The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014158	Pseudomonas citronellolis strain P3B5 chromosome, complete genome	6951444	330890	363230	6951444	tail,transposase,integrase,protease	Pseudomonas_phage(54.55%)	48	321890:321915	369679:369704
321890:321915	attL	TCGTAGGAGCGGATCTTATCCGCGAA	NA	NA	NA	NA
WP_009614960.1|330890_331796_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.3	1.8e-38
WP_161788534.1|331792_332236_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_009614968.1|332387_332783_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_061560381.1|333431_333656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061560382.1|333667_334327_-	helix-turn-helix transcriptional regulator	NA	A0A0A1IWY4	Pseudomonas_phage	61.5	8.6e-75
WP_061563187.1|334558_334897_+	nucleotide excision repair protein	NA	A0A2H4J3B6	uncultured_Caudovirales_phage	51.0	3.3e-22
WP_061560383.1|334899_335346_+	hypothetical protein	NA	L7P804	Pseudomonas_phage	68.7	7.4e-46
WP_061560384.1|335342_335537_+	hypothetical protein	NA	A0A076FRH8	Pseudomonas_phage	76.8	5.0e-15
WP_061560385.1|335529_337587_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JEQ4	uncultured_Caudovirales_phage	51.9	2.3e-195
WP_061560386.1|337604_338324_+	ATP-binding protein	NA	A0A2H4J809	uncultured_Caudovirales_phage	65.3	6.2e-87
WP_061560387.1|339328_339712_+	hypothetical protein	NA	A0A0A1IWY8	Pseudomonas_phage	57.5	5.8e-31
WP_061560388.1|339695_340025_+	hypothetical protein	NA	A0A125RN98	Pseudomonas_phage	63.8	2.5e-27
WP_061560389.1|340042_340675_+	DUF3164 family protein	NA	J9SHK0	Pseudomonas_phage	37.4	3.0e-32
WP_145923839.1|340677_340869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061560391.1|340871_341180_+	hypothetical protein	NA	A0A0A1IUY5	Pseudomonas_phage	51.4	7.7e-18
WP_145923840.1|341181_341397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061560393.1|341396_341648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061560394.1|341647_342097_+	hypothetical protein	NA	A0A076FRH0	Pseudomonas_phage	79.2	6.9e-60
WP_061560395.1|342105_342357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061560396.1|342433_343108_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	79.0	2.6e-95
WP_061560397.1|343117_343396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061560398.1|343392_343647_+	hypothetical protein	NA	A0A125RNA7	Pseudomonas_phage	53.4	2.3e-12
WP_061560399.1|343643_344048_+	regulatory protein GemA	NA	A0A0A7DJY7	Pseudomonas_phage	63.7	1.1e-35
WP_061560400.1|344050_344485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061560401.1|344564_344909_+	hypothetical protein	NA	L7P853	Pseudomonas_phage	56.6	2.1e-24
WP_061560402.1|344898_345402_+	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	51.6	2.1e-33
WP_061560403.1|345398_346028_+	hypothetical protein	NA	Q5ZQY9	Pseudomonas_phage	40.9	2.1e-09
WP_061560404.1|346027_346402_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	43.2	3.7e-14
WP_061560405.1|346394_346706_+	hypothetical protein	NA	A0A2H4JGU5	uncultured_Caudovirales_phage	75.0	3.6e-39
WP_061560406.1|346708_347221_+	DUF3486 family protein	NA	A0A2H4JD50	uncultured_Caudovirales_phage	77.8	2.0e-63
WP_145923965.1|347393_348881_+	hypothetical protein	NA	A0A2H4JF57	uncultured_Caudovirales_phage	73.9	2.8e-214
WP_061560408.1|348877_350461_+	DUF935 domain-containing protein	NA	A0A2P9JZI9	Alteromonadaceae_phage	52.6	8.5e-153
WP_082816435.1|350523_351285_+	hypothetical protein	NA	M4M9M5	Vibrio_phage	53.4	4.6e-72
WP_145923841.1|351374_351863_+	hypothetical protein	NA	A0A2H4J7V6	uncultured_Caudovirales_phage	43.1	2.5e-23
WP_061560410.1|351917_352931_+	hypothetical protein	NA	A0A2H4J9A2	uncultured_Caudovirales_phage	43.3	2.9e-53
WP_061560411.1|352933_353851_+	hypothetical protein	NA	A0A1C6ZDN1	Pseudomonas_phage	56.3	6.8e-86
WP_061560412.1|353863_354304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061560413.1|354309_354717_+	DUF1320 domain-containing protein	NA	A0A2P9JZJ4	Alteromonadaceae_phage	50.5	1.5e-24
WP_061560414.1|354713_355157_+	phage virion morphogenesis protein	NA	A0A2H4PAM9	Aphanizomenon_phage	28.9	7.4e-06
WP_061560415.1|355149_355617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061560416.1|355625_355817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061560417.1|355819_356557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061560418.1|356608_356959_+	hypothetical protein	NA	A0A1B0YZV7	Pseudomonas_phage	39.2	3.8e-13
