The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012533	Psychrobacter sp. P11G5 chromosome, complete genome	3423795	1258928	1339191	3423795	transposase,integrase	Acinetobacter_phage(16.67%)	60	1247298:1247313	1321477:1321492
1247298:1247313	attL	TTAATTCGTACGCTAA	NA	NA	NA	NA
WP_068035158.1|1258928_1262378_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_068035160.1|1262384_1264760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068035163.1|1265418_1266279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068035167.1|1266458_1268312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068035168.1|1268311_1269520_-	AAA family ATPase	NA	M1PME2	Moumouvirus	23.4	7.7e-05
WP_068035169.1|1269528_1271934_-	Hsp70 family protein	NA	A0A0G2YCR2	Acanthamoeba_polyphaga_mimivirus	25.6	8.1e-14
WP_068035170.1|1272474_1278186_-	AAA family ATPase	NA	A0A172Q0D8	Acinetobacter_phage	35.8	3.5e-15
WP_068035182.1|1278586_1279456_+	hypothetical protein	NA	A0A0R6PHP9	Moraxella_phage	38.4	1.1e-45
WP_068035184.1|1279508_1282001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068035185.1|1282026_1283340_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_068035187.1|1283379_1285725_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_068035188.1|1285783_1286107_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_149038738.1|1286170_1287729_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_068035190.1|1287796_1289491_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_068035192.1|1289552_1291931_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	39.0	5.4e-26
WP_068035194.1|1291927_1293205_+	McrC family protein	NA	NA	NA	NA	NA
WP_068035195.1|1293518_1294580_+	HNH endonuclease	NA	A0A2H4IZY3	uncultured_Caudovirales_phage	39.0	1.6e-14
WP_068035197.1|1294612_1295014_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_068035198.1|1295010_1297848_+	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	26.3	9.5e-30
WP_149038750.1|1297971_1298643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068035203.1|1300188_1300845_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068035207.1|1301229_1301598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082787179.1|1301623_1302355_+	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_068035211.1|1302463_1303372_+	radical SAM protein	NA	NA	NA	NA	NA
WP_149038751.1|1303915_1304161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149038742.1|1304585_1305804_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	51.3	1.8e-81
WP_068035223.1|1306311_1307442_+	radical SAM protein	NA	NA	NA	NA	NA
WP_068035224.1|1307438_1308044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068035225.1|1308036_1308456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149038738.1|1308441_1310000_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_068035226.1|1310172_1310475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068035227.1|1311026_1311344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068035229.1|1311354_1311639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068035231.1|1311635_1312859_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	28.8	1.7e-31
WP_045456309.1|1312885_1313101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068035233.1|1313223_1313460_+	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	38.2	9.4e-08
WP_068035234.1|1314277_1315948_+	alpha-keto acid decarboxylase family protein	NA	E4WLQ6	Ostreococcus_tauri_virus	23.3	1.3e-15
WP_068035237.1|1316120_1316525_+	RidA family protein	NA	NA	NA	NA	NA
WP_068039075.1|1316658_1317426_-	DUF5020 family protein	NA	NA	NA	NA	NA
WP_068035238.1|1318064_1318853_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068035241.1|1318887_1320276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082787180.1|1320400_1321480_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_068035243.1|1321613_1322693_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
1321477:1321492	attR	TTAATTCGTACGCTAA	NA	NA	NA	NA
WP_149038787.1|1322840_1323869_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_068035248.1|1324216_1325137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068035249.1|1325163_1325943_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_068035250.1|1325979_1327152_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_068039081.1|1327224_1327953_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_068035252.1|1327956_1328580_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_068035254.1|1328647_1329871_+	4-hydroxybenzoate 3-monooxygenase	NA	NA	NA	NA	NA
WP_068035257.1|1330097_1330634_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_068035259.1|1330693_1332040_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_068035261.1|1332109_1332763_+	5-oxoprolinase subunit PxpB	NA	NA	NA	NA	NA
WP_068035264.1|1332812_1333733_+	biotin-dependent carboxyltransferase family protein	NA	NA	NA	NA	NA
