA	NA
WP_033574618.1|622788_623244_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	31.1	9.0e-15
WP_033574619.1|623270_624164_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_012117440.1|624153_624627_-	flavodoxin	NA	A7KUZ7	Bacillus_phage	35.7	1.8e-13
>prophage 47
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	630027	630792	4167153		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_003154618.1|630027_630792_-	2,4-dienoyl-CoA reductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	39.4	6.7e-39
>prophage 48
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	634367	645230	4167153		Bacillus_thuringiensis_phage(25.0%)	8	NA	NA
WP_039251615.1|634367_635279_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	33.8	2.3e-46
WP_007409608.1|635467_635629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007611083.1|635829_636999_+	aminotransferase A	NA	NA	NA	NA	NA
WP_015417363.1|637023_638844_-	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.6	1.3e-08
WP_039251618.1|639021_641154_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_039251620.1|641494_642280_+	hypothetical protein	NA	U5Q0C0	Bacillus_phage	63.8	2.4e-39
WP_025284653.1|642315_643182_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_040238202.1|643262_645230_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.6	3.1e-11
>prophage 49
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	648874	650971	4167153		Vibrio_phage(100.0%)	1	NA	NA
WP_007409599.1|648874_650971_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	45.8	2.0e-08
>prophage 50
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	654575	659368	4167153		Streptococcus_phage(50.0%)	4	NA	NA
WP_007409595.1|654575_656489_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	37.8	2.2e-110
WP_007409594.1|656731_657226_-	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_007409593.1|657288_658629_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_015417352.1|658744_659368_-	cell wall hydrolase	NA	A0A141HRV8	Bacillus_phage	55.4	4.4e-28
>prophage 51
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	664087	673123	4167153	protease	Trichoplusia_ni_ascovirus(20.0%)	9	NA	NA
WP_015417347.1|664087_664834_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.7	1.0e-15
WP_015417346.1|665002_665359_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003154673.1|665778_666273_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	73.2	1.1e-55
WP_015239741.1|666290_667022_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	47.2	4.4e-56
WP_007408455.1|667014_667458_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_003154679.1|667458_668118_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	59.4	6.6e-67
WP_062623324.1|668368_669490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015417344.1|669587_670625_-	transporter	NA	NA	NA	NA	NA
WP_040238219.1|671026_673123_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	42.4	1.9e-128
>prophage 52
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	682373	686501	4167153		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_003154702.1|682373_683153_+	carbon-nitrogen family hydrolase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	27.2	6.1e-11
WP_039251664.1|683509_684694_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_039251667.1|684700_685762_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_015417335.1|686003_686501_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	46.5	1.1e-18
>prophage 53
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	694366	699844	4167153		Bacillus_phage(66.67%)	6	NA	NA
WP_039251672.1|694366_694561_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	65.5	3.6e-13
WP_007407209.1|694567_695737_-	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_003154719.1|695733_696489_-	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_039251676.1|696765_697548_-	TerC family protein	NA	A0A068EP98	Bacillus_phage	42.1	5.3e-31
WP_172437942.1|697793_698429_-	DedA family protein	NA	NA	NA	NA	NA
WP_007610913.1|698962_699844_+	Ku protein	NA	A0A218M9C0	Mycobacterium_phage	36.8	3.0e-43
>prophage 54
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	708398	712830	4167153		Planktothrix_phage(50.0%)	4	NA	NA
WP_040238223.1|708398_710036_+	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.1	4.5e-16
WP_040238225.1|710010_710772_+	CbiQ family ECF transporter T component	NA	NA	NA	NA	NA
WP_039251693.1|710817_711651_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_031378790.1|711870_712830_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	51.2	1.2e-72
>prophage 55
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	722702	726331	4167153		Streptococcus_phage(66.67%)	3	NA	NA
WP_015417313.1|722702_723950_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	50.1	8.0e-98
WP_060675386.1|723946_725059_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	43.2	3.2e-74
WP_007407234.1|725428_726331_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	36.2	1.2e-15
>prophage 56
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	730605	732480	4167153		Bacillus_virus(50.0%)	2	NA	NA
WP_007610864.1|730605_731577_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	35.6	5.2e-20
WP_060675388.1|731580_732480_-	C40 family peptidase	NA	A0A0A8WIF2	Clostridium_phage	43.0	4.5e-18
>prophage 57
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	736219	737248	4167153		Planktothrix_phage(100.0%)	1	NA	NA
WP_033575301.1|736219_737248_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.3e-16
>prophage 58
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	741949	744632	4167153		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_031378806.1|741949_743299_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	33.7	4.1e-23
WP_014417532.1|743398_743575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007610846.1|743660_744632_-	glycosyltransferase family 2 protein	NA	A0A2H5BFL1	Salmonella_phage	41.6	3.8e-63
>prophage 59
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	752754	784622	4167153	plate,tail,terminase,holin,portal,capsid	Bacillus_phage(34.48%)	42	NA	NA
WP_007407257.1|752754_753633_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	60.5	3.7e-81
WP_003154813.1|753646_753910_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	65.5	2.3e-23
WP_003154815.1|753923_754187_-	hemolysin XhlA family protein	NA	A0A2H4JD40	uncultured_Caudovirales_phage	63.1	8.8e-23
WP_033575307.1|754238_755000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012117366.1|755056_755254_-	XkdX family protein	NA	A0A2H4JAA1	uncultured_Caudovirales_phage	63.6	2.5e-14
WP_015417295.1|755258_755630_-	YomQ/XkdW protein, phage-like element PBSX	NA	NA	NA	NA	NA
WP_015417294.1|755642_757274_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	33.5	3.5e-53
WP_003154822.1|757276_757549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015239689.1|757545_758124_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.9	3.1e-12
WP_060561805.1|758107_759154_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	43.8	1.7e-69
WP_015417292.1|759146_759572_-	DUF2634 domain-containing protein	NA	A0A2H4J6K5	uncultured_Caudovirales_phage	35.9	3.3e-11
WP_007610818.1|759675_759942_-	DUF2577 family protein	NA	S6C459	Thermus_phage	38.6	1.2e-06
WP_015417291.1|759941_760919_-	hypothetical protein	NA	A0A1L6BY20	Clostridium_phage	30.6	6.4e-34
WP_015239684.1|765888_766041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154836.1|766082_766529_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.0e-10
WP_003154837.1|766605_767049_-|tail	phage tail tube protein	tail	A0A0K2CNG3	Brevibacillus_phage	45.2	8.4e-26
WP_007610810.1|767050_768448_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7RTT5	Clostridium_phage	40.4	9.0e-82
WP_007610809.1|768447_768657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015417289.1|768653_769100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040238248.1|769096_769600_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	41.1	2.7e-36
WP_007407272.1|769596_769953_-	DUF3599 family protein	NA	NA	NA	NA	NA
WP_015417287.1|769949_770333_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_007407274.1|770349_771285_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	62.8	3.3e-104
WP_007407275.1|771311_772157_-|portal	phage portal protein	portal	A0A1B1P7E4	Bacillus_phage	58.1	2.5e-55
WP_154019770.1|772176_773568_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	55.8	1.2e-137
WP_033574559.1|773616_774915_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	59.2	2.1e-149
WP_007407278.1|774911_775709_-|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	49.8	4.0e-58
WP_012117362.1|775821_776334_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CNQ1	Brevibacillus_phage	44.6	2.9e-22
WP_007407280.1|776447_776651_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	50.0	1.9e-12
WP_007407281.1|776640_776982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095352209.1|777079_777247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031378815.1|777246_778047_-	ATP-binding protein	NA	A6XMI1	Bacillus_virus	45.3	3.0e-58
WP_040238252.1|777946_778774_-	hypothetical protein	NA	S6BFM4	Thermus_phage	49.0	2.2e-19
WP_031378816.1|778763_778943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003154871.1|779133_779472_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.8	8.4e-18
WP_007610775.1|779620_780211_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	51.7	3.0e-39
WP_040238256.1|780232_781069_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_015417281.1|781139_781742_-	poly-gamma-glutamate hydrolase family protein	NA	A0A0Y0AJU6	Bacillus_phage	48.3	7.9e-43
WP_007610770.1|781851_782229_+	PH domain-containing protein	NA	A5GYQ0	Lactococcus_phage	41.4	1.5e-15
WP_015417280.1|782265_783219_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A218KC88	Bacillus_phage	69.3	1.1e-62
WP_003154881.1|783361_783496_-	PhrA family phosphatase inhibitor	NA	NA	NA	NA	NA
WP_087920760.1|783485_784622_-	S9 family peptidase	NA	A0A1P8CWN8	Bacillus_phage	47.9	1.3e-94
>prophage 60
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	796979	800912	4167153		Bacillus_phage(66.67%)	5	NA	NA
WP_039251831.1|796979_797717_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	34.3	2.4e-17
WP_039251832.1|797718_798480_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_039251834.1|798505_799324_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_003154919.1|799499_799685_+	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	75.9	2.6e-21
WP_031378841.1|799727_800912_-	UDP-glucosyltransferase	NA	Q0IKX4	Leucania_separata_nucleopolyhedrovirus	30.2	7.3e-08
>prophage 61
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	807579	808215	4167153		Bacillus_virus(100.0%)	1	NA	NA
WP_007407316.1|807579_808215_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	50.4	6.2e-22
>prophage 62
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	815563	816556	4167153		Tupanvirus(100.0%)	1	NA	NA
WP_039251866.1|815563_816556_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	36.3	1.5e-46
>prophage 63
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	822034	822955	4167153		Salmonella_phage(100.0%)	1	NA	NA
WP_095352227.1|822034_822955_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	47.9	7.1e-59
>prophage 64
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	835852	856231	4167153	coat,transposase	Bacillus_phage(40.0%)	26	NA	NA
WP_062623318.1|835852_837631_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	54.4	2.4e-111
WP_061861370.1|837642_838035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623317.1|838405_838708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623316.1|838841_840194_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	40.9	5.5e-84
WP_061861368.1|840709_841066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052827270.1|841521_842697_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_012117314.1|842689_843811_-	methionine biosynthesis PLP-dependent protein	NA	A0A0B5JD48	Pandoravirus	26.7	3.3e-18
WP_007409075.1|844179_844902_+	esterase family protein	NA	NA	NA	NA	NA
WP_007409076.1|844927_845443_+	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_061861367.1|845447_845879_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007409078.1|846039_846273_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_061861366.1|846273_847011_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.8	2.0e-27
WP_061861365.1|847003_847726_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_061861364.1|847767_848457_-	subclass B1 metallo-beta-lactamase	NA	NA	NA	NA	NA
WP_020955647.1|848585_848840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061890541.1|848960_851246_+	ATP-dependent helicase	NA	A0A068EQC7	Bacillus_phage	33.3	2.4e-84
WP_003154986.1|851314_851569_-	stage VI sporulation protein F	NA	NA	NA	NA	NA
WP_007610678.1|851735_851897_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_003154990.1|851989_852187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015388440.1|852473_852830_-	DUF1360 domain-containing protein	NA	NA	NA	NA	NA
WP_003154992.1|853000_853387_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_031378507.1|853426_853741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015417225.1|853833_854334_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_061890540.1|854484_854967_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_061890539.1|855114_855558_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_172798704.1|855616_856231_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 65
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	864756	869682	4167153		Klosneuvirus(33.33%)	7	NA	NA
WP_007409101.1|864756_865506_+	bis(5'-nucleosyl)-tetraphosphatase PrpE	NA	A0A1V0SJW2	Klosneuvirus	26.4	9.9e-11
WP_060675054.1|865539_866433_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	31.2	1.4e-06
WP_003155018.1|866447_867248_-	NAD kinase	NA	NA	NA	NA	NA
WP_003155019.1|867265_867901_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_012117290.1|867928_868294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409104.1|868418_868991_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_061861355.1|868995_869682_+	lytic transglycosylase domain-containing protein	NA	A0A1P8CWQ1	Bacillus_phage	72.6	2.3e-38
>prophage 66
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	876000	881264	4167153		Pseudomonas_phage(33.33%)	6	NA	NA
WP_007409109.1|876000_876657_+	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	41.0	9.9e-31
WP_003155034.1|876714_877110_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_061890537.1|877287_877866_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_062623314.1|877983_879171_-	putative glycoside hydrolase	NA	NA	NA	NA	NA
WP_017417453.1|879277_880195_-	oligopeptide ABC transporter ATP-binding protein OppF	NA	M1HP82	Acanthocystis_turfacea_Chlorella_virus	24.6	1.5e-05
WP_061890535.1|880187_881264_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.9	2.3e-16
>prophage 67
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	886654	887395	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_062623312.1|886654_887395_-	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	43.9	1.8e-49
>prophage 68
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	891201	893174	4167153		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_007610590.1|891201_892191_-	dipeptide ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	24.6	5.7e-06
WP_031378493.1|892187_893174_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.3	2.7e-24
>prophage 69
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	900198	901170	4167153		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_062623311.1|900198_901170_-	ornithine carbamoyltransferase	NA	M1I6M4	Paramecium_bursaria_Chlorella_virus	27.7	2.6e-19
>prophage 70
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	904245	905304	4167153		Halovirus(100.0%)	1	NA	NA
WP_007409132.1|904245_905304_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	37.6	5.3e-58
>prophage 71
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	910301	912506	4167153		Tupanvirus(50.0%)	2	NA	NA
WP_031378486.1|910301_911738_-	FAD-binding oxidoreductase	NA	A0A2K9KZR0	Tupanvirus	29.6	2.3e-48
WP_031378485.1|912062_912506_+	metallothiol transferase FosB	NA	Q2LI91	Bacillus_phage	65.1	7.1e-41
>prophage 72
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	915654	921701	4167153		Streptococcus_phage(25.0%)	6	NA	NA
WP_007409143.1|915654_916497_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	26.7	2.9e-27
WP_031378484.1|916622_917474_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	35.7	5.4e-13
WP_003155105.1|917522_917645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040238286.1|917693_918944_-	cytochrome P450	NA	NA	NA	NA	NA
WP_040238288.1|919077_920727_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.4	1.1e-14
WP_040238291.1|920723_921701_-	BMP family ABC transporter substrate-binding protein	NA	A0A0A7DN02	Lactobacillus_phage	28.5	6.6e-31
>prophage 73
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	932947	934789	4167153		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_025284535.1|932947_934789_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y1H0	Organic_Lake_phycodnavirus	28.0	1.2e-33
>prophage 74
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	940040	948371	4167153		Bacillus_virus(100.0%)	3	NA	NA
WP_040238306.1|940040_943433_-	SMC family ATPase	NA	G3MAB6	Bacillus_virus	22.8	2.3e-06
WP_040238308.1|943429_944602_-	exonuclease SbcCD subunit D	NA	NA	NA	NA	NA
WP_062623372.1|944666_948371_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	26.1	1.7e-15
>prophage 75
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	966903	972959	4167153		Trichoplusia_ni_ascovirus(33.33%)	5	NA	NA
WP_040238324.1|966903_967761_-	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.2	2.4e-53
WP_062623309.1|967885_969409_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007409192.1|969530_970823_+	globin-coupled sensor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	42.2	1.5e-09
WP_033574491.1|970953_971511_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_040238327.1|971522_972959_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	1.5e-23
>prophage 76
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	976047	980631	4167153		Bacillus_phage(50.0%)	4	NA	NA
WP_007409199.1|976047_977196_+	S8 family peptidase	NA	A0A217EQY2	Bacillus_phage	46.0	1.5e-50
WP_040238330.1|977241_978492_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_012117225.1|978646_979042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039252108.1|979089_980631_-	fatty acid--CoA ligase family protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.7	2.4e-43
>prophage 77
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1001941	1004828	4167153		Staphylococcus_phage(33.33%)	3	NA	NA
WP_003155231.1|1001941_1002685_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	5.4e-25
WP_007409220.1|1003175_1003613_+	HIT family protein	NA	X4YER2	Lactococcus_phage	33.0	6.2e-05
WP_062623307.1|1003748_1004828_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.7	1.0e-80
>prophage 78
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1016566	1017463	4167153		Staphylococcus_phage(100.0%)	1	NA	NA
WP_015417145.1|1016566_1017463_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.1	2.6e-26
>prophage 79