WP_160336924.1|357154_357319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082816242.1|357317_360587_+|tail	phage tail tape measure protein	tail	A0A2K9VGI5	Pontimonas_phage	27.9	3.8e-14
WP_061560420.1|360579_361107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082816243.1|361106_362873_+	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	50.2	3.7e-149
WP_061560421.1|362876_363230_+	hypothetical protein	NA	A0A1B0YZV1	Pseudomonas_phage	65.6	1.3e-24
369679:369704	attR	TTCGCGGATAAGATCCGCTCCTACGA	NA	NA	NA	NA
>prophage 2
NZ_CP014158	Pseudomonas citronellolis strain P3B5 chromosome, complete genome	6951444	715116	779264	6951444	plate,tRNA,tail,holin	uncultured_Caudovirales_phage(29.03%)	63	NA	NA
WP_061560561.1|715116_715605_-	Bro-N domain-containing protein	NA	A0A290FZK7	Caldibacillus_phage	27.6	5.1e-08
WP_009615522.1|716063_716246_+	addiction module toxin, HicA family	NA	A0A0R6PJD4	Moraxella_phage	60.0	2.5e-16
WP_043319209.1|716278_716683_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0U4ISP5	Pseudomonas_phage	84.8	8.1e-60
WP_061560562.1|716725_717910_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	28.7	1.5e-08
WP_061560563.1|718212_721947_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	33.9	2.5e-17
WP_009615539.1|722065_723916_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	3.4e-36
WP_058073278.1|723994_726013_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.3	4.1e-75
WP_003085057.1|726202_726418_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_061560564.1|726621_727647_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.6	2.7e-107
WP_058487631.1|727740_728310_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_043269307.1|728392_728746_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_061560565.1|728736_729273_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_061560566.1|729498_730725_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	42.6	4.1e-78
WP_061560567.1|731067_731577_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_009615572.1|731635_733189_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_043269296.1|733185_734457_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	1.6e-08
WP_009615576.1|734573_736496_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_043269294.1|736771_737101_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_043269293.1|737123_737948_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	31.4	7.3e-07
WP_009615581.1|737947_738328_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_058073272.1|738356_739166_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_061560568.1|739336_740335_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_145923845.1|740467_741760_-	peptidylprolyl isomerase SurA	NA	NA	NA	NA	NA
WP_061560570.1|741740_744545_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_061560571.1|744672_745689_+	phosphotransferase	NA	NA	NA	NA	NA
WP_061560572.1|745685_746360_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_009615593.1|746360_747119_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_061560573.1|747133_748174_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_145923846.1|748317_750741_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_009615596.1|750780_751410_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_145923968.1|751552_752590_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_009615598.1|752935_754045_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.9	4.1e-29
WP_009615599.1|754086_755145_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009615600.1|755319_756567_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_058073262.1|756580_757408_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_043269271.1|757638_758313_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_009615605.1|758312_759137_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_043269267.1|759207_760695_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_043319249.1|760866_761175_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_043269263.1|761304_762063_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	57.5	8.6e-71
WP_061560576.1|762458_762668_+	conjugal transfer protein TraR	NA	NA	NA	NA	NA
WP_009615611.1|762685_763045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082816247.1|763102_763594_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_058073259.1|763874_764207_+|holin	holin	holin	B5TK61	Pseudomonas_phage	49.5	1.8e-20
WP_058073258.1|764235_764754_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	40.3	7.6e-26
