The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014544	Zhongshania aliphaticivorans strain SM2, complete genome	4204359	152435	216102	4204359	protease,integrase,transposase	Bacillus_phage(14.29%)	56	185322:185356	216192:216226
WP_156474828.1|152435_153311_+|protease	serine protease	protease	NA	NA	NA	NA
WP_062382400.1|153305_155393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062384783.1|155676_157683_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	38.5	2.5e-117
WP_062382402.1|157783_158245_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_082793631.1|158278_160048_+	recombinase family protein	NA	NA	NA	NA	NA
WP_062382407.1|160107_160638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062382410.1|161391_162090_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_156474829.1|162174_162573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062384786.1|162707_163262_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E0P1	Streptococcus_phage	27.9	7.6e-16
WP_062382419.1|164235_164433_-	carbon storage regulator	NA	NA	NA	NA	NA
WP_062382422.1|164459_165107_-	HNH endonuclease	NA	A0A1S6L216	Vibrio_phage	38.2	4.0e-24
WP_008253379.1|166621_166885_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_156474882.1|167245_168139_+	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_008253381.1|168184_168487_+	urease subunit gamma	NA	NA	NA	NA	NA
WP_008253382.1|168507_168828_+	urease subunit beta	NA	NA	NA	NA	NA
WP_062382430.1|168832_170536_+	urease subunit alpha	NA	NA	NA	NA	NA
WP_062382432.1|170588_171056_+	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_062382437.1|171048_171717_+	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_086005650.1|171743_172361_+	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_062382441.1|172378_172987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008253388.1|173236_174553_+	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008253389.1|174664_176344_+	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_008253390.1|176350_177505_+	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_008253391.1|177501_178281_+	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	2.5e-12
WP_008253397.1|178285_178981_+	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	28.8	1.2e-13
WP_062382446.1|179727_180324_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	34.0	7.7e-06
WP_008253399.1|180320_180902_+	YceI family protein	NA	NA	NA	NA	NA
WP_062382449.1|181027_182428_-	AarF/ABC1/UbiB kinase family protein	NA	M4R0M8	Ostreococcus_lucimarinus_virus	27.3	4.4e-20
WP_156474830.1|182482_183760_+	divalent metal cation transporter	NA	NA	NA	NA	NA
WP_062382456.1|183797_184568_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
185322:185356	attL	TCGTCACTCCTGCGAAGGCAGGAGTCCATCCCAGC	NA	NA	NA	NA
WP_008253403.1|185661_186591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062382458.1|187072_187738_+	histidine kinase	NA	NA	NA	NA	NA
WP_008253407.1|187824_188163_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_062382461.1|188229_189474_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	37.0	2.4e-54
WP_062382475.1|190760_191921_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_008253411.1|192564_192903_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_008253412.1|193106_193307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008253413.1|193319_194030_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_008253414.1|194016_194922_-	tyrosine recombinase XerC	NA	G1D5R6	Mycobacterium_phage	28.6	6.2e-15
WP_062382481.1|195090_196293_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_062382485.1|197676_198381_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_062382488.1|198389_199220_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_062382492.1|199332_200580_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_062382495.1|200591_200804_-	lipoprotein	NA	NA	NA	NA	NA
WP_008253420.1|200864_201179_+	iron donor protein CyaY	NA	NA	NA	NA	NA
WP_062382498.1|201734_202670_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_062382501.1|203019_205791_-	class I adenylate cyclase	NA	NA	NA	NA	NA
WP_062382505.1|205855_207886_-	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_062382508.1|208370_209189_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	28.9	1.0e-16
WP_062384789.1|210030_211770_-	gamma-glutamyltransferase	NA	Q5GF27	Diachasmimorpha_longicaudata_entomopoxvirus	26.0	4.8e-08
WP_062382512.1|212438_212726_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_008253427.1|212761_213013_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	59.6	5.4e-22
WP_062382515.1|213020_213506_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.8	3.4e-28
WP_062384793.1|213734_215297_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	49.3	3.9e-126
WP_081482690.1|215407_215761_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_082793634.1|215739_216102_-|transposase	transposase	transposase	NA	NA	NA	NA
216192:216226	attR	TCGTCACTCCTGCGAAGGCAGGAGTCCATCCCAGC	NA	NA	NA	NA
>prophage 2
NZ_CP014544	Zhongshania aliphaticivorans strain SM2, complete genome	4204359	1874338	1950749	4204359	protease,tRNA,transposase,integrase,tail	uncultured_Mediterranean_phage(13.33%)	65	1946396:1946431	1960670:1960705
WP_008247831.1|1874338_1875595_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	85.2	3.4e-19
WP_008247833.1|1875645_1875861_-	cold shock domain-containing protein CspD	NA	Q9AZD3	Lactococcus_phage	55.2	6.7e-13
WP_143829345.1|1876053_1876404_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	49.4	2.0e-14
WP_008247837.1|1876435_1878715_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	3.4e-163
WP_008247839.1|1878725_1878944_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_040802926.1|1879075_1879780_-	arginyltransferase	NA	NA	NA	NA	NA
WP_008247841.1|1879776_1880502_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_008247842.1|1880520_1881471_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.8	2.1e-66
WP_008247843.1|1881711_1884012_+	DNA translocase FtsK	NA	G1DAY1	Mycobacterium_virus	48.6	6.4e-85
WP_008247846.1|1884023_1884626_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_050985174.1|1884661_1885924_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.0	2.1e-77
WP_008247849.1|1885969_1886347_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	41.8	3.0e-08
WP_008247850.1|1886392_1887697_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.4	1.3e-93
WP_008247851.1|1887700_1889104_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_008247852.1|1889158_1890529_+	glutathione-disulfide reductase	NA	NA	NA	NA	NA