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1031057	1035955	4167153		Bacillus_phage(100.0%)	4	NA	NA
WP_007409244.1|1031057_1031264_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	79.0	1.8e-18
WP_039252156.1|1031519_1032140_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_061861315.1|1032179_1034201_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.6	1.8e-43
WP_061861314.1|1034197_1035955_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.4	1.7e-48
>prophage 80
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1040191	1043652	4167153		Staphylococcus_phage(66.67%)	5	NA	NA
WP_040238355.1|1040191_1040935_-	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	30.5	9.5e-22
WP_007409256.1|1040986_1042102_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_003155299.1|1042264_1042369_-	YhdX family protein	NA	NA	NA	NA	NA
WP_040238358.1|1042538_1043255_+	glycerophosphodiester phosphodiesterase	NA	A0A220BY94	Staphylococcus_phage	34.3	4.8e-31
WP_040238361.1|1043256_1043652_+	CrcB family protein	NA	A0A2H4PQR0	Staphylococcus_phage	40.5	8.9e-11
>prophage 81
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1056066	1059997	4167153		Trichoplusia_ni_ascovirus(50.0%)	4	NA	NA
WP_039252186.1|1056066_1056936_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	43.5	1.9e-50
WP_062623305.1|1057015_1058119_-	citrate synthase/methylcitrate synthase	NA	NA	NA	NA	NA
WP_007409271.1|1058228_1059104_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015417118.1|1059172_1059997_-	C40 family peptidase	NA	U5PW24	Bacillus_virus	43.9	3.0e-16
>prophage 82
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1065709	1071200	4167153		Bacillus_virus(50.0%)	6	NA	NA
WP_039252199.1|1065709_1067164_+	peptidoglycan endopeptidase	NA	M1HNA7	Bacillus_virus	34.0	1.0e-11
WP_033574459.1|1067208_1067532_-	YqzG/YhdC family protein	NA	NA	NA	NA	NA
WP_031378435.1|1067722_1067965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039252202.1|1067978_1068503_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_039254965.1|1068502_1069147_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_039252207.1|1069457_1071200_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	50.7	1.7e-162
>prophage 83
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1074651	1075479	4167153		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_039252210.1|1074651_1075479_-	aquaporin family protein	NA	M1IAZ4	Acanthocystis_turfacea_Chlorella_virus	34.4	1.2e-30
>prophage 84
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1079370	1082154	4167153		Synechococcus_phage(33.33%)	4	NA	NA
WP_003155347.1|1079370_1080060_-	HAD family hydrolase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	5.2e-06
WP_007408449.1|1080187_1080610_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	34.2	2.3e-12
WP_015417107.1|1080740_1081136_-	DUF5365 family protein	NA	NA	NA	NA	NA
WP_007408447.1|1081245_1082154_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.7	7.3e-08
>prophage 85
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1089550	1094726	4167153		Staphylococcus_phage(50.0%)	6	NA	NA
WP_015239460.1|1089550_1090630_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	35.5	6.0e-17
WP_039252223.1|1090646_1091477_-	lipoprotein	NA	NA	NA	NA	NA
WP_003155376.1|1091859_1092060_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	62.1	3.2e-17
WP_031378428.1|1092151_1093099_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_031378427.1|1093091_1094009_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.0	6.2e-39
WP_039252235.1|1094009_1094726_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	8.0e-18
>prophage 86
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1099908	1103179	4167153		Bacillus_phage(50.0%)	2	NA	NA
WP_012117146.1|1099908_1101093_-	sporulation protein YhbH	NA	A0A140HLI1	Bacillus_phage	44.0	3.0e-25
WP_003155391.1|1101283_1103179_-	serine/threonine protein kinase PrkA	NA	A0MN77	Thermus_phage	36.1	1.4e-101
>prophage 87
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1113596	1119240	4167153		Bacillus_virus(33.33%)	5	NA	NA
WP_014417255.1|1113596_1114364_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	3.6e-32
WP_033574447.1|1114586_1115522_-	amidohydrolase	NA	NA	NA	NA	NA
WP_003155420.1|1115778_1117224_+	catalase	NA	A0A2K9L0T1	Tupanvirus	41.7	8.1e-110
WP_039252255.1|1117295_1118261_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_033574445.1|1118253_1119240_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.8	5.1e-15
>prophage 88
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1123340	1124696	4167153		Pandoravirus(100.0%)	1	NA	NA
WP_025284453.1|1123340_1124696_+	FAD-binding oxidoreductase	NA	S4VRT3	Pandoravirus	40.2	7.2e-44
>prophage 89
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1141404	1143147	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_015417069.1|1141404_1143147_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.3	9.6e-49
>prophage 90
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1150549	1152601	4167153		Salmonella_phage(50.0%)	2	NA	NA
WP_003155484.1|1150549_1151530_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.3	1.5e-59
WP_015417065.1|1151740_1152601_-	alpha/beta hydrolase	NA	A0A0S2MV32	Mycobacterium_phage	26.4	2.2e-06
>prophage 91
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1164541	1166636	4167153		Mycobacterium_phage(50.0%)	2	NA	NA
WP_031378900.1|1164541_1166134_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	25.0	5.9e-21
WP_031378899.1|1166093_1166636_-	bacillithiol transferase BstA	NA	D0R7I3	Paenibacillus_phage	45.6	4.6e-18
>prophage 92
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1174953	1178485	4167153		Bacillus_phage(100.0%)	2	NA	NA
WP_062623293.1|1174953_1176771_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.5	1.3e-56
WP_062623292.1|1176751_1178485_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.3	7.6e-46
>prophage 93
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1193054	1194455	4167153		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_015417040.1|1193054_1194455_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	38.9	5.1e-85
>prophage 94
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1211322	1211838	4167153		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_003155578.1|1211322_1211838_-	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	28.9	1.3e-09
>prophage 95
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1225074	1227012	4167153		Streptococcus_phage(100.0%)	1	NA	NA
WP_062623279.1|1225074_1227012_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.1	2.7e-137
>prophage 96
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1230702	1230837	4167153		Bacillus_virus(100.0%)	1	NA	NA
WP_003155609.1|1230702_1230837_+	YflJ family protein	NA	G3MBD1	Bacillus_virus	61.0	1.9e-05
>prophage 97
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1247027	1251786	4167153		Hokovirus(50.0%)	2	NA	NA
WP_062623270.1|1247027_1250117_+	response regulator	NA	A0A1V0SGX0	Hokovirus	29.6	4.2e-31
WP_062623269.1|1250271_1251786_-	spore surface glycoprotein BclB	NA	A0A1M7XUW2	Cedratvirus	62.7	5.1e-46
>prophage 98
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1265053	1274864	4167153		Tupanvirus(33.33%)	8	NA	NA
WP_015239365.1|1265053_1266184_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	32.2	2.7e-44
WP_012117051.1|1266355_1267912_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.5	8.9e-54
WP_007408959.1|1267956_1269141_-	MFS transporter	NA	NA	NA	NA	NA
WP_003155658.1|1269204_1269627_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062623266.1|1269818_1271708_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	3.1e-53
WP_062623265.1|1271866_1272934_+	glycosyltransferase family 2 protein	NA	A0A1V0SAJ8	Catovirus	31.5	5.6e-15
WP_007609985.1|1272980_1273880_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	50.0	8.1e-68
WP_040238411.1|1274009_1274864_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	48.6	3.6e-09
>prophage 99
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1282422	1293097	4167153		Tupanvirus(25.0%)	8	NA	NA
WP_012117042.1|1282422_1283391_-	GDP-mannose 4,6-dehydratase	NA	A0A2K9L0I7	Tupanvirus	29.2	6.1e-29
WP_031379277.1|1283397_1284162_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003155677.1|1284376_1286305_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	44.5	1.1e-130
WP_031379276.1|1287078_1287819_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_015239351.1|1287833_1288724_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	31.1	3.5e-23
WP_007609957.1|1288724_1289036_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_015416999.1|1289028_1289622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061890471.1|1289914_1293097_-	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.3	3.9e-80
>prophage 100
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1305100	1307107	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_039252419.1|1305100_1307107_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	52.1	1.2e-132
>prophage 101
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1317908	1323658	4167153		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_062623263.1|1317908_1319303_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	45.5	4.9e-112
WP_015239327.1|1319450_1320362_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	29.6	1.2e-21
WP_031378830.1|1320514_1323658_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	24.0	2.7e-65
>prophage 102
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1329924	1337350	4167153		Bacillus_virus(33.33%)	5	NA	NA
WP_003155735.1|1329924_1330617_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	37.9	2.0e-18
WP_015416981.1|1330654_1331650_-	phosphotransferase enzyme family protein	NA	NA	NA	NA	NA
WP_040238424.1|1331887_1333084_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_061890465.1|1333099_1335106_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	39.7	2.9e-126
WP_020955453.1|1335130_1337350_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.5	5.9e-136
>prophage 103
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1344784	1360096	4167153		Synechococcus_phage(40.0%)	16	NA	NA
WP_039252469.1|1344784_1346323_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.8	6.7e-78
WP_012116999.1|1346319_1346907_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	38.8	1.0e-26
WP_015239317.1|1346903_1347944_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.9	3.7e-64
WP_007609856.1|1348035_1349466_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.7	6.2e-54
WP_062623262.1|1349441_1351670_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.2e-158
WP_031378824.1|1351653_1352337_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003155758.1|1352333_1352588_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	33.3	4.7e-05
WP_031378823.1|1352587_1353307_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	44.7	1.3e-47
WP_007408896.1|1353382_1354675_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	27.3	4.5e-19
WP_052250228.1|1354674_1355856_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_007609846.1|1355809_1356298_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	43.6	5.6e-23
WP_003155772.1|1356611_1356809_-	NETI motif-containing protein	NA	NA	NA	NA	NA
WP_007408893.1|1356805_1357360_-	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_076982879.1|1357481_1357655_-	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_015416966.1|1357793_1358576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007408891.1|1358773_1360096_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.0	4.1e-36
>prophage 104
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1363679	1365221	4167153		Hokovirus(100.0%)	1	NA	NA
WP_007408887.1|1363679_1365221_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.0	1.2e-21
>prophage 105
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1379593	1381525	4167153		Pseudomonas_phage(100.0%)	1	NA	NA
WP_040238449.1|1379593_1381525_+	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.4	1.5e-42
>prophage 106
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1393080	1395611	4167153		uncultured_virus(66.67%)	3	NA	NA
WP_014417068.1|1393080_1393428_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	67.6	3.3e-17
WP_003155941.1|1393650_1395285_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.5	3.7e-159
WP_003155970.1|1395326_1395611_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	51.6	2.2e-19
>prophage 107
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1399058	1402251	4167153	tRNA	Tupanvirus(50.0%)	2	NA	NA
WP_033574939.1|1399058_1400987_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.6e-60
WP_007408855.1|1401210_1402251_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	42.0	4.1e-63
>prophage 108
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1423525	1427027	4167153		Mycobacterium_virus(50.0%)	4	NA	NA
WP_060675349.1|1423525_1424884_-	serine hydrolase	NA	G1DUA7	Mycobacterium_virus	23.2	5.2e-10
WP_007409303.1|1425020_1425290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040238473.1|1425521_1425776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031378603.1|1425833_1427027_-	UDP-glucosyltransferase	NA	O89808	Epiphyas_postvittana_nucleopolyhedrovirus	27.9	2.3e-09
>prophage 109
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1440140	1441769	4167153		Streptococcus_phage(100.0%)	1	NA	NA
WP_061861209.1|1440140_1441769_+	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	27.4	1.3e-47
>prophage 110
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1444903	1448933	4167153	coat	Bacillus_phage(50.0%)	5	NA	NA
WP_062623258.1|1444903_1445539_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.3	9.3e-10
WP_052467625.1|1445531_1446692_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_015416919.1|1447146_1447392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003156070.1|1447409_1447778_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_014417028.1|1447796_1448933_+	glutathione-dependent formaldehyde dehydrogenase	NA	E3SJ82	Synechococcus_phage	26.7	1.0e-14
>prophage 111
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1458859	1464965	4167153		Tupanvirus(33.33%)	6	NA	NA
WP_007609682.1|1458859_1459909_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	41.2	1.6e-67
WP_040238511.1|1459967_1460930_-	arsenic resistance protein	NA	NA	NA	NA	NA
WP_015416907.1|1461119_1462358_-	HAD-IIA family hydrolase	NA	A0A192YCC8	Morganella_phage	42.9	9.3e-06
WP_040238514.1|1462366_1463185_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_007409545.1|1463199_1463958_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_040238515.1|1463954_1464965_-	thymidylate synthase	NA	A0A0K0N6Z8	Gordonia_phage	37.6	8.4e-13
>prophage 112
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1469566	1470604	4167153		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_039252592.1|1469566_1470604_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	25.1	2.4e-15
>prophage 113
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1480610	1482564	4167153		Lactococcus_phage(50.0%)	3	NA	NA
WP_003156143.1|1480610_1480814_-	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	75.4	2.2e-21
WP_158186009.1|1481260_1481350_-	molecular chaperone TorD family protein	NA	NA	NA	NA	NA
WP_040238518.1|1481535_1482564_+	fatty acid desaturase	NA	A0A1V0SAL5	Catovirus	28.7	4.5e-30
>prophage 114
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1487140	1488544	4167153		Burkholderia_virus(100.0%)	1	NA	NA
WP_007409580.1|1487140_1488544_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.3	7.7e-57
>prophage 115
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1491587	1492037	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_061861178.1|1491587_1492037_-	SprT family protein	NA	U5J9G1	Bacillus_phage	25.0	2.2e-05
>prophage 116
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1495093	1495882	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_003156171.1|1495093_1495882_-	RNA polymerase sigma factor SigB	NA	A0A0Y0AU18	Bacillus_phage	35.1	2.6e-25
>prophage 117
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1499451	1499802	4167153		Lactobacillus_phage(100.0%)	1	NA	NA
WP_003156187.1|1499451_1499802_-	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	38.6	5.8e-14
>prophage 118
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1505774	1507259	4167153		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_014416963.1|1505774_1507259_-	ATP-dependent RNA helicase CshA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.8	1.4e-61
>prophage 119
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1510276	1510594	4167153		Staphylococcus_phage(100.0%)	1	NA	NA
WP_003156200.1|1510276_1510594_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	32.0	1.8e-06
>prophage 120
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1514488	1515415	4167153		Staphylococcus_phage(100.0%)	1	NA	NA
WP_031378644.1|1514488_1515415_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.0	3.4e-37
>prophage 121
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1531053	1532184	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_014304380.1|1531053_1532184_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	41.2	1.5e-71
>prophage 122
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1535644	1537870	4167153		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_031378655.1|1535644_1537366_-	pyruvate oxidase	NA	G8DDL3	Micromonas_pusilla_virus	26.8	2.1e-35
WP_033575061.1|1537423_1537870_-	NUDIX hydrolase	NA	Q56BL2	Escherichia_virus	44.6	9.8e-06
>prophage 123
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1547406	1549593	4167153		Streptococcus_phage(100.0%)	1	NA	NA
WP_033575096.1|1547406_1549593_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	31.3	4.6e-40
>prophage 124
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1553560	1559603	4167153		Diadromus_pulchellus_ascovirus(33.33%)	4	NA	NA
WP_020955337.1|1553560_1554421_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	38.1	1.5e-47
WP_007410305.1|1554579_1556094_-	acyl--CoA ligase	NA	Q75ZG1	Hepacivirus	26.3	6.6e-38
WP_062623249.1|1556316_1558401_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_007410303.1|1558700_1559603_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	28.7	3.8e-09
>prophage 125
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1576993	1583136	4167153		Trichoplusia_ni_ascovirus(33.33%)	5	NA	NA
WP_007410286.1|1576993_1577779_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	1.4e-23
WP_003156317.1|1577799_1578663_-	glucose transporter GlcU	NA	NA	NA	NA	NA
WP_007410282.1|1578817_1580206_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_033575077.1|1580311_1581619_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.2	1.8e-23
WP_033575078.1|1581726_1583136_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	26.9	3.1e-21
>prophage 126
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1588155	1596411	4167153		Bacillus_phage(60.0%)	9	NA	NA
WP_003156330.1|1588155_1588914_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	29.8	5.9e-19
WP_040238557.1|1588907_1589855_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_015239156.1|1589844_1590798_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	53.1	5.9e-93
WP_042634827.1|1591211_1592576_+	aspartate kinase	NA	NA	NA	NA	NA