WP_068035266.1|1333722_1334457_+	5-oxoprolinase subunit PxpA	NA	NA	NA	NA	NA
WP_068035268.1|1334510_1335698_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_068035270.1|1335708_1336137_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_068039085.1|1336443_1337196_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_082787182.1|1337202_1337964_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_149038736.1|1338026_1339191_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	62.3	2.2e-102
>prophage 2
NZ_CP012533	Psychrobacter sp. P11G5 chromosome, complete genome	3423795	2690314	2743383	3423795	protease,transposase,integrase	uncultured_virus(40.0%)	48	2687058:2687077	2730159:2730178
2687058:2687077	attL	TAAAGCCAGCTTTTGGCAGA	NA	NA	NA	NA
WP_109592591.1|2690314_2691013_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_068037304.1|2692615_2693050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157822716.1|2693154_2693982_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_068037308.1|2694296_2695229_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068037311.1|2695455_2696538_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_068037314.1|2696593_2697475_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_068037317.1|2697621_2698239_+	DUF411 domain-containing protein	NA	NA	NA	NA	NA
WP_062844964.1|2699281_2700562_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_062844965.1|2700558_2701122_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_058025866.1|2701118_2701769_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_068037320.1|2701761_2703816_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_068037323.1|2704060_2705350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068037325.1|2705433_2706303_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_036599454.1|2706299_2706686_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_011959992.1|2706741_2707026_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_068037328.1|2707106_2709725_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.2	9.3e-88
WP_157769651.1|2709840_2710017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068037331.1|2710395_2710668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068037334.1|2710780_2711434_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_102076291.1|2711563_2712913_-	APC family permease	NA	NA	NA	NA	NA
WP_068037340.1|2713052_2713529_-	DUF305 domain-containing protein	NA	A0A0G2Y9T4	Acanthamoeba_polyphaga_mimivirus	31.5	6.5e-08
WP_068037343.1|2713624_2714809_-	copper resistance protein	NA	NA	NA	NA	NA
WP_068037346.1|2714840_2716538_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_068037351.1|2716605_2717244_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_068037353.1|2717413_2718004_-	cytochrome c	NA	NA	NA	NA	NA
WP_068037357.1|2718065_2718338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011959984.1|2718471_2718798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068037359.1|2719123_2719870_+	heavy metal response regulator transcription factor	NA	NA	NA	NA	NA
WP_068037363.1|2719859_2721338_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_011959981.1|2721521_2722406_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_068037366.1|2722588_2723458_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_158511270.1|2723580_2726907_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_068037372.1|2726897_2729261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068037374.1|2729247_2729772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068037376.1|2730722_2731247_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	29.4	1.1e-16
2730159:2730178	attR	TAAAGCCAGCTTTTGGCAGA	NA	NA	NA	NA
WP_068037378.1|2731508_2732480_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_011959554.1|2732688_2733390_-|transposase	IS1-like element ISPssp2 family transposase	transposase	A0A218MNG1	uncultured_virus	54.3	2.0e-37
WP_011959978.1|2733468_2734299_+	cation transporter	NA	NA	NA	NA	NA
WP_011959977.1|2734660_2735362_-	VIT family protein	NA	NA	NA	NA	NA
WP_011959976.1|2735443_2736127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011959975.1|2736190_2737273_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_020444569.1|2737328_2737643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011959973.1|2737635_2738226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011959972.1|2738325_2739789_-	histidine kinase	NA	NA	NA	NA	NA
WP_020444568.1|2739853_2740528_-	response regulator	NA	NA	NA	NA	NA
WP_082787241.1|2740547_2741153_-	cytochrome B	NA	NA	NA	NA	NA
WP_020444588.1|2741473_2742733_+	ferredoxin reductase family protein	NA	NA	NA	NA	NA
WP_011959968.1|2743116_2743383_-|protease	Serine protease inhibitor-like protein	protease	Q9DHG4	Yaba-like_disease_virus	36.9	1.2e-06