WP_061560577.1|764750_765314_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	67.6	2.6e-48
WP_043269256.1|765414_765741_+|plate	phage baseplate protein	plate	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	7.1e-30
WP_061560578.1|765737_766628_+|plate	baseplate assembly protein	plate	A0A0M4REB7	Salmonella_phage	61.9	2.3e-91
WP_061560579.1|766620_767235_+|tail	phage tail protein I	tail	A0A2H4JDH5	uncultured_Caudovirales_phage	59.1	1.3e-61
WP_082816248.1|767225_768776_+	hypothetical protein	NA	A0A077K818	Ralstonia_phage	54.8	1.9e-80
WP_061560580.1|769039_770197_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	79.2	4.0e-176
WP_043269248.1|770209_770713_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	69.1	6.3e-62
WP_061560581.1|770723_771035_+|tail	phage tail assembly protein	tail	A0A2H4J873	uncultured_Caudovirales_phage	54.9	5.9e-18
WP_061560582.1|771193_773116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061560583.1|773144_773981_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	48.6	4.9e-67
WP_009615647.1|773964_774171_+	hypothetical protein	NA	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	4.3e-17
WP_061560584.1|774217_775234_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	57.0	8.5e-106
WP_061560585.1|775245_775863_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	64.9	1.2e-65
WP_061560586.1|775859_776219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061560587.1|776215_776476_+	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	52.3	4.3e-14
WP_061560588.1|776788_777385_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	61.6	2.3e-71
WP_043269234.1|777381_778431_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	56.9	1.3e-109
WP_061560589.1|778427_779264_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	53.5	4.0e-69
>prophage 3
NZ_CP014158	Pseudomonas citronellolis strain P3B5 chromosome, complete genome	6951444	2211355	2287147	6951444	tRNA,transposase,coat,protease	Acanthamoeba_polyphaga_mimivirus(10.0%)	60	NA	NA
WP_061561166.1|2211355_2212741_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2L2DK39	Acanthamoeba_polyphaga_mimivirus	35.7	5.1e-45
WP_061561167.1|2213103_2213958_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	32.2	8.6e-27
WP_061561168.1|2214683_2215994_+	trigger factor	NA	NA	NA	NA	NA
WP_009623460.1|2216085_2216724_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	58.0	9.2e-58
WP_009623458.1|2216831_2218112_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.3	2.4e-137
WP_009623456.1|2218246_2220643_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.3e-220
WP_003087931.1|2220779_2221052_+	DNA-binding protein HU-beta	NA	A4JWM7	Burkholderia_virus	60.7	2.5e-20
WP_061561169.1|2221281_2223159_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_058488992.1|2223575_2224346_-	dioxygenase	NA	NA	NA	NA	NA
WP_009623417.1|2224685_2224877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061561170.1|2224975_2225629_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_061561171.1|2225683_2226994_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_009623413.1|2227103_2227991_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_009623411.1|2228135_2228582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009623409.1|2228584_2229796_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_009623407.1|2230098_2230500_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_043267143.1|2230610_2231096_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.3	6.8e-21
WP_061561172.1|2231092_2231560_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061561173.1|2231573_2233898_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.6	8.6e-45
WP_009623402.1|2234039_2234933_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_043267136.1|2234929_2235412_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_058489000.1|2236515_2237193_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_009618909.1|2237203_2237971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009618910.1|2238544_2239141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061563233.1|2239350_2240766_-	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_051878413.1|2240983_2241931_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_061561174.1|2242094_2243030_-	carbamate kinase	NA	NA	NA	NA	NA
WP_009618914.1|2243046_2244405_-	allantoinase AllB	NA	NA	NA	NA	NA
WP_051878517.1|2244417_2245857_-	YfcC family protein	NA	NA	NA	NA	NA