WP_012116800.1|1592670_1592766_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_031378677.1|1592914_1593034_-	PhrC/PhrF family phosphatase-inhibitory pheromone	NA	NA	NA	NA	NA
WP_007410270.1|1593017_1594166_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	44.6	1.2e-84
WP_162303988.1|1594307_1595741_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.6	9.7e-39
WP_007410267.1|1595727_1596411_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.2	1.9e-45
>prophage 127
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1601373	1602123	4167153		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_003156349.1|1601373_1602123_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.4	4.3e-14
>prophage 128
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1610084	1613587	4167153		Bacillus_phage(50.0%)	2	NA	NA
WP_079891295.1|1610084_1611830_-	right-handed parallel beta-helix repeat-containing protein	NA	U5PSS0	Bacillus_phage	41.0	1.0e-106
WP_012116786.1|1612108_1613587_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	39.4	4.3e-82
>prophage 129
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1618973	1622523	4167153		Planktothrix_phage(50.0%)	4	NA	NA
WP_012116781.1|1618973_1619717_+	cystine ABC transporter ATP-binding protein TcyC	NA	G9BWD6	Planktothrix_phage	38.1	3.1e-33
WP_025284214.1|1619816_1620446_+	YitT family protein	NA	NA	NA	NA	NA
WP_012116780.1|1620543_1621218_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_061861145.1|1621212_1622523_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	41.3	7.2e-73
>prophage 130
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1626357	1656828	4167153		Tupanvirus(60.0%)	9	NA	NA
WP_062623245.1|1626357_1630194_-	surfactin non-ribosomal peptide synthetase SrfAC	NA	A0A2K9KZV5	Tupanvirus	26.2	2.0e-86
WP_064323386.1|1630228_1640989_-	surfactin non-ribosomal peptide synthetase SrfAB	NA	A0A2K9KZV5	Tupanvirus	27.4	1.3e-167
WP_064323387.1|1641010_1651765_-	surfactin non-ribosomal peptide synthetase SrfAA	NA	A0A2K9KZV5	Tupanvirus	27.5	3.6e-162
WP_014304320.1|1652353_1652716_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_015416785.1|1652947_1653583_+	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_039252823.1|1653579_1654137_+	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_003156588.1|1654494_1654932_+	DNA-entry nuclease	NA	F8WPS9	Bacillus_phage	62.6	1.2e-37
WP_039252825.1|1654952_1655351_+	peptidase S24	NA	NA	NA	NA	NA
WP_015416781.1|1655391_1656828_-	family 1 glycosylhydrolase	NA	A0A0B5JD41	Pandoravirus	30.0	9.0e-53
>prophage 131
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1670648	1671659	4167153		Bacillus_virus(100.0%)	1	NA	NA
WP_039252844.1|1670648_1671659_-	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	27.4	1.0e-18
>prophage 132
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1676359	1678244	4167153		Staphylococcus_phage(50.0%)	2	NA	NA
WP_087920787.1|1676359_1677271_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	40.9	6.1e-63
WP_039252847.1|1677458_1678244_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	43.6	3.9e-42
>prophage 133
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1682876	1683695	4167153		Bacillus_virus(100.0%)	1	NA	NA
WP_007409061.1|1682876_1683695_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.7	2.9e-96
>prophage 134
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1698014	1699271	4167153		Bacillus_virus(100.0%)	1	NA	NA
WP_015416756.1|1698014_1699271_-	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.3	1.1e-33
>prophage 135
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1703760	1714784	4167153		Bacillus_phage(37.5%)	12	NA	NA
WP_003156644.1|1703760_1704534_-	TerC family protein	NA	S5MAL1	Bacillus_phage	63.9	9.4e-81
WP_003156645.1|1704572_1705151_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	37.1	1.1e-28
WP_007409047.1|1705183_1705765_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.9	1.9e-30
WP_015239102.1|1705788_1706385_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	32.4	1.5e-25
WP_062623239.1|1706660_1707656_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007409044.1|1707700_1708540_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_003156655.1|1708497_1709193_-	metal ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.2e-15
WP_020955277.1|1709247_1710207_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042634785.1|1710392_1712072_-	alpha-glucosidase	NA	NA	NA	NA	NA
WP_020955275.1|1712154_1712934_-	glucose 1-dehydrogenase	NA	A0A0G2Y8L6	Acanthamoeba_polyphaga_mimivirus	31.2	1.2e-06
WP_007409040.1|1713049_1714171_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	36.9	1.0e-64
WP_007409039.1|1714280_1714784_+	M15 family metallopeptidase	NA	A0A127AWA8	Bacillus_phage	58.1	5.1e-35
>prophage 136
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1723910	1727954	4167153		Mycobacterium_phage(50.0%)	4	NA	NA
WP_042634781.1|1723910_1725350_+	lincomycin efflux MFS transporter Lmr(B)	NA	A0A0M3UL24	Mycobacterium_phage	23.5	1.2e-12
WP_032870237.1|1725385_1726513_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_007409027.1|1726584_1727232_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_042634779.1|1727228_1727954_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	27.0	2.3e-20
>prophage 137
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1760736	1761624	4167153		Staphylococcus_phage(100.0%)	1	NA	NA
WP_042634767.1|1760736_1761624_+	glycerophosphodiester phosphodiesterase	NA	I6XE30	Staphylococcus_phage	40.5	2.2e-41
>prophage 138
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1767749	1782500	4167153		Bacillus_phage(33.33%)	5	NA	NA
WP_033575116.1|1767749_1768226_-	DUF4879 domain-containing protein	NA	O64027	Bacillus_phage	28.6	1.6e-06
WP_033575115.1|1768382_1769426_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052467619.1|1769446_1776067_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.7	5.2e-103
WP_033575114.1|1776164_1777688_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033575113.1|1777709_1782500_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.5	5.4e-33
>prophage 139
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1788837	1807204	4167153		Tupanvirus(100.0%)	2	NA	NA
WP_062623232.1|1788837_1799595_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.4	1.8e-177
WP_154019759.1|1799554_1807204_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.1	6.1e-180
>prophage 140
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1810940	1811873	4167153		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_024084826.1|1810940_1811873_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.9	2.7e-34
>prophage 141
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1822208	1825302	4167153		Staphylococcus_phage(50.0%)	2	NA	NA
WP_015416698.1|1822208_1823081_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.6	5.5e-21
WP_039252922.1|1823499_1825302_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q84421	Paramecium_bursaria_Chlorella_virus	40.4	1.1e-103
>prophage 142
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1846180	1851080	4167153		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_014720647.1|1846180_1847614_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.7	2.0e-137
WP_039252945.1|1847843_1848890_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	27.0	8.7e-13
WP_040238610.1|1848864_1849815_-	inorganic polyphosphate kinase	NA	NA	NA	NA	NA
WP_015416683.1|1849811_1851080_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	29.1	4.7e-21
>prophage 143
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1872188	1873879	4167153		Staphylococcus_phage(50.0%)	2	NA	NA
WP_003156552.1|1872188_1873058_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	3.6e-12
WP_007615256.1|1873033_1873879_-	energy-coupling factor ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.0	1.0e-19
>prophage 144
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1891600	1902434	4167153		Streptococcus_phage(33.33%)	6	NA	NA
WP_007410399.1|1891600_1893679_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.2	2.4e-62
WP_003156447.1|1893731_1894202_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_003156445.1|1894241_1894658_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_003156443.1|1894773_1895022_-	50S ribosomal protein L7ae-like protein	NA	NA	NA	NA	NA
WP_007410398.1|1895190_1898790_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	25.1	8.9e-65
WP_003156440.1|1898852_1902434_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	23.4	4.0e-49
>prophage 145
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1905929	1906463	4167153		Bacillus_virus(100.0%)	1	NA	NA
WP_003156423.1|1905929_1906463_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	30.8	5.4e-11
>prophage 146
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1909484	1910885	4167153	tRNA	Catovirus(100.0%)	1	NA	NA
WP_062623225.1|1909484_1910885_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.4	2.0e-60
>prophage 147
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1918341	1920774	4167153	protease	Enterobacteria_phage(100.0%)	1	NA	NA
WP_039252985.1|1918341_1920774_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	35.4	8.8e-133
>prophage 148
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1928270	1929770	4167153	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_014416740.1|1928270_1929770_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	39.2	9.0e-96
>prophage 149
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1933617	1942106	4167153	protease	Acinetobacter_phage(20.0%)	8	NA	NA
WP_007409944.1|1933617_1934205_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	57.0	1.1e-62
WP_025284092.1|1934220_1935633_-	aminodeoxychorismate synthase, component I	NA	A0A0B5J984	Pandoravirus	30.7	1.9e-34
WP_039253001.1|1935800_1936727_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.1	3.4e-109
WP_033575241.1|1936802_1937693_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_004264606.1|1937738_1938614_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_007409940.1|1938624_1939401_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_004264608.1|1939549_1941469_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	42.0	8.5e-115
WP_004264611.1|1941566_1942106_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	24.3	1.0e-04
>prophage 150
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1953763	1954300	4167153		Paenibacillus_phage(100.0%)	1	NA	NA
WP_004264646.1|1953763_1954300_-	stage V sporulation protein T	NA	A0A2I7SC16	Paenibacillus_phage	70.6	4.2e-11
>prophage 151
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1959675	1962021	4167153		Hokovirus(50.0%)	2	NA	NA
WP_007409928.1|1959675_1960629_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	34.1	3.9e-44
WP_004264658.1|1960650_1962021_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L140	Tupanvirus	34.8	7.1e-31
>prophage 152
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1968444	1981831	4167153	tRNA	Streptococcus_phage(37.5%)	15	NA	NA
WP_023356663.1|1968444_1969770_-	DUF348 domain-containing protein	NA	A0A0E3D983	Bacillus_phage	73.0	5.3e-23
WP_017419495.1|1969904_1970672_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_011996169.1|1970748_1972740_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	39.4	8.0e-100
WP_169510469.1|1973222_1973513_+	transition state genes transcriptional regulator AbrB	NA	A0A2I7SC16	Paenibacillus_phage	71.4	1.0e-16
WP_040238641.1|1973562_1974444_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	48.4	1.0e-67
WP_007409921.1|1974418_1974718_-	GIY-YIG nuclease family protein	NA	A0A068LKN9	Peridroma_alphabaculovirus	40.3	9.4e-05
WP_004264717.1|1974704_1975448_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_004264720.1|1975508_1975868_-	DNA replication initiation control protein YabA	NA	NA	NA	NA	NA
WP_004264723.1|1975882_1976710_-	competence/sporulation regulator complex protein RicT	NA	NA	NA	NA	NA
WP_033575250.1|1976712_1977702_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	32.8	1.2e-32
WP_004264730.1|1977713_1978154_-	DUF327 family protein	NA	NA	NA	NA	NA
WP_004264734.1|1978166_1978496_-	cyclic di-AMP receptor DarA	NA	NA	NA	NA	NA
WP_007409918.1|1978566_1979205_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	55.9	4.1e-58
WP_015416648.1|1979201_1980635_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_015416647.1|1980712_1981831_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	29.6	1.1e-34
>prophage 153
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1989542	1991234	4167153		Clostridium_phage(100.0%)	1	NA	NA
WP_062623221.1|1989542_1991234_-	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	35.1	1.6e-53
>prophage 154
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	1994283	2003394	4167153	tRNA	Lactobacillus_virus(16.67%)	8	NA	NA
WP_040238647.1|1994283_1994907_+	deoxynucleoside kinase	NA	Q5ULP7	Lactobacillus_virus	33.9	1.8e-18
WP_007615132.1|1994903_1995557_+	deoxynucleoside kinase	NA	A0A127AVX2	Bacillus_phage	35.7	1.2e-25
WP_062623219.1|1995996_1997142_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	41.7	5.7e-50
WP_007408744.1|1997152_1998430_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	55.5	1.3e-98
WP_007615126.1|1998749_1999340_-	pyridoxal 5'-phosphate synthase glutaminase subunit PdxT	NA	NA	NA	NA	NA
WP_003150714.1|1999361_2000246_-	pyridoxal 5'-phosphate synthase lyase subunit PdxS	NA	NA	NA	NA	NA
WP_040238653.1|2000443_2001775_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	27.3	1.4e-20
WP_003150717.1|2001927_2003394_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	41.3	4.2e-98
>prophage 155
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2009627	2017153	4167153		Bacillus_virus(66.67%)	6	NA	NA
WP_015239009.1|2009627_2012087_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	36.9	2.1e-113
WP_014720600.1|2012302_2014219_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	48.0	7.9e-153
WP_004392908.1|2014275_2014521_-	DUF370 domain-containing protein	NA	NA	NA	NA	NA
WP_007409910.1|2014538_2015651_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004392910.1|2015666_2015882_-	ribosome maturation protein RlbA	NA	NA	NA	NA	NA
WP_007409909.1|2016016_2017153_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	32.9	1.1e-16
>prophage 156
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2025913	2029313	4167153	protease	Leptospira_phage(25.0%)	4	NA	NA
WP_007409900.1|2025913_2026765_+	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	35.7	2.8e-17
WP_007409899.1|2027063_2027825_+	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	30.6	5.0e-26
WP_004392966.1|2027817_2028669_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	38.2	2.3e-19
WP_004392969.1|2028698_2029313_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	42.3	2.4e-18
>prophage 157
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2035167	2038052	4167153		Bacillus_phage(33.33%)	5	NA	NA
WP_004392979.1|2035167_2035686_+	single-stranded DNA-binding protein	NA	M5ABV5	Bacillus_phage	70.9	2.1e-52
WP_004392983.1|2035729_2035969_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_039253109.1|2036161_2036743_+	methylphosphotriester-DNA--protein-cysteine methyltransferase family protein	NA	NA	NA	NA	NA
WP_061861077.1|2036739_2037297_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	45.8	9.6e-19
WP_033574264.1|2037293_2038052_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	44.7	8.1e-61
>prophage 158
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2051845	2053949	4167153		Streptococcus_phage(50.0%)	3	NA	NA
WP_040238671.1|2051845_2052724_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	33.5	7.5e-34
WP_172437936.1|2052835_2053297_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004393039.1|2053310_2053949_+	nitroreductase family protein	NA	A0A1V0E011	Clostridioides_phage	49.0	3.1e-05
>prophage 159
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2058771	2060328	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_105322169.1|2058771_2060328_-	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	38.4	3.2e-88
>prophage 160
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2076816	2090138	4167153	protease	Bacillus_phage(42.86%)	11	NA	NA
WP_004393100.1|2076816_2078181_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	54.1	3.6e-128
WP_040238682.1|2078298_2078712_+	VOC family protein	NA	NA	NA	NA	NA
WP_012118894.1|2078950_2080243_+	adenylosuccinate synthase	NA	G5CQQ4	Megavirus	35.9	1.1e-68
WP_004393104.1|2081208_2081916_+	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	42.3	1.2e-45
WP_004393106.1|2081922_2083758_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	33.5	3.4e-36
WP_015418614.1|2083747_2085106_+	regulator of YycFG	NA	NA	NA	NA	NA
WP_040238684.1|2085092_2085932_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_007407895.1|2085946_2086741_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	34.1	4.1e-39
WP_007614967.1|2086827_2088024_+|protease	serine protease	protease	W5SAB9	Pithovirus	32.1	1.4e-11
WP_015418611.1|2088513_2088723_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039253191.1|2088719_2090138_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	35.6	3.9e-32
>prophage 161
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2093932	2104111	4167153		Klosneuvirus(40.0%)	9	NA	NA
WP_039253197.1|2093932_2095558_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.6	1.6e-45
WP_025285562.1|2095571_2096291_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_033574425.1|2096332_2097718_-	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_015240946.1|2097922_2098210_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	41.3	2.8e-06
WP_015418604.1|2098206_2098842_+	SdpI family protein	NA	NA	NA	NA	NA
WP_004393130.1|2099071_2100277_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.5	3.4e-29
WP_062623601.1|2100500_2101901_+	amino acid permease	NA	NA	NA	NA	NA
WP_007407883.1|2101974_2102865_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	28.8	5.8e-26
WP_039253203.1|2102995_2104111_+	aspartate phosphatase	NA	D6R410	Bacillus_phage	30.4	8.3e-38
>prophage 162
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2126338	2129145	4167153		Lactococcus_phage(100.0%)	2	NA	NA
WP_039253237.1|2126338_2127571_+	Fic family protein	NA	Q9AZ49	Lactococcus_phage	32.6	1.1e-51
WP_007614902.1|2127615_2129145_-	alkyl hydroperoxide reductase subunit F	NA	V9VEY6	Lactococcus_phage	29.4	3.7e-20
>prophage 163
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2144254	2149450	4167153		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_007407845.1|2144254_2146135_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	33.1	9.9e-84
WP_007407844.1|2146177_2147566_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_007407843.1|2147684_2148617_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_007614879.1|2148694_2149450_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.5	1.1e-20
>prophage 164
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2162992	2164848	4167153		Staphylococcus_phage(50.0%)	2	NA	NA
WP_033574314.1|2162992_2163904_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	41.8	6.3e-44
WP_031379171.1|2164125_2164848_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.1	7.0e-38
>prophage 165
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2168240	2169014	4167153		Planktothrix_phage(100.0%)	1	NA	NA
WP_007614823.1|2168240_2169014_+	ABC transporter ATP-binding protein YxdL	NA	G9BWD6	Planktothrix_phage	36.8	9.9e-30
>prophage 166