WP_143829334.1|1890582_1892706_-|tail,protease	tail-specific protease	tail,protease	A0A0R6PIZ1	Moraxella_phage	34.4	4.5e-93
WP_008247861.1|1892853_1893249_+	nuclear transport factor 2	NA	NA	NA	NA	NA
WP_008247862.1|1893559_1895188_+	long-chain-fatty-acid--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.3	1.1e-25
WP_008247866.1|1895256_1896063_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_008247867.1|1896165_1897668_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_008247878.1|1897708_1899355_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_008247879.1|1899355_1900342_+	peptidase M15	NA	NA	NA	NA	NA
WP_143829335.1|1900472_1901312_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_008247885.1|1901327_1903727_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_008247886.1|1903742_1904291_-	cytochrome c	NA	NA	NA	NA	NA
WP_008247887.1|1904315_1904663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008247888.1|1904715_1905441_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_050985169.1|1905437_1907363_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_040802701.1|1907512_1907947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008247891.1|1908027_1908444_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_008247893.1|1908445_1910917_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.7	3.5e-121
WP_081482616.1|1910928_1911234_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_008247897.1|1911274_1912429_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.0	4.7e-28
WP_008247899.1|1912455_1913316_-	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_008247911.1|1913312_1914182_-	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_008247919.1|1914223_1915255_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086005639.1|1916018_1917014_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_008247922.1|1917123_1917486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040802704.1|1917570_1918932_+	TolC family protein	NA	NA	NA	NA	NA
WP_143829346.1|1918988_1919888_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_008247935.1|1919983_1923121_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_008247937.1|1923217_1923520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008247939.1|1923523_1924468_-	sodium-dependent bicarbonate transport family permease	NA	NA	NA	NA	NA
WP_008247941.1|1924630_1925518_-	cation transporter	NA	NA	NA	NA	NA
WP_143829347.1|1925714_1926848_+	DUF3754 domain-containing protein	NA	NA	NA	NA	NA
WP_008247945.1|1927019_1927472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008247955.1|1928173_1928977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008247958.1|1929154_1930312_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_008247960.1|1930381_1930990_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_143829348.1|1931068_1931932_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_008247963.1|1932097_1932850_+	DUF1461 domain-containing protein	NA	NA	NA	NA	NA
WP_008247965.1|1933105_1933606_+	AP2 domain-containing protein	NA	NA	NA	NA	NA
WP_008247967.1|1934021_1934480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008247970.1|1934689_1936057_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_008247972.1|1936110_1936737_+	superoxide dismutase family protein	NA	A0A0C5AQ67	Spodoptera_frugiperda_granulovirus	34.6	8.0e-14
WP_008247975.1|1936987_1937575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008247990.1|1937640_1938057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008247992.1|1938057_1939086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008247994.1|1939146_1939578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008247997.1|1939591_1939915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156474854.1|1940407_1943473_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_040802713.1|1943681_1944515_+	sprT domain-containing protein	NA	NA	NA	NA	NA
WP_008248003.1|1944656_1945889_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1946396:1946431	attL	TTGAGGGTCGGCCGTCATTCTGGAAAAATTCGCCAA	NA	NA	NA	NA
WP_008251030.1|1946460_1949469_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	25.8	3.1e-79
WP_008251029.1|1949498_1950749_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
1960670:1960705	attR	TTGGCGAATTTTTCCAGAATGACGGCCGACCCTCAA	NA	NA	NA	NA
>prophage 3
NZ_CP014544	Zhongshania aliphaticivorans strain SM2, complete genome	4204359	3096518	3109045	4204359	tRNA	Vibrio_phage(25.0%)	14	NA	NA
WP_062384039.1|3096518_3097325_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R4ALY4	Aeromonas_phage	45.9	4.6e-06
WP_062384042.1|3097433_3098525_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	A0A2I7SAR1	Vibrio_phage	50.4	9.6e-55
WP_062384049.1|3098546_3098813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062384052.1|3098802_3099066_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_062384054.1|3099144_3099636_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_062384057.1|3099628_3100024_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_062384059.1|3100075_3101101_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	60.2	1.7e-109
WP_008248432.1|3101290_3101506_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_062384061.1|3101573_3102026_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	46.6	3.6e-24
WP_062384064.1|3102113_3103979_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.6	9.6e-71
WP_008248427.1|3104089_3105904_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.2	2.2e-35
WP_062384066.1|3105985_3106465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062384068.1|3106478_3108677_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.1	5.6e-38
WP_008248423.1|3108673_3109045_-	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.6	2.4e-10
>prophage 4
NZ_CP014544	Zhongshania aliphaticivorans strain SM2, complete genome	4204359	3787489	3795287	4204359		Staphylococcus_phage(33.33%)	8	NA	NA
WP_008252422.1|3787489_3787951_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	51.7	7.4e-33
WP_008252424.1|3787976_3789107_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	36.5	7.3e-58
WP_008252426.1|3789131_3789806_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.1	2.0e-18
WP_040804324.1|3789806_3790907_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	32.7	7.9e-41
WP_008252428.1|3790936_3791413_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_008252429.1|3791547_3792810_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.9	2.2e-103
WP_008252430.1|3793022_3793232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008252431.1|3793625_3795287_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	27.5	3.1e-36