WP_009618916.1|2245859_2246888_-	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_009618917.1|2246974_2247751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923869.1|2248081_2249443_+	OmpA family protein	NA	NA	NA	NA	NA
WP_061561176.1|2249470_2250517_-	ornithine cyclodeaminase	NA	A0A1V0SL93	Klosneuvirus	52.9	8.2e-96
WP_061561177.1|2250654_2251149_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_043267118.1|2251442_2251853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043315061.1|2251931_2252348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061561178.1|2252491_2254930_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_061561179.1|2255076_2255748_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_061561180.1|2255863_2256484_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_061561181.1|2256577_2257510_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.8	2.6e-24
WP_009618941.1|2257506_2258283_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_061561182.1|2258619_2260665_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_009618943.1|2261287_2262805_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_061561183.1|2262856_2264047_-	sugar transporter	NA	NA	NA	NA	NA
WP_009618945.1|2264281_2264506_+	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_061561184.1|2265255_2268615_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_145923870.1|2268759_2271867_-	glycosyl transferase family 51	NA	NA	NA	NA	NA
WP_061561185.1|2272075_2272306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061561186.1|2272692_2273370_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_061561187.1|2273646_2275029_+	amino acid permease	NA	NA	NA	NA	NA
WP_061561188.1|2275240_2277199_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_061561189.1|2277214_2277811_-	LemA family protein	NA	NA	NA	NA	NA
WP_145923871.1|2278253_2280203_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_061561190.1|2280210_2280918_+	(2Fe-2S) ferredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_061561191.1|2280914_2281820_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_061561192.1|2281826_2282852_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_061561193.1|2282867_2285249_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_058070116.1|2285252_2285999_-	molecular chaperone	NA	NA	NA	NA	NA
WP_061561194.1|2286018_2286564_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_009618970.1|2286613_2287147_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 4
NZ_CP014158	Pseudomonas citronellolis strain P3B5 chromosome, complete genome	6951444	4248128	4251864	6951444		uncultured_Caudovirales_phage(100.0%)	7	NA	NA
WP_058071766.1|4248128_4248365_+	hypothetical protein	NA	A0A2H4JDJ8	uncultured_Caudovirales_phage	51.3	1.6e-12
WP_061562078.1|4248702_4249368_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	75.3	1.0e-83
WP_061562079.1|4249483_4249876_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	77.5	6.1e-52
WP_061562080.1|4249875_4250235_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	64.2	8.0e-35
WP_061562081.1|4250234_4250534_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	58.8	3.2e-21
WP_043272060.1|4250530_4250866_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	71.2	2.9e-39
WP_061562082.1|4250862_4251864_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	73.7	3.4e-139
>prophage 5
NZ_CP014158	Pseudomonas citronellolis strain P3B5 chromosome, complete genome	6951444	4526168	4630535	6951444	transposase,portal,protease,terminase,integrase	Pseudomonas_phage(55.56%)	103	4585509:4585555	4629732:4629778
WP_061560270.1|4526168_4527341_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_145923920.1|4533921_4534194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562191.1|4534317_4535127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061563304.1|4535196_4535499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562192.1|4535523_4538862_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_061562193.1|4538861_4541831_-	site-specific DNA-methyltransferase	NA	A0A023MI13	Escherichia_phage	41.4	5.2e-10
WP_061562194.1|4542168_4542711_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_082816361.1|4542775_4544347_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	A0A1V0SKB7	Klosneuvirus	25.2	9.7e-16
WP_061562195.1|4545919_4547263_+|integrase	site-specific integrase	integrase	A0A2H4IYX8	uncultured_Caudovirales_phage	67.9	9.3e-169