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2178699	2180001	4167153		Geobacillus_virus(100.0%)	1	NA	NA
WP_015418556.1|2178699_2180001_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	61.0	5.5e-134
>prophage 167
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2185400	2186939	4167153		Catovirus(100.0%)	1	NA	NA
WP_062623607.1|2185400_2186939_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.6	1.8e-91
>prophage 168
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2210252	2211692	4167153		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_033574330.1|2210252_2211692_+	DEAD/DEAH box helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	35.6	1.9e-63
>prophage 169
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2216461	2218513	4167153		Tupanvirus(100.0%)	1	NA	NA
WP_033574334.1|2216461_2218513_+	catalase	NA	A0A2K9L0T1	Tupanvirus	52.7	3.4e-154
>prophage 170
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2222652	2223789	4167153		uncultured_virus(100.0%)	1	NA	NA
WP_062623593.1|2222652_2223789_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	46.8	2.1e-89
>prophage 171
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2226805	2245939	4167153		Tupanvirus(25.0%)	15	NA	NA
WP_062623592.1|2226805_2227822_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	50.5	2.0e-94
WP_119834765.1|2227868_2228408_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_003150818.1|2228920_2229757_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	34.3	2.3e-40
WP_015418522.1|2229923_2230817_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033574336.1|2230933_2232034_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.2	1.6e-20
WP_012118785.1|2232133_2232976_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_033574337.1|2233009_2234353_-	2-hydroxycarboxylate transporter family protein	NA	A0A140XAH4	Dickeya_phage	25.7	2.3e-05
WP_015418520.1|2234854_2236261_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003150830.1|2236244_2237261_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_062623591.1|2237260_2238964_+	thiol reductant ABC exporter subunit CydD	NA	A0A2H4UU96	Bodo_saltans_virus	31.4	5.6e-17
WP_040238714.1|2238960_2240691_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	22.5	7.4e-17
WP_040238716.1|2240782_2241613_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_015240847.1|2241626_2242985_-	cytosine permease	NA	NA	NA	NA	NA
WP_003150840.1|2243301_2244288_+	choloylglycine hydrolase family protein	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	30.0	1.1e-30
WP_031379229.1|2244325_2245939_-	catalase	NA	A0A2K9L572	Tupanvirus	45.4	1.0e-97
>prophage 172
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2248960	2254188	4167153		Pandoravirus(33.33%)	6	NA	NA
WP_033574344.1|2248960_2250361_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	28.6	6.1e-46
WP_033574345.1|2250390_2251710_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_007407750.1|2251728_2252046_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_007614670.1|2252060_2252372_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_033574346.1|2252525_2253824_-	arsenical efflux pump membrane protein ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	65.6	1.5e-155
WP_033574347.1|2253837_2254188_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	42.6	4.2e-12
>prophage 173
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2266541	2277649	4167153		Pseudomonas_phage(20.0%)	10	NA	NA
WP_033574350.1|2266541_2267723_-	D-alanyl-lipoteichoic acid biosynthesis protein DltB	NA	A0A125RNP0	Pseudomonas_phage	25.4	1.2e-18
WP_033574351.1|2267719_2269231_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2H4PQU7	Staphylococcus_phage	24.7	7.1e-16
WP_003150882.1|2269246_2269396_-	teichoic acid D-Ala incorporation-associated protein DltX	NA	NA	NA	NA	NA
WP_007407733.1|2269839_2270775_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_007407732.1|2270906_2271539_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_015418500.1|2271798_2272659_+	glycosyltransferase family 8 protein	NA	A0A2P0VP84	Tetraselmis_virus	27.5	1.4e-05
WP_033574428.1|2272714_2274460_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	41.3	6.0e-43
WP_062623588.1|2274621_2275956_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_014419203.1|2275983_2276367_-	VOC family protein	NA	NA	NA	NA	NA
WP_007407727.1|2276461_2277649_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	43.7	6.3e-76
>prophage 174
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2300925	2303337	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_033574358.1|2300925_2303337_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	36.8	3.8e-19
>prophage 175
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2306629	2311124	4167153		Bacillus_phage(50.0%)	5	NA	NA
WP_015418479.1|2306629_2308069_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.3	4.1e-21
WP_007407702.1|2308168_2308408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033574431.1|2308439_2309252_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_061890963.1|2309619_2310426_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_012118732.1|2310440_2311124_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	44.7	3.2e-48
>prophage 176
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2314252	2315023	4167153		uncultured_marine_virus(100.0%)	1	NA	NA
WP_003150972.1|2314252_2315023_+	glycosyltransferase family 2 protein	NA	A0A0F7L2F7	uncultured_marine_virus	26.3	4.4e-06
>prophage 177
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2321395	2323952	4167153		Bacillus_virus(33.33%)	3	NA	NA
WP_031378582.1|2321395_2322133_+	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	42.7	5.0e-47
WP_007407684.1|2322135_2323083_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	42.9	5.9e-69
WP_015418465.1|2323103_2323952_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.3	5.4e-37
>prophage 178
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2331536	2336434	4167153		Salmonella_phage(50.0%)	5	NA	NA
WP_062623586.1|2331536_2332739_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.9	2.1e-26
WP_033574368.1|2332961_2334200_+	MFS transporter	NA	NA	NA	NA	NA
WP_015418458.1|2334361_2334976_+	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_003151000.1|2334965_2335676_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_007407673.1|2335672_2336434_+	dihydroanticapsin 7-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.1	4.8e-21
>prophage 179
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2344303	2345203	4167153		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_020957985.1|2344303_2345203_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	40.2	2.1e-07
>prophage 180
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2349950	2354760	4167153		Staphylococcus_phage(50.0%)	6	NA	NA
WP_007407659.1|2349950_2350871_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	36.6	1.3e-36
WP_015418448.1|2350968_2351523_-	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_015418447.1|2351523_2351838_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_040238745.1|2352098_2352872_-	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_003151034.1|2353074_2353299_+	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_003151035.1|2353458_2354760_+	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	29.5	1.0e-23
>prophage 181
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2366647	2367793	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_033574379.1|2366647_2367793_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	42.9	4.2e-77
>prophage 182
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2380924	2382388	4167153		Escherichia_phage(100.0%)	1	NA	NA
WP_033574384.1|2380924_2382388_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	43.6	4.2e-21
>prophage 183
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2386086	2389185	4167153		Bacillus_phage(100.0%)	3	NA	NA
WP_033574386.1|2386086_2387811_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.7	8.6e-58
WP_003151087.1|2387881_2388154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015418426.1|2388222_2389185_-	UV DNA damage repair endonuclease UvsE	NA	A0A127AW32	Bacillus_phage	34.9	1.5e-40
>prophage 184
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2393639	2398145	4167153		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_033574388.1|2393639_2395247_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	2.1e-151
WP_007407614.1|2395294_2395816_-	DUF2529 domain-containing protein	NA	NA	NA	NA	NA
WP_012118670.1|2395980_2396355_+	sporulation initiation phosphotransferase Spo0F	NA	W8CYM9	Bacillus_phage	36.5	1.3e-11
WP_003151102.1|2396530_2397388_+	fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_007407613.1|2397506_2398145_+	fructose-6-phosphate aldolase	NA	A0A1D7SX77	Cyanophage	50.0	4.3e-47
>prophage 185
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2402842	2403427	4167153		Mycoplasma_phage(100.0%)	1	NA	NA
WP_062623583.1|2402842_2403427_+	thymidine kinase	NA	Q6GYZ9	Mycoplasma_phage	39.6	5.7e-30
>prophage 186
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2407652	2408723	4167153		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003151139.1|2407652_2408723_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	40.0	3.1e-05
>prophage 187
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2411806	2416536	4167153		Pandoravirus(50.0%)	6	NA	NA
WP_032867405.1|2411806_2412847_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	42.1	2.7e-59
WP_007407601.1|2412915_2413473_+	manganese efflux pump	NA	NA	NA	NA	NA
WP_007407600.1|2413546_2414002_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_062623582.1|2414135_2414585_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_032867407.1|2414598_2415141_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_015418416.1|2415288_2416536_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.4	1.5e-99
>prophage 188
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2427974	2429006	4167153		Pseudomonas_phage(100.0%)	1	NA	NA
WP_062623581.1|2427974_2429006_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	40.7	5.5e-44
>prophage 189
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2433312	2434443	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_033574399.1|2433312_2434443_+	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	41.7	8.9e-80
>prophage 190
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2443795	2444665	4167153		Clostridium_phage(100.0%)	1	NA	NA
WP_007407571.1|2443795_2444665_+	M23 family metallopeptidase	NA	I3PV24	Clostridium_phage	38.3	1.1e-05
>prophage 191
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2454520	2454802	4167153		Clostridium_phage(100.0%)	1	NA	NA
WP_003151236.1|2454520_2454802_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	50.7	9.4e-15
>prophage 192
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2461019	2472010	4167153		Listeria_phage(25.0%)	10	NA	NA
WP_012118637.1|2461019_2461361_+	single-stranded DNA-binding protein	NA	A0A059T5E0	Listeria_phage	63.2	4.2e-33
WP_039253550.1|2461569_2462352_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_039063770.1|2462348_2463206_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_033574409.1|2463318_2466093_-	DEAD/DEAH box helicase	NA	V9XTV7	Choristoneura_murinana_nucleopolyhedrovirus	26.3	4.6e-37
WP_040238784.1|2466079_2467690_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_003151259.1|2467893_2468037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015418390.1|2468252_2468999_+	modulator of YwqD protein tyrosine kinase activity	NA	NA	NA	NA	NA
WP_012118633.1|2468985_2469675_+	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	35.9	4.1e-27
WP_040238785.1|2469720_2470485_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_014419067.1|2470684_2472010_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.0	3.6e-88
>prophage 193
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2480456	2481173	4167153		Klosneuvirus(100.0%)	1	NA	NA
WP_040238789.1|2480456_2481173_+	endonuclease V	NA	A0A1V0SJW5	Klosneuvirus	29.0	2.9e-20
>prophage 194
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2489529	2491965	4167153		Staphylococcus_phage(50.0%)	2	NA	NA
WP_015418370.1|2489529_2490861_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	30.4	2.0e-54
WP_040238795.1|2491056_2491965_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	1.2e-10
>prophage 195
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2497899	2499393	4167153		Cedratvirus(100.0%)	1	NA	NA
WP_040238802.1|2497899_2499393_-	sugar ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	28.8	2.1e-12
>prophage 196
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2509295	2510531	4167153		Clostridioides_phage(100.0%)	1	NA	NA
WP_015418360.1|2509295_2510531_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.7	1.4e-17
>prophage 197
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2513704	2515081	4167153		Aichi_virus(100.0%)	1	NA	NA
WP_015418357.1|2513704_2515081_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	30.5	9.6e-36
>prophage 198
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2521589	2528686	4167153		Staphylococcus_phage(33.33%)	5	NA	NA
WP_040238811.1|2521589_2524235_+	glucosaminidase domain-containing protein	NA	A0A1W6JQU5	Staphylococcus_phage	44.3	1.7e-36
WP_039253618.1|2524295_2525462_-	CDP-glycerol--glycerophosphate glycerophosphotransferase	NA	NA	NA	NA	NA
WP_007407501.1|2525494_2526265_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_003151361.1|2526620_2527010_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	43.4	1.1e-18
WP_031379266.1|2527147_2528686_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.7	7.8e-10
>prophage 199
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2533527	2540892	4167153		Bacillus_phage(50.0%)	6	NA	NA
WP_003151367.1|2533527_2534412_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.7	6.7e-83
WP_039253626.1|2534640_2535780_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	29.7	2.7e-23
WP_003151369.1|2535810_2536728_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007407496.1|2536909_2537227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039253628.1|2537259_2539380_+	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	28.8	5.3e-17
WP_015418344.1|2539401_2540892_+	N-acetylmuramoyl-L-alanine amidase	NA	J9PV86	Bacillus_phage	31.3	4.6e-15
>prophage 200
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2544450	2545791	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_015418341.1|2544450_2545791_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	41.0	1.4e-87
>prophage 201
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2552538	2557777	4167153		Streptococcus_phage(66.67%)	5	NA	NA
WP_003151384.1|2552538_2553186_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	43.1	7.4e-39
WP_007407484.1|2553408_2554572_+	two-component sensor histidine kinase DegS	NA	NA	NA	NA	NA
WP_003219701.1|2554648_2555338_+	two-component system response regulator DegU	NA	NA	NA	NA	NA
WP_015418336.1|2555435_2556284_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.6	5.8e-15
WP_040238815.1|2556391_2557777_+	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.3	5.1e-61
>prophage 202
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2563716	2563941	4167153		Pseudomonas_phage(100.0%)	1	NA	NA
WP_003151402.1|2563716_2563941_+	carbon storage regulator CsrA	NA	H2BD56	Pseudomonas_phage	49.0	6.4e-06
>prophage 203
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2574405	2578996	4167153		Planktothrix_phage(50.0%)	4	NA	NA
WP_007407465.1|2574405_2575092_+	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	33.8	3.8e-25
WP_007407464.1|2575084_2575975_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_040238825.1|2576021_2577428_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_040238826.1|2577595_2578996_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	1.7e-24
>prophage 204
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2583104	2605049	4167153		Tupanvirus(66.67%)	3	NA	NA
WP_062623573.1|2583104_2591780_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	25.6	4.1e-140
WP_062623572.1|2591791_2603110_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.4	6.2e-173
WP_040238841.1|2603306_2605049_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	4.6e-35
>prophage 205
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2610713	2618794	4167153		Hokovirus(50.0%)	4	NA	NA
WP_040238846.1|2610713_2613215_-	phosphotransferase	NA	A0A1V0SGR7	Hokovirus	31.5	2.8e-33
WP_003151438.1|2613515_2613752_+	CsbA family protein	NA	NA	NA	NA	NA
WP_003151439.1|2613927_2615913_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_040238848.1|2615920_2618794_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.3	0.0e+00
>prophage 206
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2639519	2651883	4167153		Bacillus_phage(50.0%)	11	NA	NA
WP_012118541.1|2639519_2641289_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	60.2	1.1e-164
WP_039255029.1|2641377_2641995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012118540.1|2642031_2642709_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	56.6	9.8e-66
WP_031378293.1|2642705_2643767_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	38.6	1.3e-61
WP_040238853.1|2643882_2645337_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_007407424.1|2645732_2647145_+	C40 family peptidase	NA	A0A0A0RVE6	Bacillus_phage	51.7	3.5e-25
WP_094032595.1|2647351_2648302_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.9	3.7e-87
WP_003151491.1|2648575_2649043_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_012118535.1|2649068_2649956_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.8	5.1e-06
WP_007407422.1|2649952_2650906_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	39.9	2.6e-64
WP_007407421.1|2650932_2651883_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.1	6.6e-52
>prophage 207
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2655539	2658185	4167153		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_039255032.1|2655539_2657129_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.8	5.0e-44
WP_003151506.1|2657173_2657494_-	hypothetical protein	NA	G3MBI9	Bacillus_virus	43.3	2.3e-17
WP_015387658.1|2657609_2658185_+	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	26.4	1.5e-11
>prophage 208
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2662056	2662653	4167153		Agrobacterium_phage(100.0%)	1	NA	NA
WP_003151513.1|2662056_2662653_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	7.5e-54
>prophage 209
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2674508	2685457	4167153		Mollivirus(25.0%)	10	NA	NA
WP_039253752.1|2674508_2675957_-	carboxylesterase/lipase family protein	NA	A0A0M4JT58	Mollivirus	33.1	7.3e-34
WP_003151541.1|2676037_2676493_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033575178.1|2676738_2677446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007407393.1|2677451_2678132_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_172798706.1|2678353_2680171_+	polysaccharide biosynthesis protein	NA	K7Y9E1	Megavirus	29.4	2.7e-25
WP_060674034.1|2680186_2681326_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_020954328.1|2681322_2682165_+	glycosyltransferase	NA	A0A0F7L2F7	uncultured_marine_virus	25.9	7.0e-05
WP_062623569.1|2682157_2683294_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_007613926.1|2683297_2684401_+	EpsG family protein	NA	NA	NA	NA	NA
WP_031378303.1|2684419_2685457_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	41.3	2.3e-13
>prophage 210
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2690336	2691509	4167153		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_007407381.1|2690336_2691509_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A2D2W2B8	Stenotrophomonas_phage	26.6	2.0e-10
>prophage 211
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2724279	2725572	4167153		Streptococcus_phage(100.0%)	1	NA	NA
WP_007409956.1|2724279_2725572_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	71.0	1.9e-174
>prophage 212
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2728669	2734212	4167153		Tupanvirus(33.33%)	6	NA	NA
WP_062623565.1|2728669_2729800_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	31.0	5.5e-37
WP_032867004.1|2729796_2730726_+	NAD(P)-dependent oxidoreductase	NA	M1I3H4	Acanthocystis_turfacea_Chlorella_virus	28.0	4.2e-19
WP_039253797.1|2730691_2731948_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_023357141.1|2731959_2732841_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007409964.1|2732813_2733572_+	WbqC family protein	NA	NA	NA	NA	NA
WP_007409965.1|2733534_2734212_+	PIG-L family deacetylase	NA	A0A2D2W2P2	Stenotrophomonas_phage	27.8	7.3e-13
>prophage 213
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2741437	2742577	4167153	holin	Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_062623563.1|2741437_2742577_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.7	9.5e-13
>prophage 214
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2745726	2749995	4167153	holin	Anomala_cuprea_entomopoxvirus(50.0%)	5	NA	NA
WP_015418236.1|2745726_2746872_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	W6JKT0	Anomala_cuprea_entomopoxvirus	29.9	4.3e-13
WP_015418235.1|2746888_2747542_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_022553803.1|2747556_2748474_+	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015240601.1|2748492_2749170_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_031378331.1|2749281_2749995_+	lantibiotic protection ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	46.6	4.3e-56
>prophage 215
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2754054	2759477	4167153		Thermus_phage(50.0%)	7	NA	NA
WP_003151674.1|2754054_2754486_-	helix-turn-helix domain-containing protein	NA	S6C481	Thermus_phage	64.2	6.5e-15
WP_003151677.1|2754510_2754921_-	helix-turn-helix transcriptional regulator	NA	S6C481	Thermus_phage	62.0	7.8e-18
WP_087920807.1|2755116_2755302_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003151681.1|2755425_2755656_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_062623562.1|2755774_2756515_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012118465.1|2756533_2758867_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	42.4	7.0e-87
WP_003151688.1|2759006_2759477_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	61.3	7.0e-47
>prophage 216
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2766348	2767128	4167153		Planktothrix_phage(100.0%)	1	NA	NA
WP_031378339.1|2766348_2767128_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	2.9e-37
>prophage 217
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2776218	2780909	4167153		uncultured_virus(50.0%)	2	NA	NA
WP_062623558.1|2776218_2778648_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.7	4.1e-114
WP_062623557.1|2778797_2780909_+	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	36.0	1.0e-116
>prophage 218
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2783943	2786262	4167153		Saudi_moumouvirus(100.0%)	1	NA	NA
WP_062623556.1|2783943_2786262_+	UvrD-helicase domain-containing protein	NA	A0A1S5V1I8	Saudi_moumouvirus	26.9	3.5e-06
>prophage 219
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2793097	2797161	4167153		Staphylococcus_phage(100.0%)	4	NA	NA
WP_007410023.1|2793097_2793928_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	54.9	2.7e-78
WP_040238892.1|2793960_2795106_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_040238893.1|2795107_2796202_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_033574854.1|2796225_2797161_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.7e-24
>prophage 220
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2801667	2804048	4167153		Streptococcus_phage(50.0%)	2	NA	NA
WP_039253879.1|2801667_2803524_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	36.0	4.9e-91
WP_003151759.1|2803565_2804048_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.3	2.4e-10
>prophage 221
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2810563	2811367	4167153		Indivirus(100.0%)	1	NA	NA
WP_015418195.1|2810563_2811367_+	ABC transporter ATP-binding protein	NA	A0A1V0SD74	Indivirus	27.5	1.3e-08
>prophage 222
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2814512	2816971	4167153		Bacillus_phage(50.0%)	2	NA	NA
WP_031378359.1|2814512_2815232_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	2.3e-33
WP_031378360.1|2815228_2816971_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	30.7	1.3e-16
>prophage 223
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2820893	2822120	4167153		Staphylococcus_phage(100.0%)	1	NA	NA
WP_033574862.1|2820893_2822120_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.8	1.3e-12
>prophage 224
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2836843	2839670	4167153	protease	Bacillus_phage(33.33%)	3	NA	NA
WP_007410069.1|2836843_2837521_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	8.1e-28
WP_062623554.1|2837797_2839159_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.1	5.6e-20
WP_033574870.1|2839205_2839670_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	48.6	3.1e-31
>prophage 225
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2843227	2844052	4167153		Phaeocystis_globosa_virus(100.0%)	1	NA	NA
WP_003151820.1|2843227_2844052_+	ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	28.6	1.9e-10
>prophage 226
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2859406	2872880	4167153	transposase	Streptococcus_phage(14.29%)	18	NA	NA
WP_003151843.1|2859406_2859763_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	51.9	2.9e-21
WP_003151844.1|2859822_2860206_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_033574881.1|2860260_2860497_+	YusG family protein	NA	NA	NA	NA	NA
WP_033574882.1|2860566_2860932_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_003151847.1|2860934_2861255_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_007410085.1|2861351_2861702_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003151850.1|2862024_2863050_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.0	2.2e-32
WP_003151851.1|2863042_2863711_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012118382.1|2863724_2864540_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_088056427.1|2864624_2865011_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003151857.1|2865203_2865356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003327022.1|2865532_2866318_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	23.6	6.5e-05
WP_062623553.1|2866335_2867649_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_033574884.1|2867648_2868869_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	48.8	2.3e-118
WP_003151877.1|2868858_2869302_+	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A2P1CJL8	Mycobacterium_phage	39.4	1.8e-15
WP_007410090.1|2869321_2870719_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_105322142.1|2870832_2871982_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	60.4	3.0e-38
WP_033574887.1|2872043_2872880_-	chitosanase	NA	A0A223LHY0	Streptomyces_phage	31.4	3.4e-20
>prophage 227
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2879491	2880478	4167153		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_032867108.1|2879491_2880478_+	SIS domain-containing protein	NA	A0A2L2DN46	Acanthamoeba_polyphaga_mimivirus	25.7	7.7e-11
>prophage 228
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2885396	2886503	4167153		Mycoplasma_phage(100.0%)	1	NA	NA
WP_040238908.1|2885396_2886503_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	Q6GZ03	Mycoplasma_phage	47.3	2.8e-17
>prophage 229
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2890256	2891453	4167153		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_062623552.1|2890256_2891453_+	MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	20.5	3.4e-05
>prophage 230
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2901113	2905475	4167153		Staphylococcus_phage(50.0%)	6	NA	NA
WP_032876720.1|2901113_2902091_-	M23 family metallopeptidase	NA	A0A1J0MFP9	Staphylococcus_phage	36.2	7.9e-08
WP_003151923.1|2902293_2903190_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003151928.1|2903407_2903683_+	YutD family protein	NA	NA	NA	NA	NA
WP_040238918.1|2903708_2904143_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_040238919.1|2904176_2904947_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_003151934.1|2904974_2905475_-	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	58.4	6.8e-40
>prophage 231
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2912252	2917373	4167153		Prochlorococcus_phage(33.33%)	7	NA	NA
WP_169510385.1|2912252_2912588_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	42.4	3.7e-10
WP_015240509.1|2912667_2912994_+	YuzD family protein	NA	NA	NA	NA	NA
WP_007613539.1|2913031_2914099_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007408721.1|2914365_2914602_+	YuzB family protein	NA	NA	NA	NA	NA
WP_062623550.1|2914735_2915953_+	NupC/NupG family nucleoside CNT transporter	NA	B2YG43	Musca_hytrovirus	23.2	1.3e-12
WP_012118345.1|2916077_2916932_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_003151967.1|2917010_2917373_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	44.9	1.4e-18
>prophage 232
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2923094	2932107	4167153		Staphylococcus_phage(20.0%)	12	NA	NA
WP_015418131.1|2923094_2923799_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	1.7e-28
WP_015418130.1|2923795_2924323_+	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_003151978.1|2924339_2924561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012118338.1|2924623_2925604_-	GMP reductase	NA	G3MBI2	Bacillus_virus	82.8	1.7e-156
WP_003151982.1|2925821_2925965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003151984.1|2926005_2927001_-	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	51.6	2.3e-31
WP_062623549.1|2927312_2928533_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_007408708.1|2928706_2928832_+	YuiA family protein	NA	NA	NA	NA	NA
WP_003151989.1|2928900_2929221_+	YuiB family protein	NA	NA	NA	NA	NA
WP_047936427.1|2929345_2929963_+	3D domain-containing protein	NA	A0A127AW72	Bacillus_phage	42.3	6.1e-14
WP_040238935.1|2929992_2930469_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_040238937.1|2930616_2932107_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.3	2.8e-57
>prophage 233
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2940692	2947820	4167153		Tupanvirus(100.0%)	1	NA	NA
WP_040238942.1|2940692_2947820_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.0	4.1e-98
>prophage 234
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2953636	2958112	4167153		Mycobacterium_phage(100.0%)	1	NA	NA
WP_061860834.1|2953636_2958112_+	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	22.2	2.9e-33
>prophage 235
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2966552	2968019	4167153		Bacillus_virus(100.0%)	1	NA	NA
WP_015418109.1|2966552_2968019_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	47.2	1.1e-117
>prophage 236
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	2983338	2984871	4167153		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_007408666.1|2983338_2984871_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	26.0	1.4e-11
>prophage 237
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3015906	3024889	4167153		uncultured_Caudovirales_phage(80.0%)	5	NA	NA
WP_040238955.1|3015906_3017892_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	57.3	6.7e-14
WP_007408633.1|3018076_3020065_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	6.5e-17
WP_020956254.1|3020192_3022178_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.9	1.4e-14
WP_040238956.1|3022292_3024299_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.0	2.1e-15
WP_003152143.1|3024364_3024889_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	35.4	2.6e-18
>prophage 238
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3031040	3031886	4167153		Brevibacillus_phage(100.0%)	1	NA	NA
WP_039254129.1|3031040_3031886_+	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	45.2	1.1e-26
>prophage 239
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3038744	3040274	4167153		Orpheovirus(100.0%)	1	NA	NA
WP_039254138.1|3038744_3040274_+	flotillin family protein	NA	A0A2I2L4B2	Orpheovirus	27.5	2.1e-07
>prophage 240
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3054785	3057361	4167153		Staphylococcus_phage(50.0%)	2	NA	NA
WP_015418062.1|3054785_3056249_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	35.2	1.2e-76
WP_007408844.1|3056245_3057361_+	o-succinylbenzoate synthase	NA	Q6A202	Oenococcus_phage	22.2	1.1e-13
>prophage 241
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3061483	3073954	4167153	holin	Staphylococcus_phage(57.14%)	15	NA	NA
WP_003152235.1|3061483_3061711_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	66.2	6.9e-24
WP_003152237.1|3061836_3062310_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_015418059.1|3062424_3062868_+	FixH family protein	NA	NA	NA	NA	NA
WP_015240433.1|3062864_3063014_-	YtzI protein	NA	NA	NA	NA	NA
WP_007408835.1|3063138_3063576_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.4	2.2e-47
WP_007408834.1|3063727_3064132_+|holin	holin family protein	holin	NA	NA	NA	NA
WP_007408833.1|3064264_3064744_+	nucleoside triphosphatase YtkD	NA	NA	NA	NA	NA
WP_040237831.1|3064778_3065591_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003152246.1|3065565_3066348_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.0	1.6e-32
WP_015418057.1|3066359_3067364_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015418056.1|3067503_3068277_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	38.3	9.2e-36
WP_003152249.1|3068334_3068577_+	DUF2584 domain-containing protein	NA	NA	NA	NA	NA
WP_015418055.1|3068619_3070203_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	64.2	1.1e-195
WP_003152253.1|3070709_3071912_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	74.4	9.6e-165
WP_003152255.1|3072055_3073954_+	asparagine synthase (glutamine-hydrolyzing)	NA	R4TIC1	Phaeocystis_globosa_virus	28.3	1.3e-30
>prophage 242
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3078289	3080979	4167153		Staphylococcus_phage(66.67%)	4	NA	NA
WP_061860812.1|3078289_3079099_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.4	2.2e-08
WP_031378718.1|3079115_3079310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031378719.1|3079432_3080014_-	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	54.2	2.1e-45
WP_007408822.1|3080010_3080979_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	74.5	3.2e-54
>prophage 243
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3085686	3086565	4167153		Staphylococcus_phage(100.0%)	1	NA	NA
WP_061860810.1|3085686_3086565_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	1.4e-19
>prophage 244
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3089579	3090275	4167153		Planktothrix_phage(100.0%)	1	NA	NA
WP_007408816.1|3089579_3090275_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.7	2.1e-39
>prophage 245
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3093433	3102714	4167153	tRNA	Staphylococcus_phage(66.67%)	7	NA	NA
WP_033574237.1|3093433_3094189_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	35.8	1.3e-18
WP_039254165.1|3094185_3096126_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_062623542.1|3096233_3096944_+	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_031378729.1|3097139_3098324_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	51.6	2.5e-101
WP_031378730.1|3098365_3099151_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_015418038.1|3099539_3099875_+	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_031378731.1|3100299_3102714_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	73.4	0.0e+00
>prophage 246
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3109547	3112528	4167153		Vibrio_phage(50.0%)	2	NA	NA
WP_007408799.1|3109547_3111083_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	4.7e-23
WP_062623541.1|3111262_3112528_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	57.0	3.4e-27
>prophage 247
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3115778	3121474	4167153		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_031379302.1|3115778_3116483_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.1	2.2e-20
WP_039254170.1|3116479_3117640_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_014418668.1|3117673_3118978_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.4	1.2e-48
WP_039254172.1|3119073_3120465_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_154019764.1|3120502_3121474_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.8	4.5e-80
>prophage 248
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3131542	3135743	4167153		Staphylococcus_phage(50.0%)	3	NA	NA
WP_012118213.1|3131542_3132352_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	51.5	9.0e-34
WP_033574220.1|3132366_3132972_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_039254181.1|3133139_3135743_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.3	9.2e-88
>prophage 249
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3138894	3139971	4167153		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_003152383.1|3138894_3139971_+	bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase	NA	E3T537	Cafeteria_roenbergensis_virus	28.7	8.1e-14
>prophage 250
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3145449	3148770	4167153	tRNA	Staphylococcus_phage(50.0%)	2	NA	NA
WP_007408770.1|3145449_3147168_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	72.1	9.4e-206
WP_007613147.1|3147504_3148770_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.8	6.5e-79
>prophage 251
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3152695	3161290	4167153		Bacillus_phage(66.67%)	8	NA	NA
WP_039254200.1|3152695_3153448_+	SGNH/GDSL hydrolase family protein	NA	A0A1J0MFI8	Staphylococcus_phage	45.9	5.6e-54
WP_007408760.1|3153734_3154244_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_007408759.1|3154413_3154641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039254203.1|3154878_3156069_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_033574211.1|3156333_3156891_+	SMI1/KNR4 family protein	NA	O64022	Bacillus_phage	52.7	8.3e-47
WP_039254206.1|3157023_3158394_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003152406.1|3158648_3159251_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_033574209.1|3159541_3161290_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	6.5e-21
>prophage 252
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3169327	3174915	4167153		Bacillus_phage(33.33%)	5	NA	NA
WP_007408043.1|3169327_3169549_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	82.1	8.2e-22