WP_145923921.1|4547330_4548422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923991.1|4548888_4549218_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_082816363.1|4549282_4550701_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_034040907.1|4550828_4551158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562196.1|4551265_4552234_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	42.7	1.5e-59
WP_061562197.1|4552387_4552789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562198.1|4552911_4553916_+	alkaline phosphatase	NA	A6XMH8	Bacillus_virus	38.3	7.2e-49
WP_061562199.1|4553994_4554915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562200.1|4554958_4555141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562201.1|4555225_4555561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562202.1|4555590_4555938_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061562203.1|4556076_4556523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562204.1|4556720_4559300_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_014820685.1|4559998_4560979_+|transposase	IS5-like element ISPst5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.3	2.5e-94
WP_037005584.1|4562141_4563179_-|transposase	IS630-like element ISPa47 family transposase	transposase	NA	NA	NA	NA
WP_082816364.1|4563208_4564144_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_082816365.1|4564223_4565336_+	DUF697 domain-containing protein	NA	NA	NA	NA	NA
WP_071535784.1|4565391_4565730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562206.1|4565829_4566531_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_025981557.1|4567082_4567298_-	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	52.5	8.2e-11
WP_019726434.1|4567538_4568048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082816366.1|4568044_4569418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023123593.1|4569414_4570584_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_082816367.1|4570558_4571188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160336936.1|4571232_4572342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082816368.1|4572435_4574232_-	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_061562207.1|4574416_4576267_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_061562208.1|4576309_4579378_-	DEAD/DEAH box helicase family protein	NA	A0A2K5B2C2	Erysipelothrix_phage	31.7	3.4e-126
WP_061562209.1|4579388_4581260_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	38.2	1.6e-110
WP_061562210.1|4581303_4581978_-	DUF4391 domain-containing protein	NA	NA	NA	NA	NA
WP_061563305.1|4581974_4585265_-	helicase	NA	A0A2K5B253	Erysipelothrix_phage	43.1	7.7e-241
4585509:4585555	attL	TTTGGTCGGGACGGAGTGATTCGAACACTCGACCCCTTGCACCCCAT	NA	NA	NA	NA
WP_058487177.1|4585698_4585959_-	hypothetical protein	NA	H2BDA2	Pseudomonas_phage	52.9	1.9e-14
WP_061563306.1|4585994_4586258_-	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	83.7	4.7e-32
WP_061562211.1|4586317_4586692_-	hypothetical protein	NA	J7HXL1	Pseudomonas_phage	69.5	8.4e-35
WP_061562212.1|4586701_4587115_-	cell wall hydrolase	NA	A0A2D1GNI1	Pseudomonas_phage	66.4	8.6e-49
WP_061562213.1|4587181_4587418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923992.1|4587417_4588674_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	34.1	3.2e-46
WP_145923922.1|4589180_4589927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562216.1|4589953_4590919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562217.1|4590918_4594491_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	35.7	3.5e-178
WP_061562218.1|4594557_4594863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562219.1|4594876_4595278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562220.1|4595277_4598994_-	tape measure protein	NA	A0A2I7S9D9	Vibrio_phage	42.3	8.6e-47
WP_145923923.1|4599211_4599559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562223.1|4599581_4600328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562224.1|4600357_4600573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562225.1|4600623_4601061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923924.1|4601060_4601381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562226.1|4601380_4601698_-	DUF2190 family protein	NA	A0A1W6JT93	Pseudomonas_phage	91.4	1.7e-44
WP_061562227.1|4601764_4603855_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	94.2	0.0e+00
WP_061562228.1|4603826_4605473_-|portal	phage portal protein	portal	A0A1W6JTB6	Pseudomonas_phage	95.1	1.7e-305