WP_033574205.1|3169697_3171284_+	acyl--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.6	1.9e-75
WP_062623540.1|3171307_3172903_+	amidohydrolase	NA	NA	NA	NA	NA
WP_015240378.1|3172919_3173726_-	NAD kinase	NA	NA	NA	NA	NA
WP_039254219.1|3173907_3174915_+	signal peptide peptidase SppA	NA	Q6UAX7	Klebsiella_phage	27.8	1.6e-16
>prophage 253
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3189151	3192490	4167153		Saccharomonospora_phage(100.0%)	1	NA	NA
WP_039254229.1|3189151_3192490_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	34.7	8.5e-179
>prophage 254
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3204037	3214961	4167153		Bacillus_phage(50.0%)	9	NA	NA
WP_007408075.1|3204037_3205309_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	4.0e-12
WP_003152455.1|3205354_3206293_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_031379143.1|3206508_3207228_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	42.5	5.0e-44
WP_039254239.1|3207220_3208960_+	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	42.4	2.6e-46
WP_039254241.1|3209206_3211846_+	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	28.5	3.5e-42
WP_154019765.1|3211870_3212707_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	31.6	1.1e-23
WP_003152461.1|3212838_3213471_+	sporulation membrane protein YtaF	NA	NA	NA	NA	NA
WP_039254246.1|3213486_3214080_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_007408081.1|3214118_3214961_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	51.5	5.1e-80
>prophage 255
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3218257	3231419	4167153	tRNA,holin	Synechococcus_phage(20.0%)	13	NA	NA
WP_003152471.1|3218257_3218638_+	S-adenosylmethionine decarboxylase proenzyme	NA	Q5GQE8	Synechococcus_phage	41.8	2.1e-17
WP_003152473.1|3218885_3219344_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_039254250.1|3219455_3220865_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_012118157.1|3220889_3221825_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	30.4	4.4e-32
WP_007408086.1|3221856_3222498_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_039254253.1|3222563_3223394_+	putative sporulation protein YtxC	NA	NA	NA	NA	NA
WP_015417978.1|3223803_3225735_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.3	4.9e-110
WP_015240354.1|3225788_3226583_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_039254256.1|3226769_3228551_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.8	3.6e-75
WP_015417976.1|3228528_3229263_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015417975.1|3229392_3229830_+|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_062623537.1|3229842_3230526_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
WP_071543361.1|3230897_3231419_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	36.5	9.3e-16
>prophage 256
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3253219	3254254	4167153	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_003152530.1|3253219_3254254_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	32.4	5.0e-29
>prophage 257
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3258697	3265816	4167153		Cafeteria_roenbergensis_virus(33.33%)	5	NA	NA
WP_039254303.1|3258697_3260410_+	DNA polymerase/3'-5' exonuclease PolX	NA	E3T5M9	Cafeteria_roenbergensis_virus	23.6	9.2e-12
WP_015417955.1|3260430_3262788_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	43.4	2.9e-16
WP_003152541.1|3262804_3263209_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_039254306.1|3263347_3264022_-	DUF2711 family protein	NA	NA	NA	NA	NA
WP_039254310.1|3264127_3265816_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	26.9	1.8e-36
>prophage 258
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3270934	3271249	4167153		Indivirus(100.0%)	1	NA	NA
WP_003152560.1|3270934_3271249_+	thioredoxin	NA	A0A1V0SD63	Indivirus	43.0	3.5e-10
>prophage 259
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3279331	3279556	4167153		Caldibacillus_phage(100.0%)	1	NA	NA
WP_003152579.1|3279331_3279556_+	spore germination protein GerE	NA	A0A290GJH9	Caldibacillus_phage	77.0	1.5e-15
>prophage 260
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3283058	3289984	4167153		Bodo_saltans_virus(33.33%)	4	NA	NA
WP_088056439.1|3283058_3283655_+	XTP/dITP diphosphatase	NA	A0A2H4UUV7	Bodo_saltans_virus	31.2	2.5e-09
WP_040237873.1|3283670_3284180_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_040237875.1|3285214_3288421_+	type I restriction-modification system endonuclease	NA	Q5YA94	Bacillus_phage	29.5	1.7e-06
WP_060674756.1|3288553_3289984_+	N-6 DNA methylase	NA	A0A220A2U4	Liberibacter_phage	25.7	2.0e-28
>prophage 261
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3293989	3298823	4167153		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_062623543.1|3293989_3295714_+	acetolactate synthase large subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	29.4	2.0e-59
WP_003152598.1|3295710_3296229_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_003152600.1|3296251_3297280_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_033574188.1|3297266_3298823_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	34.1	1.7e-09
>prophage 262
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3304907	3352489	4167153	tRNA,coat,protease	uncultured_Mediterranean_phage(25.0%)	49	NA	NA
WP_007408149.1|3304907_3306170_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.3	4.2e-147
WP_039254342.1|3306319_3307984_+|protease	ATP-dependent protease LonB	protease	A0A167RA83	Powai_lake_megavirus	33.3	3.0e-15
WP_040237880.1|3308183_3310508_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	44.2	1.8e-183
WP_007612895.1|3310504_3311092_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_040237881.1|3311124_3311616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003152628.1|3311810_3313178_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_015417935.1|3313185_3314016_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_007408155.1|3314050_3314992_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_015417934.1|3314981_3315761_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_099686900.1|3315766_3316741_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_012118112.1|3316769_3318059_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_062623535.1|3318191_3320066_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_040238959.1|3320099_3321122_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_003152639.1|3321136_3321328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015417930.1|3321780_3324423_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.3	3.7e-161
WP_015417929.1|3324481_3325774_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_015417928.1|3325913_3326666_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_015417927.1|3326792_3327794_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_015417926.1|3327934_3328504_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_032866595.1|3328535_3329231_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_003152647.1|3329322_3330336_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_007408166.1|3330366_3331230_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_007408167.1|3331226_3331745_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003152653.1|3331798_3332479_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003152655.1|3332481_3333285_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_007408168.1|3333412_3334216_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_015417924.1|3334208_3335075_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003152660.1|3335220_3335529_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_012118103.1|3335531_3335873_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_003152662.1|3335885_3336170_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_015417923.1|3336487_3337066_+	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_062623534.1|3337097_3338384_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_007408173.1|3338437_3338881_+	transcriptional regulator ThrR	NA	NA	NA	NA	NA
WP_003152668.1|3338894_3339752_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_012118101.1|3339776_3340319_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_039254362.1|3340315_3341467_-	IscS subfamily cysteine desulfurase	NA	A0A141ZJV0	Faustovirus	29.6	1.3e-30
WP_039254365.1|3341571_3343137_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_015417919.1|3343118_3343967_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_012118097.1|3343968_3345072_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_015417918.1|3345198_3346386_+|coat	SafA/ExsA family spore coat assembly protein	coat	NA	NA	NA	NA
WP_014721606.1|3346534_3347128_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_007408183.1|3347141_3347381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015417917.1|3347513_3348023_+	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003152683.1|3348157_3348763_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_062623533.1|3348773_3349778_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.2e-08
WP_031378914.1|3349770_3349971_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_003152692.1|3349996_3351025_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_007408186.1|3351052_3352198_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	8.1e-89
WP_003152695.1|3352228_3352489_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.9	1.5e-06
>prophage 263
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3355762	3372542	4167153	tRNA	Bacillus_phage(25.0%)	13	NA	NA
WP_015417914.1|3355762_3357982_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	31.3	3.5e-27
WP_015417913.1|3358113_3358611_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_014418528.1|3358674_3359001_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_031378915.1|3359056_3361417_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	34.8	1.4e-90
WP_003152714.1|3361422_3361935_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.2	5.5e-29
WP_003152716.1|3362092_3364297_+	GTP diphosphokinase	NA	A0A2I2L310	Orpheovirus	34.8	1.5e-09
WP_007408194.1|3364309_3364753_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_015417910.1|3364779_3366342_-	SH3 domain-containing protein	NA	E5DV68	Deep-sea_thermophilic_phage	33.3	2.0e-13
WP_012118083.1|3366472_3366643_+	YrzK family protein	NA	NA	NA	NA	NA
WP_015417909.1|3366999_3368274_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_031378916.1|3368288_3370067_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	29.1	8.7e-13
WP_015240289.1|3370392_3371157_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	A0A291ATS8	Pandoravirus	33.0	1.1e-20
WP_062623532.1|3371273_3372542_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	52.6	2.0e-112
>prophage 264
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3376189	3378568	4167153		Brevibacillus_phage(100.0%)	1	NA	NA
WP_015417905.1|3376189_3378568_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.7	1.2e-81
>prophage 265
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3381766	3386743	4167153	tRNA	Planktothrix_phage(50.0%)	3	NA	NA
WP_007408209.1|3381766_3382495_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.3	1.5e-35
WP_033574169.1|3382713_3383775_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_033574168.1|3384106_3386743_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	34.1	4.1e-67
>prophage 266
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3390773	3392684	4167153		Phage_TP(50.0%)	2	NA	NA
WP_003152759.1|3390773_3392042_+	U32 family peptidase	NA	Q6DW11	Phage_TP	32.1	7.3e-38
WP_003152763.1|3392048_3392684_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	39.2	4.1e-34
>prophage 267
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3397829	3399897	4167153		Lactococcus_phage(50.0%)	2	NA	NA
WP_007408220.1|3397829_3398753_+	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	43.4	8.4e-60
WP_062623530.1|3398754_3399897_+	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	28.5	1.8e-19
>prophage 268
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3407819	3410981	4167153		Mycobacterium_phage(100.0%)	1	NA	NA
WP_061860746.1|3407819_3410981_+	cytochrome P450	NA	V5UQK0	Mycobacterium_phage	37.3	2.9e-75
>prophage 269
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3424169	3424691	4167153		Streptococcus_phage(100.0%)	1	NA	NA
WP_033574159.1|3424169_3424691_+	streptothricin N-acetyltransferase SatA	NA	A0A1B0RXL7	Streptococcus_phage	50.0	5.6e-45
>prophage 270
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3430065	3430761	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_015417875.1|3430065_3430761_+	two-component response regulator YrkP	NA	W8CYM9	Bacillus_phage	36.7	4.0e-30
>prophage 271
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3435691	3439132	4167153	portal	Staphylococcus_phage(50.0%)	4	NA	NA
WP_015417866.1|3435691_3436543_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	44.1	1.2e-55
WP_094032320.1|3437003_3437273_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_015417864.1|3437364_3438063_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_007408248.1|3438409_3439132_-	RNA polymerase sporulation sigma factor SigK	NA	A0A0A0RV91	Bacillus_phage	27.1	9.6e-11
>prophage 272
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3447315	3447885	4167153		Bacillus_virus(100.0%)	1	NA	NA
WP_007408258.1|3447315_3447885_+	nicotinate-nucleotide adenylyltransferase	NA	G3MA22	Bacillus_virus	30.2	3.6e-21
>prophage 273
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3451172	3454094	4167153		Bacillus_phage(50.0%)	2	NA	NA
WP_003152868.1|3451172_3451742_+	ComE operon protein 2	NA	A0A127AWN5	Bacillus_phage	56.3	3.7e-34
WP_062623529.1|3451742_3454094_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332B9	Clostridium_botulinum_C_phage	33.9	1.6e-38
>prophage 274
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3458860	3466818	4167153		Streptococcus_phage(33.33%)	6	NA	NA
WP_039254423.1|3458860_3460696_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.1	8.9e-21
WP_015417851.1|3460755_3461895_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_003152889.1|3461975_3463007_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_003152892.1|3463066_3463642_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_007408273.1|3463666_3465505_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.5	4.0e-138
WP_003152895.1|3465690_3466818_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.7	6.7e-27
>prophage 275
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3471248	3471695	4167153		Bacillus_virus(100.0%)	1	NA	NA
WP_007408278.1|3471248_3471695_+	GatB/YqeY domain-containing protein	NA	G3MAQ0	Bacillus_virus	41.2	2.9e-18
>prophage 276
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3476156	3477116	4167153		Rhizobium_phage(100.0%)	1	NA	NA
WP_007408283.1|3476156_3477116_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	44.7	1.8e-52
>prophage 277
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3488262	3498214	4167153	tRNA	Caulobacter_phage(20.0%)	9	NA	NA
WP_062623527.1|3488262_3490074_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	30.5	1.2e-49
WP_003152998.1|3490266_3491388_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.1	5.8e-39
WP_003152999.1|3491738_3492101_+	cytochrome c	NA	NA	NA	NA	NA
WP_033574250.1|3492226_3492931_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_033574147.1|3492923_3494045_+	Nif3-like dinuclear metal center hexameric protein	NA	A0A1S5V250	Saudi_moumouvirus	48.0	6.4e-22
WP_012118007.1|3494065_3495010_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_031378941.1|3495132_3495828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015417834.1|3495993_3497310_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.4	1.7e-53
WP_015417833.1|3497320_3498214_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	31.5	8.5e-25
>prophage 278
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3504405	3505011	4167153		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_003153025.1|3504405_3505011_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.6	9.3e-68
>prophage 279
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3508824	3513208	4167153		Bacillus_virus(66.67%)	5	NA	NA
WP_039254459.1|3508824_3509727_+	phosphate ABC transporter substrate-binding protein	NA	R9S7J3	Prochlorococcus_phage	28.7	8.3e-12
WP_039254462.1|3509775_3510705_+	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_007408306.1|3510704_3511589_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_040237919.1|3511607_3512414_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	9.3e-15
WP_003153040.1|3512425_3513208_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.1	2.4e-15
>prophage 280
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3534987	3543992	4167153		Prochlorococcus_phage(50.0%)	8	NA	NA
WP_031378948.1|3534987_3536658_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	30.9	8.0e-61
WP_031378949.1|3537081_3538182_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_015417808.1|3538196_3539543_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.7	3.0e-58
WP_031378950.1|3539535_3541011_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	E3ST28	Prochlorococcus_phage	42.2	3.2e-85
WP_007408335.1|3541063_3541444_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_015240200.1|3541637_3542474_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_039254499.1|3542573_3543002_+	transcriptional regulator MntR	NA	NA	NA	NA	NA
WP_039254501.1|3543116_3543992_+	patatin-like phospholipase family protein	NA	A0A1V0SFX9	Hokovirus	27.8	7.0e-16
>prophage 281
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3556786	3559105	4167153		Enterococcus_phage(50.0%)	2	NA	NA
WP_007408350.1|3556786_3557638_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	43.9	1.7e-43
WP_039254514.1|3557761_3559105_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	39.1	2.3e-42
>prophage 282
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3567158	3569289	4167153		Bacillus_phage(50.0%)	2	NA	NA
WP_003153177.1|3567158_3567959_+	sporulation transcription factor Spo0A	NA	W8CYM9	Bacillus_phage	35.3	4.2e-07
WP_012117960.1|3568107_3569289_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.2	2.8e-28
>prophage 283
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3573828	3575280	4167153		Bacillus_phage(50.0%)	2	NA	NA
WP_039254526.1|3573828_3574455_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1S5QTQ1	Bacillus_phage	38.8	4.5e-17
WP_015240188.1|3574542_3575280_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	30.1	3.7e-18
>prophage 284
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3592634	3596596	4167153		Catovirus(50.0%)	5	NA	NA
WP_039254547.1|3592634_3593531_-	YegS/Rv2252/BmrU family lipid kinase	NA	A0A1V0SBJ0	Catovirus	23.9	1.2e-15
WP_003153223.1|3593709_3594147_+	bacilliredoxin BrxB	NA	NA	NA	NA	NA
WP_015240174.1|3594392_3595160_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003153227.1|3595221_3595881_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_012117941.1|3595873_3596596_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	3.5e-37
>prophage 285
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3604192	3607161	4167153		Synechococcus_phage(50.0%)	2	NA	NA
WP_003153241.1|3604192_3605602_+	NADP-dependent phosphogluconate dehydrogenase	NA	V5UT40	Synechococcus_phage	34.2	7.5e-36
WP_003153243.1|3605691_3607161_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	38.8	2.1e-81
>prophage 286
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3617277	3636963	4167153		Paenibacillus_phage(66.67%)	3	NA	NA
WP_007408405.1|3617277_3618015_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.6	3.5e-16
WP_062623519.1|3618054_3630648_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.2	2.6e-34
WP_039254578.1|3630666_3636963_+	KR domain-containing protein	NA	D0R7J2	Paenibacillus_phage	27.9	2.3e-31
>prophage 287
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3658399	3678505	4167153		Paenibacillus_phage(100.0%)	3	NA	NA
WP_040237960.1|3658399_3666118_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	28.5	6.0e-34
WP_062623517.1|3666140_3672293_+	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	28.4	2.5e-35
WP_062623516.1|3672289_3678505_+	zinc-binding dehydrogenase	NA	D0R7J2	Paenibacillus_phage	29.2	9.7e-35
>prophage 288
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3681888	3682728	4167153		Streptococcus_phage(100.0%)	1	NA	NA
WP_039254613.1|3681888_3682728_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	32.3	4.5e-28
>prophage 289
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3686306	3698235	4167153		uncultured_Mediterranean_phage(16.67%)	19	NA	NA
WP_015417761.1|3686306_3687266_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	36.1	2.6e-32
WP_029973629.1|3687290_3687680_+	VOC family protein	NA	V5UQY3	Oenococcus_phage	52.4	2.4e-32
WP_094032266.1|3687681_3687849_-	DUF4083 domain-containing protein	NA	NA	NA	NA	NA
WP_015417760.1|3687929_3689012_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_003153294.1|3689085_3689292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409390.1|3689393_3689738_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_062623515.1|3689753_3690980_-	DNA polymerase IV	NA	O64031	Bacillus_phage	44.6	2.4e-78
WP_012117908.1|3691195_3691666_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015240143.1|3691678_3692023_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_062623514.1|3692019_3692988_+	GNAT family N-acetyltransferase	NA	A0A2K5B2B6	Erysipelothrix_phage	42.9	2.8e-34
WP_014305346.1|3693059_3693422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153307.1|3693396_3693636_+	DUF2552 family protein	NA	NA	NA	NA	NA
WP_039254624.1|3693675_3694590_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_007409396.1|3694712_3694937_+	YqkE family protein	NA	NA	NA	NA	NA
WP_015417754.1|3694969_3695890_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.7	1.3e-07
WP_003153315.1|3695952_3696075_-	Z-ring formation inhibitor MciZ	NA	NA	NA	NA	NA
WP_031378964.1|3696153_3696708_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_062623513.1|3696707_3697871_+	TIGR00375 family protein	NA	NA	NA	NA	NA
WP_007409399.1|3697881_3698235_-	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	36.7	4.1e-07
>prophage 290
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3706060	3712104	4167153		Brevibacillus_phage(25.0%)	7	NA	NA
WP_007612347.1|3706060_3706951_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	33.7	1.3e-41
WP_015417748.1|3707118_3708303_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_007409407.1|3708314_3709133_+	purine-nucleoside phosphorylase	NA	Q5YBA4	Grouper_iridovirus	48.0	9.7e-68
WP_039254642.1|3709269_3710439_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.3	2.2e-36
WP_007409411.1|3710534_3710888_+	anti-sigma F factor antagonist	NA	NA	NA	NA	NA
WP_003153347.1|3710884_3711325_+	anti-sigma F factor	NA	NA	NA	NA	NA
WP_003153348.1|3711336_3712104_+	RNA polymerase sporulation sigma factor SigF	NA	A0A0Y0AU18	Bacillus_phage	60.9	1.3e-71
>prophage 291
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3719828	3730637	4167153		Staphylococcus_phage(50.0%)	15	NA	NA
WP_003153363.1|3719828_3720260_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	36.6	9.4e-14
WP_015417746.1|3720409_3720901_+	DUF1453 family protein	NA	NA	NA	NA	NA
WP_033574742.1|3720981_3721557_+	signal peptidase I	NA	NA	NA	NA	NA
WP_007409423.1|3721804_3722149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015417744.1|3722546_3723662_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	1.7e-54
WP_015417743.1|3723642_3724290_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.3	2.6e-39
WP_015417742.1|3724304_3725501_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	54.9	9.6e-117
WP_003153372.1|3725533_3725998_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	59.3	1.2e-43
WP_003153373.1|3726114_3726489_+	GNAT family N-acetyltransferase RibT	NA	NA	NA	NA	NA
WP_015417741.1|3726554_3727076_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_003153376.1|3727163_3727253_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_007409427.1|3727460_3728216_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.7	2.9e-10
WP_062623511.1|3728205_3728799_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.4	1.5e-14
WP_033574737.1|3728888_3729374_+	DUF3907 family protein	NA	NA	NA	NA	NA
WP_031378974.1|3729485_3730637_+	D-alanyl-D-alanine carboxypeptidase	NA	A0A1P8VVG5	Erythrobacter_phage	27.5	1.0e-06
>prophage 292
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3736108	3746305	4167153		Bacillus_phage(60.0%)	9	NA	NA
WP_003153397.1|3736108_3736831_+	DNA-binding response regulator ResD	NA	W8CYM9	Bacillus_phage	42.6	2.9e-44
WP_007409435.1|3736827_3738609_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	38.1	3.0e-37
WP_003153399.1|3738799_3739384_+	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_031378976.1|3739358_3740420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007409437.1|3740466_3742044_-	phosphoglycerate dehydrogenase	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	32.8	1.1e-27
WP_108490751.1|3742472_3743105_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_003153403.1|3743246_3743495_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	56.8	1.6e-18
WP_040237977.1|3743763_3744822_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_039254663.1|3744814_3746305_+	ATP-dependent DNA helicase RecQ	NA	F2NZ48	Diadromus_pulchellus_ascovirus	37.9	7.4e-58
>prophage 293
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3753212	3754082	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_039254679.1|3753212_3754082_+	spore cortex-lytic enzyme	NA	A0A0E3XAL9	Bacillus_phage	39.1	9.4e-21
>prophage 294
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3766333	3773000	4167153		Bacillus_phage(25.0%)	9	NA	NA
WP_003153447.1|3766333_3766612_+	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	75.3	1.1e-28
WP_003153448.1|3766798_3767371_+	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	55.7	1.3e-50
WP_003153449.1|3767391_3767619_+	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_007409455.1|3767775_3768531_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_003153453.1|3768536_3769238_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_003153454.1|3769266_3770229_+	heptaprenyl diphosphate synthase component II	NA	NA	NA	NA	NA
WP_015417727.1|3770349_3770796_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	45.0	6.3e-29
WP_015417726.1|3770985_3771756_+	protein-glutamate O-methyltransferase	NA	NA	NA	NA	NA
WP_003153459.1|3771827_3773000_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.5	5.0e-41
>prophage 295
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3776210	3781697	4167153		Acinetobacter_phage(66.67%)	6	NA	NA
WP_031378983.1|3776210_3777227_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.6	8.3e-53
WP_015417722.1|3777219_3777972_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	40.5	7.6e-43
WP_015417721.1|3777976_3778630_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_020954213.1|3778610_3779813_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_007409464.1|3779805_3780603_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_039254705.1|3780614_3781697_+	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.5	1.2e-20
>prophage 296
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3785823	3786363	4167153		Bacillus_virus(100.0%)	1	NA	NA
WP_015417715.1|3785823_3786363_+	YpiB family protein	NA	G3MAV7	Bacillus_virus	48.0	3.5e-42
>prophage 297
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3791758	3792631	4167153		Streptococcus_phage(100.0%)	1	NA	NA
WP_003153493.1|3791758_3792631_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	45.5	2.4e-72
>prophage 298
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3796198	3867760	4167153	coat,tail,holin,integrase,tRNA	Bacillus_phage(75.76%)	71	3816787:3816802	3866325:3866340
WP_039254720.1|3796198_3797389_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	46.3	1.4e-38
WP_012117846.1|3797373_3798351_+	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_039254724.1|3798595_3799429_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	38.3	9.9e-52
WP_039254727.1|3799432_3800293_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_003153510.1|3800294_3800678_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_040237992.1|3800799_3803586_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	29.2	7.9e-61
WP_003153512.1|3803733_3803904_+	YpmA family protein	NA	NA	NA	NA	NA
WP_007409483.1|3803913_3804399_+	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_015417706.1|3804421_3805603_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_039254732.1|3805737_3807030_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.5	1.0e-55
WP_003153516.1|3807124_3807823_+	DnaD domain-containing protein	NA	NA	NA	NA	NA
WP_007612187.1|3807841_3808501_+	endonuclease III	NA	NA	NA	NA	NA
WP_039254733.1|3808497_3808989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039254735.1|3809066_3811850_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_015417702.1|3811888_3812497_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	34.3	5.9e-22
WP_015417701.1|3812538_3813501_+	DUF2515 domain-containing protein	NA	NA	NA	NA	NA
WP_003153525.1|3813544_3813649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012117836.1|3813855_3814101_+	DUF5446 family protein	NA	NA	NA	NA	NA
WP_007409492.1|3814146_3814515_+	YppE family protein	NA	NA	NA	NA	NA
WP_003153532.1|3814553_3814736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007409493.1|3814922_3815357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039254739.1|3815386_3815800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012117833.1|3815938_3816445_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_039254742.1|3816543_3818790_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	27.3	9.6e-09
3816787:3816802	attL	AAAACACTGTGCTATA	NA	NA	NA	NA
WP_033574709.1|3818809_3820048_+	ribonuclease H-like domain-containing protein	NA	NA	NA	NA	NA
WP_007409498.1|3820181_3820277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153539.1|3820360_3820597_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_033574708.1|3820685_3821234_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_003153541.1|3821313_3821613_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_040237997.1|3822146_3823313_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_003153548.1|3823353_3823506_-	YpzG family protein	NA	NA	NA	NA	NA
WP_039254745.1|3823671_3823863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032866285.1|3823966_3825886_+	ATP-dependent DNA helicase	NA	A0A2P1N0K5	Streptomyces_phage	21.8	1.8e-11
WP_039254748.1|3825997_3827500_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_039254751.1|3827834_3828419_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_062623510.1|3828833_3830375_-	recombinase family protein	NA	I3VYZ3	Thermoanaerobacterium_phage	32.1	6.3e-36
WP_062623509.1|3830624_3831605_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	76.8	3.5e-80
WP_064323388.1|3831781_3833497_+	ribonuclease YeeF family protein	NA	O64023	Bacillus_phage	77.1	5.4e-254
WP_014417844.1|3833505_3833994_+	SMI1/KNR4 family protein	NA	O64024	Bacillus_phage	89.4	5.2e-85
WP_021493640.1|3833983_3834472_+	antitoxin YezG family protein	NA	NA	NA	NA	NA
WP_079891318.1|3834573_3835047_+	SMI1/KNR4 family protein	NA	A0A1P8CWM6	Bacillus_phage	65.8	2.5e-60
WP_076982784.1|3835343_3835433_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_021493638.1|3835676_3835880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079891308.1|3836008_3836782_+	sporulation protein YunB	NA	NA	NA	NA	NA
WP_014472056.1|3837009_3837342_+	YolD-like family protein	NA	A0A1P8CWP2	Bacillus_phage	74.5	6.3e-42
WP_062623501.1|3837334_3838585_+	UV damage repair protein UvrX	NA	O64031	Bacillus_phage	91.1	1.5e-221
WP_079891309.1|3838748_3839909_-	tetratricopeptide repeat protein	NA	A0A1P8CWN8	Bacillus_phage	26.3	3.8e-33
WP_062623508.1|3840060_3840321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014417851.1|3840677_3840929_-|holin	phage holin	holin	A0A1P8CWN5	Bacillus_phage	86.7	5.2e-33
WP_045208155.1|3840941_3841313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062623500.1|3841419_3842463_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A1J0MS59	Bacillus_phage	56.1	6.1e-91
WP_062623499.1|3842635_3845161_-	hypothetical protein	NA	D6R401	Bacillus_phage	38.3	2.1e-145
WP_045207994.1|3845202_3846021_-	hypothetical protein	NA	A0A1P8CWP7	Bacillus_phage	70.5	3.5e-110
WP_062623498.1|3849335_3850094_-|tail	phage tail family protein	tail	O64045	Bacillus_phage	84.1	1.9e-126
WP_062623497.1|3850151_3857030_-|tail	phage tail tape measure protein	tail	A0A1P8CWQ1	Bacillus_phage	78.8	0.0e+00
WP_045207988.1|3857093_3857720_-	hypothetical protein	NA	A0A0H3UZD5	Geobacillus_virus	31.7	2.1e-22
WP_045207987.1|3857805_3858234_-	hypothetical protein	NA	O64047	Bacillus_phage	37.4	1.4e-14
WP_052510545.1|3858309_3858846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062623496.1|3859466_3860486_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3U2P3	Fusobacterium_phage	35.8	3.0e-50
WP_062623495.1|3860499_3860916_-	hypothetical protein	NA	A0A1P8CWQ4	Bacillus_phage	66.9	1.4e-46
WP_062623494.1|3860915_3861401_-	hypothetical protein	NA	A0A1P8CWQ6	Bacillus_phage	68.4	9.5e-55
WP_021493613.1|3861483_3862332_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_014470095.1|3862350_3862503_-	XkdX family protein	NA	NA	NA	NA	NA
WP_021493612.1|3862503_3862779_-	hypothetical protein	NA	M4ZR44	Bacillus_phage	37.2	4.0e-10
WP_062623493.1|3862792_3864124_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	53.5	5.0e-21
WP_062623492.1|3864123_3864480_-	hypothetical protein	NA	O64055	Bacillus_phage	79.7	8.2e-48
WP_062623491.1|3864551_3865019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062623490.1|3865039_3865831_-	hypothetical protein	NA	A0A1P8CWR0	Bacillus_phage	37.5	1.8e-18
WP_062623489.1|3865869_3866595_-	hypothetical protein	NA	A0A1P8CWQ7	Bacillus_phage	33.2	1.9e-27
3866325:3866340	attR	AAAACACTGTGCTATA	NA	NA	NA	NA
WP_062623488.1|3866591_3867098_-	hypothetical protein	NA	O64060	Bacillus_phage	69.0	2.3e-64
WP_062623487.1|3867094_3867760_-	hypothetical protein	NA	A0A1P8CWR8	Bacillus_phage	50.0	5.3e-48
>prophage 299
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3873064	3968825	4167153	tRNA,integrase	Bacillus_phage(89.77%)	132	3892462:3892486	3925796:3925820
WP_062623481.1|3873064_3874813_-	hypothetical protein	NA	A0A0K2FLD6	Brevibacillus_phage	30.8	8.7e-66
WP_062623480.1|3874812_3875820_-	hypothetical protein	NA	Q331V7	Clostridium_botulinum_C_phage	24.2	1.6e-08
WP_062623479.1|3875923_3876454_-	hypothetical protein	NA	U5J9P3	Bacillus_phage	32.8	5.7e-13
WP_172406367.1|3876920_3877073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062623478.1|3877087_3878305_-	hypothetical protein	NA	A0A1P8CWS1	Bacillus_phage	99.5	3.3e-229
WP_062623477.1|3878317_3878509_-	YonK family protein	NA	A0A1P8CWT3	Bacillus_phage	98.4	5.6e-27
WP_062623476.1|3878786_3879449_-	hypothetical protein	NA	K7PJU1	Enterobacteria_phage	39.9	5.5e-29
WP_062623475.1|3879502_3879793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020954168.1|3880387_3880663_-	HU family DNA-binding protein	NA	A0A1P8CWT5	Bacillus_phage	95.6	9.2e-39
WP_062623474.1|3880916_3883442_-	hypothetical protein	NA	O64076	Bacillus_phage	84.6	0.0e+00
WP_014417885.1|3883482_3883662_-	hypothetical protein	NA	A0A1P8CWT4	Bacillus_phage	71.2	1.5e-18
WP_020954165.1|3883781_3884018_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062623473.1|3884196_3884481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623472.1|3884480_3885593_+	cell division protein FtsZ	NA	G3MBK4	Bacillus_virus	29.8	2.2e-30
WP_021493589.1|3887062_3887302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623470.1|3887382_3888615_+	hypothetical protein	NA	O64082	Bacillus_phage	64.5	2.9e-156
WP_062623469.1|3888922_3890794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623468.1|3890840_3892445_+	DUF4942 domain-containing protein	NA	A0A2I7RNS1	Vibrio_phage	33.7	3.2e-14
3892462:3892486	attL	AGAATAAAAATAAAATAGTTATTGA	NA	NA	NA	NA
WP_062623467.1|3892810_3893734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623466.1|3894110_3895028_+	restriction endonuclease	NA	A0A1P8CWV0	Bacillus_phage	83.2	5.8e-138
WP_062623465.1|3895395_3896487_-	acyltransferase	NA	NA	NA	NA	NA
WP_062623464.1|3896967_3897240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623463.1|3897319_3897757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623462.1|3897850_3898063_+	helix-turn-helix transcriptional regulator	NA	A0A1P8CWU2	Bacillus_phage	73.9	1.2e-22
WP_041482531.1|3898110_3898338_+	helix-turn-helix transcriptional regulator	NA	O64085	Bacillus_phage	40.8	4.8e-09
WP_062623507.1|3898416_3898632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623461.1|3898743_3898935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623460.1|3898966_3899344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057080572.1|3899446_3899998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623459.1|3900040_3900268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623458.1|3900298_3900523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041482308.1|3900537_3900720_-	hypothetical protein	NA	A0A1P8CWV7	Bacillus_phage	89.7	1.0e-25
WP_062623457.1|3900790_3901042_+	hypothetical protein	NA	A0A1P8CWV6	Bacillus_phage	63.4	5.4e-22
WP_062623456.1|3901044_3901260_+	hypothetical protein	NA	A0A1P8CWW0	Bacillus_phage	52.1	1.1e-12
WP_014417905.1|3901271_3901403_+	hypothetical protein	NA	A0A1P8CWV9	Bacillus_phage	90.7	9.4e-18
WP_062623455.1|3901826_3902918_+	hypothetical protein	NA	A0A1P8CWW3	Bacillus_phage	25.7	6.9e-13
WP_062623454.1|3903073_3904219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142396152.1|3904247_3904379_+	lysogeny pheromone AimP family peptide	NA	NA	NA	NA	NA
WP_172798707.1|3904508_3904664_+	hypothetical protein	NA	A0A1P8CWW2	Bacillus_phage	64.7	6.5e-10
WP_014472000.1|3904813_3905026_+	hypothetical protein	NA	A0A1P8CWW7	Bacillus_phage	78.5	1.6e-22
WP_014471999.1|3905040_3905271_+	hypothetical protein	NA	A0A1P8CWW1	Bacillus_phage	72.3	5.5e-21
WP_014721236.1|3905309_3905474_+	hypothetical protein	NA	A0A1P8CWX2	Bacillus_phage	52.6	3.9e-05
WP_062623453.1|3905483_3906542_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8CWW9	Bacillus_phage	76.0	1.8e-154
WP_062623452.1|3906618_3907968_+	hypothetical protein	NA	A0A1P8CWX1	Bacillus_phage	75.2	4.8e-189
WP_062623451.1|3907988_3908972_+	hypothetical protein	NA	A0A1P8CWX4	Bacillus_phage	78.0	1.9e-139
WP_021493552.1|3909192_3909414_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CWW6	Bacillus_phage	79.5	2.2e-27