WP_061562229.1|4605472_4605688_-	hypothetical protein	NA	A0A0A0YRQ0	Pseudomonas_phage	98.6	2.3e-29
WP_061562230.1|4605678_4607643_-|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	94.6	0.0e+00
WP_061562231.1|4607614_4608160_-	DNA-packaging protein	NA	A0A1B0Z033	Pseudomonas_phage	85.1	3.9e-81
WP_061562232.1|4608331_4609120_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	43.6	4.2e-44
WP_061562233.1|4609130_4609502_-	hypothetical protein	NA	W6MYB2	Pseudomonas_phage	55.1	6.4e-27
WP_061562234.1|4609718_4610108_-	antitermination protein Q	NA	A0A1W6JTD2	Pseudomonas_phage	64.3	5.8e-47
WP_061562235.1|4610110_4610410_-	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	42.9	5.9e-15
WP_061562236.1|4610387_4610807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562237.1|4610806_4611238_-	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	54.2	1.9e-38
WP_061562238.1|4611234_4611606_-	recombinase	NA	NA	NA	NA	NA
WP_061563308.1|4611602_4611818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562239.1|4611828_4612509_-	hypothetical protein	NA	A0A1B0YZY6	Pseudomonas_phage	46.6	3.9e-38
WP_061562240.1|4612505_4613240_-	hypothetical protein	NA	A0A1W6JTD5	Pseudomonas_phage	53.3	6.9e-41
WP_082816369.1|4613251_4613992_-	DNA-binding protein	NA	A0A1B0YZY9	Pseudomonas_phage	48.5	3.1e-49
WP_061562241.1|4614053_4614674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058490330.1|4614941_4615304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562242.1|4615307_4615721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074980421.1|4615733_4615955_-	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	61.6	3.4e-20
WP_061562243.1|4616050_4616755_+	hypothetical protein	NA	A0A2H4J6Q0	uncultured_Caudovirales_phage	45.4	4.6e-26
WP_061562244.1|4616758_4616995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562245.1|4617051_4617507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070065508.1|4617496_4618252_+	DUF1828 domain-containing protein	NA	A4JX42	Burkholderia_virus	43.4	8.1e-53
WP_061562247.1|4618687_4618945_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_058145433.1|4619513_4619726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562248.1|4619729_4619993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923925.1|4620077_4620323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562250.1|4620366_4620573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081884633.1|4620742_4620925_+	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	69.8	2.4e-19
WP_061562251.1|4620962_4621169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082816370.1|4621205_4622063_+	pentapeptide repeat-containing protein	NA	A0A221SAP8	Ralstonia_phage	62.7	2.4e-21
WP_061562252.1|4622407_4622671_+	hypothetical protein	NA	A0A0U3TGX2	Pseudomonas_phage	58.8	4.1e-12
WP_061562253.1|4622670_4622985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562254.1|4623187_4623568_+	hypothetical protein	NA	A0A2H4J2C6	uncultured_Caudovirales_phage	44.6	8.8e-24
WP_061563311.1|4623734_4624097_+	hypothetical protein	NA	A0A0U1UNQ6	Pseudomonas_phage	65.0	3.3e-36
WP_061562255.1|4624093_4625851_+	DEAD/DEAH box helicase	NA	A0A2K8IBK8	Pseudomonas_phage	85.0	3.3e-299
WP_061562256.1|4625908_4626340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562257.1|4626336_4626660_+	DUF4406 domain-containing protein	NA	L7TKQ2	Pseudomonas_virus	63.2	5.4e-30
WP_061562258.1|4626748_4626946_+	hypothetical protein	NA	H2BD39	Pseudomonas_phage	46.0	1.6e-05
WP_061562259.1|4627765_4628281_+	hypothetical protein	NA	H2BDI1	Pseudomonas_virus	38.1	4.3e-21
WP_043270643.1|4628321_4628534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562260.1|4628533_4629646_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4JIT5	Pseudomonas_phage	33.4	9.8e-39
WP_009617038.1|4629895_4630252_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
4629732:4629778	attR	TTTGGTCGGGACGGAGTGATTCGAACACTCGACCCCTTGCACCCCAT	NA	NA	NA	NA
WP_003090661.1|4630232_4630535_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	1.0e-11
>prophage 6
NZ_CP014158	Pseudomonas citronellolis strain P3B5 chromosome, complete genome	6951444	5127833	5194389	6951444	tail,portal,protease,terminase,head,integrase,capsid,holin	Pseudomonas_phage(52.63%)	97	5131032:5131091	5192703:5192766
WP_043315592.1|5127833_5128883_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.8	5.3e-18