WP_020954129.1|3909579_3909879_+	hypothetical protein	NA	A0A1P8CWX3	Bacillus_phage	50.0	1.0e-19
WP_020954128.1|3909953_3910199_+	hypothetical protein	NA	A0A1P8CWW5	Bacillus_phage	52.0	5.7e-16
WP_062623450.1|3910306_3910531_+	hypothetical protein	NA	A0A1P8CWW8	Bacillus_phage	53.2	5.2e-16
WP_062623449.1|3910564_3910987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623448.1|3910983_3911187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623506.1|3911359_3911767_+	hypothetical protein	NA	A0A1P8CWY3	Bacillus_phage	91.9	1.1e-67
WP_062623447.1|3911815_3914014_+	metallophosphoesterase	NA	Q4Z932	Staphylococcus_phage	43.1	1.4e-158
WP_062623446.1|3914061_3914385_+	hypothetical protein	NA	A0A1P8CWY4	Bacillus_phage	95.2	6.5e-52
WP_062623445.1|3914428_3914704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623444.1|3915030_3915648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046559767.1|3915850_3916066_+	hypothetical protein	NA	A0A1P8CX01	Bacillus_phage	97.2	1.1e-31
WP_062623443.1|3916079_3916454_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	61.8	1.4e-34
WP_172798708.1|3916568_3916733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623442.1|3916822_3917347_+	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	56.1	4.6e-47
WP_062623441.1|3917358_3917667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623440.1|3917707_3918211_+	deoxyuridine 5'-triphosphate nucleotidohydrolase	NA	D2XR49	Bacillus_phage	52.1	4.6e-36
WP_062623439.1|3918735_3919548_-	ATP-dependent DNA ligase	NA	O64130	Bacillus_phage	87.8	3.6e-139
WP_062623438.1|3919617_3920292_-	SOS response-associated peptidase	NA	A0A1P8CX02	Bacillus_phage	96.5	2.5e-77
WP_062623437.1|3920364_3920631_+	hypothetical protein	NA	O64132	Bacillus_phage	89.9	4.9e-29
WP_062623436.1|3920605_3920812_+	hypothetical protein	NA	A0A1P8CWZ9	Bacillus_phage	77.1	1.6e-11
WP_062623435.1|3920817_3921258_+	hypothetical protein	NA	A0A1S5SCZ9	Streptococcus_phage	35.6	2.4e-12
WP_062623434.1|3921431_3922256_+	poly-gamma-glutamate hydrolase family protein	NA	O64134	Bacillus_phage	62.7	1.0e-88
WP_062623433.1|3922252_3923995_+	right-handed parallel beta-helix repeat-containing protein	NA	O64135	Bacillus_phage	68.6	7.2e-222
WP_062623432.1|3924107_3924632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623431.1|3924971_3925349_+	hypothetical protein	NA	A0A1P8CX06	Bacillus_phage	76.2	9.9e-52
WP_038458620.1|3925878_3926259_+	hypothetical protein	NA	A0A1P8CX10	Bacillus_phage	79.2	6.3e-54
3925796:3925820	attR	AGAATAAAAATAAAATAGTTATTGA	NA	NA	NA	NA
WP_062623430.1|3926281_3927196_+	hypothetical protein	NA	O64140	Bacillus_phage	89.8	3.1e-155
WP_062623429.1|3927284_3928256_+	ATP-binding protein	NA	A0A1P8CX29	Bacillus_phage	95.7	5.9e-173
WP_062623428.1|3928297_3928768_+	hypothetical protein	NA	A0A1P8CX08	Bacillus_phage	91.0	4.4e-81
WP_062623427.1|3928782_3930297_+	hypothetical protein	NA	A0A1P8CWZ7	Bacillus_phage	95.0	2.9e-275
WP_062623426.1|3930312_3931449_+	hypothetical protein	NA	A0A1P8CX05	Bacillus_phage	89.7	1.1e-205
WP_062623425.1|3931448_3933176_+	single-stranded-DNA-specific exonuclease RecJ	NA	A0A1P8CX07	Bacillus_phage	80.6	6.8e-273
WP_062623424.1|3933188_3937118_+	DNA polymerase III subunit alpha	NA	A0A1P8CX14	Bacillus_phage	84.9	0.0e+00
WP_062623423.1|3937144_3937852_+	hypothetical protein	NA	O64147	Bacillus_phage	34.0	3.9e-25
WP_062623422.1|3937863_3938067_+	YorP family protein	NA	O64150	Bacillus_phage	79.1	2.3e-26
WP_165882056.1|3938071_3938230_+	hypothetical protein	NA	A0A1P8CX36	Bacillus_phage	64.7	3.2e-12
WP_062623421.1|3938226_3938724_+	AAA family ATPase	NA	A0A1P8CX28	Bacillus_phage	79.9	8.2e-70
WP_108490816.1|3938768_3939602_+	ribose-phosphate pyrophosphokinase	NA	A0A218KC69	Bacillus_phage	54.7	1.5e-76
WP_062623419.1|3939648_3941127_+	nicotinate phosphoribosyltransferase	NA	A0A218KC49	Bacillus_phage	65.1	5.6e-191
WP_062623418.1|3941177_3941396_+	hypothetical protein	NA	O64155	Bacillus_phage	55.7	2.3e-13
WP_079891311.1|3941433_3941661_+	hypothetical protein	NA	O64157	Bacillus_phage	80.0	9.3e-29
WP_047474354.1|3941675_3941873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623417.1|3942057_3942816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154019766.1|3943341_3943515_+	hypothetical protein	NA	A0A1P8CX41	Bacillus_phage	94.7	5.2e-24
WP_062623415.1|3943613_3944087_+	hypothetical protein	NA	O64162	Bacillus_phage	66.9	1.6e-59
WP_062623414.1|3944119_3944299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623413.1|3944316_3944769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623412.1|3944769_3945174_+	hypothetical protein	NA	A0A1P8CX27	Bacillus_phage	61.9	3.4e-34
WP_062623411.1|3945188_3945536_+	hypothetical protein	NA	O64164	Bacillus_phage	88.7	5.9e-51
WP_062623505.1|3945581_3945887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623410.1|3945913_3946285_+	hypothetical protein	NA	Q5YA89	Bacillus_phage	33.6	9.6e-07
WP_062623409.1|3946330_3946684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623408.1|3946737_3947049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154019767.1|3947082_3947232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047474375.1|3947250_3947601_+	hypothetical protein	NA	O64171	Bacillus_phage	45.8	1.4e-20
WP_062623407.1|3947597_3947993_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A1P8CX56	Bacillus_phage	83.2	4.1e-56
WP_079891312.1|3947955_3950055_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A1P8CX40	Bacillus_phage	61.4	0.0e+00
WP_079891313.1|3950285_3951284_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A076G7U1	Bacillus_phage	79.9	2.7e-149
WP_062623404.1|3951280_3951523_+	thioredoxin family protein	NA	A0A1P8CX24	Bacillus_phage	74.7	5.8e-29
WP_014470241.1|3951750_3952107_+|tRNA	peptidyl-tRNA hydrolase	tRNA	A0A1V0SFB5	Hokovirus	29.8	9.8e-09
WP_062623402.1|3952153_3952768_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	42.7	4.7e-43
WP_041482552.1|3953189_3953498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623401.1|3953490_3953790_+	hypothetical protein	NA	A0A1P8CX63	Bacillus_phage	54.7	1.4e-19
WP_062623399.1|3954565_3955405_+	thymidylate synthase	NA	A0A1P8CX42	Bacillus_phage	88.9	2.7e-150
WP_062623398.1|3955404_3955911_+	dihydrofolate reductase	NA	A0A0H3UYW4	Geobacillus_virus	41.5	3.7e-33
WP_062623397.1|3956039_3956405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623396.1|3956464_3956836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623395.1|3957053_3958232_+	hypothetical protein	NA	R4JEY6	Bacillus_phage	39.6	1.1e-56
WP_062623394.1|3958228_3958774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623393.1|3958787_3959135_+	hypothetical protein	NA	R4JGJ3	Bacillus_phage	37.9	3.0e-10
WP_062623392.1|3959262_3959604_+	hypothetical protein	NA	Q9ZXC6	Bacillus_phage	71.2	7.4e-22
WP_026113716.1|3960089_3961037_+	HNH endonuclease	NA	A0A1B1P765	Bacillus_phage	43.4	3.4e-16
WP_062623391.1|3961869_3962088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623390.1|3962109_3962667_+	hypothetical protein	NA	A0A140HLT6	Bacillus_phage	57.2	1.9e-59
WP_062623389.1|3962701_3962881_+	hypothetical protein	NA	A0A1P8CWU9	Bacillus_phage	86.4	3.5e-23
WP_154019768.1|3962925_3963066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623388.1|3963110_3963350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105322079.1|3963735_3964149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079891314.1|3964123_3964540_+	hypothetical protein	NA	A0A1P8CX53	Bacillus_phage	72.3	4.5e-37
WP_062623386.1|3964536_3964875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062623385.1|3964923_3965472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172798709.1|3965472_3965643_+	hypothetical protein	NA	O64190	Bacillus_phage	57.9	8.8e-08
WP_062623384.1|3965639_3965903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014470254.1|3966294_3966534_-	helix-turn-helix transcriptional regulator	NA	A0A1P8CX60	Bacillus_phage	65.8	6.5e-25
WP_062623383.1|3966631_3967186_+	hypothetical protein	NA	O64195	Bacillus_phage	89.9	1.5e-88
WP_039254755.1|3968549_3968825_-	hypothetical protein	NA	O64122	Bacillus_phage	41.8	6.6e-05
>prophage 300
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3979072	3983043	4167153		Bacillus_phage(33.33%)	9	NA	NA
WP_040238009.1|3979072_3979960_+	5'-3' exonuclease	NA	F8WQ40	Bacillus_phage	30.6	9.6e-21
WP_003153575.1|3979965_3980094_-	small, acid-soluble spore protein L	NA	NA	NA	NA	NA
WP_025649782.1|3980145_3980538_-	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_003153578.1|3980544_3981225_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.2	9.6e-13
WP_040238011.1|3981306_3981978_+	reverse transcriptase-like protein	NA	NA	NA	NA	NA
WP_040238014.1|3981980_3982163_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_007409519.1|3982189_3982447_-	DUF2564 family protein	NA	NA	NA	NA	NA
WP_012117812.1|3982608_3982791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003153604.1|3982842_3983043_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	61.9	5.5e-17
>prophage 301
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	3992348	3993625	4167153		Geobacillus_virus(50.0%)	2	NA	NA
WP_003153622.1|3992348_3993143_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	67.4	3.5e-107
WP_062623382.1|3993139_3993625_+	dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	45.9	7.1e-34
>prophage 302
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	4001454	4011176	4167153		Bacillus_phage(87.5%)	11	NA	NA
WP_012117802.1|4001454_4002045_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	31.1	2.2e-13
WP_061860649.1|4002067_4003735_-	recombinase family protein	NA	O64015	Bacillus_phage	91.0	6.4e-276
WP_039254795.1|4003951_4004917_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	75.4	4.9e-79
WP_076982865.1|4005181_4005616_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_033574690.1|4005652_4007404_+	HNH endonuclease	NA	A0A1P8CWI7	Bacillus_phage	67.1	6.8e-228
WP_033574689.1|4007405_4008002_+	SMI1/KNR4 family protein	NA	O64025	Bacillus_phage	81.9	1.7e-85
WP_033574688.1|4008097_4008430_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016936664.1|4008483_4008606_-	phosphatase RapK inhibitor PhrK	NA	NA	NA	NA	NA
WP_039254799.1|4008602_4009718_-	tetratricopeptide repeat protein	NA	D6R410	Bacillus_phage	48.4	6.3e-94
WP_039254802.1|4010115_4010568_+	hypothetical protein	NA	O64117	Bacillus_phage	78.0	5.7e-62
WP_015417664.1|4010801_4011176_-	hypothetical protein	NA	A0A1P8CWZ2	Bacillus_phage	52.0	1.2e-28
>prophage 303
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	4016513	4017149	4167153		Bacillus_phage(50.0%)	2	NA	NA
WP_015417661.1|4016513_4016690_+	hypothetical protein	NA	O64196	Bacillus_phage	91.4	3.2e-21
WP_003153663.1|4016723_4017149_-	SDR family NAD(P)-dependent oxidoreductase	NA	A0A1V0SAI8	Catovirus	35.6	2.7e-13
>prophage 304
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	4023085	4023532	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_039255090.1|4023085_4023532_+	GyrI-like domain-containing protein	NA	A0A1P8CX48	Bacillus_phage	72.5	2.6e-59
>prophage 305
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	4054181	4058596	4167153		Phthorimaea_operculella_granulovirus(33.33%)	4	NA	NA
WP_039254869.1|4054181_4055393_+	glycosyl transferase family 1	NA	G4WEM5	Phthorimaea_operculella_granulovirus	30.1	1.6e-05
WP_039254872.1|4055713_4056955_+	peptidoglycan endopeptidase	NA	A0A1V0DZX6	Clostridioides_phage	41.2	3.4e-16
WP_007407968.1|4057037_4057628_+	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_033574665.1|4057705_4058596_+	MoxR family ATPase	NA	R4TG24	Halovirus	26.7	2.7e-07
>prophage 306
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	4068247	4069093	4167153		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_007407976.1|4068247_4069093_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	41.3	8.5e-35
>prophage 307
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	4077433	4080317	4167153		Moumouvirus(50.0%)	2	NA	NA
WP_020955932.1|4077433_4079212_+	DNA helicase RecQ	NA	M1PGQ0	Moumouvirus	36.9	8.8e-82
WP_007407985.1|4079447_4080317_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A217EQJ4	Bacillus_phage	70.8	3.9e-27
>prophage 308
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	4084165	4084831	4167153		Streptococcus_phage(100.0%)	1	NA	NA
WP_003153802.1|4084165_4084831_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	32.6	3.3e-18
>prophage 309
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	4088910	4090713	4167153		Bacillus_phage(100.0%)	1	NA	NA
WP_062623378.1|4088910_4090713_+	ribonuclease YeeF family protein	NA	A0A1P8CWI7	Bacillus_phage	67.8	4.6e-179
>prophage 310
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	4095337	4096354	4167153		Streptococcus_phage(100.0%)	1	NA	NA
WP_007407339.1|4095337_4096354_+	2-hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	31.1	9.0e-23
>prophage 311
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	4100401	4103939	4167153		Streptococcus_phage(50.0%)	4	NA	NA
WP_031379054.1|4100401_4101118_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	77.2	2.8e-47
WP_003153833.1|4101403_4101772_+	replication termination protein	NA	A0A0K2CP62	Brevibacillus_phage	41.0	9.2e-18
WP_062623377.1|4101947_4102796_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	30.2	3.0e-24
WP_039251224.1|4102820_4103939_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.5	1.1e-69
>prophage 312
NZ_CP015443	Bacillus velezensis strain CC09 chromosome, complete genome	4167153	4113409	4158702	4167153	plate,tail,terminase,holin,portal,integrase,tRNA,head,protease,capsid	Bacillus_phage(80.0%)	61	4128943:4128960	4156228:4156245
WP_062623376.1|4113409_4113676_+|tRNA	threonyl-tRNA synthetase	tRNA	NA	NA	NA	NA
WP_003153841.1|4113722_4114025_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039251236.1|4114168_4115344_+	MFS transporter	NA	NA	NA	NA	NA
WP_007407357.1|4115388_4117164_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_003153848.1|4117407_4117638_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_003153850.1|4117952_4118498_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	48.6	2.1e-42
WP_039251237.1|4118771_4119884_-|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	58.3	1.9e-111
WP_032858781.1|4120123_4121224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014305167.1|4121655_4122054_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032858779.1|4122218_4122425_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017417255.1|4122488_4122812_+	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	39.8	2.0e-13
WP_039251241.1|4123040_4123901_+	phage replisome organizer N-terminal domain-containing protein	NA	V5UQV4	Oenococcus_phage	44.7	4.9e-46
WP_039251244.1|4123851_4124709_+	ATP-binding protein	NA	A0A2H4JH61	uncultured_Caudovirales_phage	29.8	1.9e-21
WP_154018700.1|4124689_4124851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165869033.1|4124847_4125006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039251246.1|4125002_4125551_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	36.5	2.0e-05
WP_015387918.1|4125658_4125799_+	BH0509 family protein	NA	NA	NA	NA	NA
WP_015387919.1|4125811_4125967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024085436.1|4126046_4126250_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	55.4	7.5e-14
WP_099686886.1|4126363_4126768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039251250.1|4126764_4126995_+	hypothetical protein	NA	J9PL10	Bacillus_phage	41.6	1.5e-10
WP_039251254.1|4127215_4127473_+	hypothetical protein	NA	F8WQ54	Bacillus_phage	42.3	1.6e-05
WP_172437940.1|4127477_4127615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039251256.1|4127628_4128318_+	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	43.7	3.3e-37
4128943:4128960	attL	AAATAAGAGGGGGATCAT	NA	NA	NA	NA
WP_039251258.1|4128961_4129474_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	39.4	2.2e-30
WP_039251261.1|4129485_4129938_+	ArpU family transcriptional regulator	NA	S6AVV9	Thermus_phage	55.9	3.7e-37
WP_039251262.1|4129934_4130477_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	65.0	2.6e-61
WP_039251265.1|4130693_4131269_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_153952963.1|4131553_4131724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039251267.1|4131835_4132018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052250224.1|4132096_4132465_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_039251269.1|4132576_4133053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039251271.1|4133229_4133604_+	HNH endonuclease	NA	Q38456	Bacillus_phage	94.4	8.9e-69
WP_039251273.1|4133572_4133899_+	hypothetical protein	NA	Q9T203	Bacillus_phage	96.3	1.1e-54
WP_039251274.1|4133985_4134492_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	95.2	7.0e-85
WP_039251276.1|4134491_4136201_+|terminase	terminase large subunit	terminase	D6R3Y4	Bacillus_phage	99.6	0.0e+00
WP_015968213.1|4136213_4136432_+	hypothetical protein	NA	Q9ZXF9	Bacillus_phage	100.0	4.3e-31
WP_039251278.1|4136437_4137688_+|portal	phage portal protein	portal	D6R3Y6	Bacillus_phage	99.3	2.4e-243
WP_039251280.1|4137677_4138304_+|head,protease	HK97 family phage prohead protease	head,protease	Q9ZXF7	Bacillus_phage	99.5	1.5e-113
WP_039251281.1|4138343_4139537_+|capsid	phage major capsid protein	capsid	Q9ZXF6	Bacillus_phage	99.7	2.5e-221
WP_039251284.1|4139549_4139861_+	hypothetical protein	NA	Q9ZXF5	Bacillus_phage	96.2	2.3e-46
WP_039251286.1|4139888_4140434_+	collagen-like protein	NA	D6R3Z0	Bacillus_phage	99.4	2.0e-45
WP_039251288.1|4140448_4140796_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q9ZXF3	Bacillus_phage	99.1	3.5e-59
WP_039251289.1|4140728_4141088_+|head	phage head closure protein	head	Q9ZXF2	Bacillus_phage	96.6	8.0e-59
WP_039251291.1|4141080_4141464_+	HK97 gp10 family phage protein	NA	Q9ZXF1	Bacillus_phage	97.6	3.2e-66
WP_039251293.1|4141460_4141841_+	DUF3168 domain-containing protein	NA	Q9ZXF0	Bacillus_phage	96.8	9.0e-61
WP_039251295.1|4141841_4142450_+|tail	major tail protein	tail	Q9ZXE9	Bacillus_phage	81.7	1.1e-92
WP_062623375.1|4142501_4142840_+	hypothetical protein	NA	Q9ZXE8	Bacillus_phage	89.3	3.7e-50
WP_172437946.1|4142842_4143028_+	hypothetical protein	NA	D6R3Z7	Bacillus_phage	94.4	8.9e-22
WP_062623374.1|4143040_4146916_+|tail	phage tail tape measure protein	tail	D6R3Z8	Bacillus_phage	97.6	0.0e+00
WP_039251302.1|4146915_4147755_+|tail	phage tail family protein	tail	D6R3Z9	Bacillus_phage	94.6	6.9e-154
WP_039251303.1|4147766_4149470_+|tail	phage tail protein	tail	D6R400	Bacillus_phage	98.6	7.6e-309
WP_039251304.1|4149509_4152071_+	peptidase G2	NA	D6R401	Bacillus_phage	95.8	0.0e+00
WP_039251305.1|4152088_4153366_+|plate	phage baseplate upper protein	plate	D6R402	Bacillus_phage	76.7	9.3e-142
WP_039251306.1|4153362_4153725_+	hypothetical protein	NA	Q9ZXE0	Bacillus_phage	92.4	2.4e-55
WP_039251307.1|4153721_4153910_+	XkdX family protein	NA	Q9ZXD9	Bacillus_phage	95.2	1.5e-29
WP_039251308.1|4153960_4154383_+|holin	phage holin family protein	holin	D6R405	Bacillus_phage	87.1	1.0e-57
WP_039251309.1|4154425_4155439_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	95.3	2.3e-183
WP_039251310.1|4155483_4156227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024085400.1|4156419_4156860_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
4156228:4156245	attR	ATGATCCCCCTCTTATTT	NA	NA	NA	NA
WP_039251312.1|4156875_4158702_-	HNH endonuclease	NA	A0A1P8CWI7	Bacillus_phage	41.0	9.9e-105