WP_043271102.1|5129176_5130013_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_043271104.1|5130199_5130898_-	hypothetical protein	NA	NA	NA	NA	NA
5131032:5131091	attL	ATGGCGGAGAGATAGGGATTTGAACCCTAGGAGCCATTGCTGACTCAACGGATTTCGAAT	NA	NA	NA	NA
WP_061562416.1|5131248_5131509_-	hypothetical protein	NA	H2BDA2	Pseudomonas_phage	52.9	3.9e-15
WP_061562417.1|5131539_5132049_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_061562418.1|5132045_5132372_-	hypothetical protein	NA	A0A1B2IBL3	Erwinia_phage	48.2	1.2e-24
WP_061562419.1|5132368_5132863_-	glycoside hydrolase family 104 protein	NA	Q9MC90	Pseudomonas_phage	61.2	1.9e-47
WP_160336941.1|5133030_5134038_+	acyltransferase	NA	W6MVL2	Pseudomonas_phage	33.9	4.4e-30
WP_145923938.1|5134012_5136031_-	hypothetical protein	NA	A0A292GL42	Xanthomonas_phage	35.3	1.6e-92
WP_082816392.1|5136030_5137083_-	DUF2793 domain-containing protein	NA	F5B3P3	Synechococcus_phage	60.2	4.6e-22
WP_082816393.1|5136758_5139914_-	hypothetical protein	NA	Q5DN19	Alphaproteobacteria_virus	29.4	6.0e-65
WP_061562423.1|5139906_5140341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562424.1|5140337_5141225_-	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_061562425.1|5141604_5142480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082816395.1|5142479_5145068_-|tail	phage tail tape measure protein	tail	D4FUM0	Pseudomonas_phage	58.6	5.4e-165
WP_082816396.1|5145338_5145596_-	hypothetical protein	NA	A0A0U4J8S9	Pseudomonas_phage	75.0	1.3e-31
WP_061562428.1|5145619_5145979_-|tail	phage tail protein	tail	Q9MCA4	Pseudomonas_phage	88.2	2.5e-52
WP_061562429.1|5145982_5146480_-|tail	phage tail protein	tail	H2BDC0	Pseudomonas_virus	66.1	4.7e-57
WP_061562430.1|5147233_5147596_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	61.2	7.3e-36
WP_061562431.1|5147595_5148078_-	hypothetical protein	NA	A0A286S249	Klebsiella_phage	46.2	8.6e-32
WP_082816397.1|5148078_5148723_-	methyltransferase domain-containing protein	NA	A0A0U4IIB3	Pseudomonas_phage	75.2	2.1e-89
WP_061562432.1|5148673_5149486_-	hypothetical protein	NA	D4FUL8	Pseudomonas_phage	90.7	4.1e-151
WP_145923939.1|5149596_5150100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562433.1|5150280_5150637_-|head	phage head closure protein	head	Q9XJT0	Pseudomonas_phage	90.7	1.4e-58
WP_061562434.1|5150845_5151166_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H2BDB3	Pseudomonas_virus	89.6	3.9e-49
WP_070065510.1|5151146_5151743_-	hypothetical protein	NA	H2BDB2	Pseudomonas_virus	84.8	2.9e-98
WP_061562435.1|5151906_5153094_-|capsid	phage major capsid protein	capsid	H2BDB0	Pseudomonas_virus	93.7	3.9e-203
WP_061562436.1|5153090_5153981_-|protease	Clp protease ClpP	protease	A0A0U4B0F3	Pseudomonas_phage	94.9	1.8e-160
WP_061562437.1|5154112_5155378_-|portal	phage portal protein	portal	A0A0U4IIV7	Pseudomonas_phage	84.6	5.5e-203
WP_061562438.1|5155531_5157223_-|terminase	terminase large subunit	terminase	A0A0U4B0C7	Pseudomonas_phage	96.1	0.0e+00
WP_061562439.1|5157224_5157605_-	hypothetical protein	NA	A0A0U4JIP6	Pseudomonas_phage	96.8	7.9e-65
WP_061562440.1|5157818_5158133_-	HNH endonuclease	NA	H2BDK0	Pseudomonas_virus	87.5	2.3e-49
WP_061562441.1|5158125_5158365_-	hypothetical protein	NA	H2BDJ8	Pseudomonas_virus	55.1	3.5e-18
WP_061562442.1|5158609_5158912_-	hypothetical protein	NA	H2BDJ7	Pseudomonas_virus	51.5	5.6e-21
WP_061562443.1|5158953_5159154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562444.1|5159146_5159401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562445.1|5159397_5159598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160336942.1|5159597_5159765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562446.1|5160062_5160308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562447.1|5160304_5160631_-|holin	phage holin family protein	holin	Q9MC42	Pseudomonas_phage	62.4	9.6e-27
WP_061562448.1|5160623_5161004_-	hypothetical protein	NA	H2BDJ3	Pseudomonas_virus	59.7	4.1e-29
WP_160336943.1|5161174_5161324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562449.1|5162032_5162635_-	hypothetical protein	NA	A0A0S2SYA9	Pseudomonas_phage	48.7	1.6e-48
WP_061562450.1|5162705_5162948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562451.1|5162947_5163589_-	hypothetical protein	NA	Q9MC46	Pseudomonas_phage	92.5	4.7e-110
WP_061562452.1|5163585_5164314_-	serine/threonine protein phosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	71.0	1.4e-102
WP_061562453.1|5164310_5164781_-	hypothetical protein	NA	A0A2H4J106	uncultured_Caudovirales_phage	72.4	5.9e-62
WP_061562454.1|5164773_5165124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562455.1|5165123_5165369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562456.1|5165368_5165878_-	hypothetical protein	NA	H2BDI1	Pseudomonas_virus	80.5	1.9e-69
WP_061562457.1|5165987_5167817_-	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	90.5	0.0e+00
WP_061562458.1|5167813_5168731_-	YdaU family protein	NA	A8HP60	Thalassomonas_phage	46.7	7.9e-18
WP_061562459.1|5168727_5168916_-	hypothetical protein	NA	A0A0U4IIX2	Pseudomonas_phage	83.9	2.8e-23
WP_061562460.1|5168897_5169107_-	hypothetical protein	NA	A0A0S2SYE2	Pseudomonas_phage	68.6	2.0e-06
WP_061562461.1|5169108_5169543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562462.1|5169630_5169837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145923940.1|5169912_5170248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562464.1|5170509_5170743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082816459.1|5171191_5171536_+	S24 family peptidase	NA	A0A1W6JNY2	Morganella_phage	49.5	2.2e-26
WP_082816402.1|5171562_5172159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562467.1|5172162_5172474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562468.1|5172504_5172984_+	hypothetical protein	NA	J7HXI2	Pseudomonas_phage	38.6	2.8e-11
WP_061562469.1|5173044_5173263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058071193.1|5173608_5173845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562471.1|5173947_5174871_+	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	39.4	6.6e-49
WP_061562472.1|5175047_5175263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562473.1|5175280_5175691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562474.1|5175687_5176152_-	ImmA/IrrE family metallo-endopeptidase	NA	Q332A2	Clostridium_botulinum_C_phage	30.5	2.7e-06
WP_061563328.1|5176263_5176497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061562475.1|5176541_5176778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145923941.1|5176927_5177437_+	hypothetical protein	NA	A0A1B0VMC8	Pseudomonas_phage	62.7	4.8e-49
WP_061562476.1|5178146_5178359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562477.1|5178362_5178626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562478.1|5178898_5179093_+	hypothetical protein	NA	A0A1B0VME6	Pseudomonas_phage	50.0	2.2e-07
WP_082656981.1|5179283_5179775_+	hypothetical protein	NA	Q7Y5K0	Xanthomonas_virus	43.7	5.7e-31
WP_061563329.1|5179767_5180874_+	hypothetical protein	NA	A0A0U4B0I3	Pseudomonas_phage	63.6	3.8e-35
WP_082816403.1|5180873_5181365_+	HNH endonuclease	NA	A0A172JFU7	Citrobacter_phage	46.8	2.3e-24
WP_061562479.1|5181461_5181788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562480.1|5181784_5181976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162493535.1|5182263_5182407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562481.1|5182569_5183628_+	hypothetical protein	NA	Q9MC69	Pseudomonas_phage	79.4	2.7e-46
WP_061562482.1|5183636_5184557_+	DNA recombinase	NA	F1C5B8	Cronobacter_phage	50.4	1.4e-62
WP_061562483.1|5184553_5185198_+	recombinase	NA	A0A2I7RQG4	Vibrio_phage	30.2	1.1e-13
WP_061562484.1|5185194_5185647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562485.1|5185643_5186108_+	hypothetical protein	NA	A0A2H4J101	uncultured_Caudovirales_phage	64.9	2.6e-54
WP_061562486.1|5186104_5186353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562488.1|5186920_5187145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562489.1|5187141_5188143_+	hypothetical protein	NA	X5I3A6	Pseudomonas_phage	76.9	1.9e-09
WP_061562490.1|5188621_5188984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562491.1|5188976_5189468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562492.1|5189854_5190193_+	hypothetical protein	NA	Q9MC61	Pseudomonas_phage	41.3	1.6e-05
WP_061562494.1|5190525_5190843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061562495.1|5190839_5191169_+	hypothetical protein	NA	W6MWX0	Pseudomonas_phage	43.9	6.7e-12
WP_057380215.1|5191377_5191623_+	hypothetical protein	NA	B5WZU8	Pseudomonas_phage	93.7	8.2e-39
WP_061562496.1|5191619_5192594_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	91.0	1.6e-165
WP_009620599.1|5192888_5193599_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	NA	NA	NA	NA
5192703:5192766	attR	ATGGCGGAGAGATAGGGATTTGAACCCTAGGAGCCATTGCTGACTCAACGGATTTCGAATCCGT	NA	NA	NA	NA
WP_043271106.1|5193630_5194389_-	MBL fold metallo-hydrolase	NA	A0A0C5AFC1	Paenibacillus_phage	36.8	3.0e-31
