The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013236	Collimonas pratensis strain Ter291, complete genome	5585899	912241	922333	5585899		Enterobacteria_phage(37.5%)	9	NA	NA
WP_061937436.1|912241_913282_-	GDP-mannose 4,6-dehydratase	NA	M1HKK4	Acanthocystis_turfacea_Chlorella_virus	53.9	4.9e-101
WP_062112145.1|913343_914762_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	28.1	1.6e-49
WP_062120345.1|915202_916285_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	45.8	4.7e-78
WP_062112147.1|916281_917184_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	64.1	1.2e-98
WP_062112149.1|917186_917732_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.1	9.3e-51
WP_156479883.1|917623_918610_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	30.6	1.9e-25
WP_082806931.1|918824_919775_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A223FNK3	NY_014_poxvirus	29.9	1.2e-08
WP_061937452.1|919774_920335_+	sugar transferase	NA	NA	NA	NA	NA
WP_062112156.1|920398_922333_+	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	28.0	1.4e-16
>prophage 2
NZ_CP013236	Collimonas pratensis strain Ter291, complete genome	5585899	1129236	1236000	5585899	head,capsid,plate,tail,tRNA,portal,integrase,holin,terminase	Burkholderia_phage(48.15%)	116	1189923:1189939	1243768:1243784
WP_062112404.1|1129236_1130262_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	55.2	2.4e-100
WP_062112406.1|1130516_1132049_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.7	2.4e-51
WP_082806946.1|1132054_1132963_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_062112411.1|1132940_1133900_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062112413.1|1134267_1134843_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_062112415.1|1134950_1135841_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_062112417.1|1135947_1139421_+	DNA polymerase III subunit alpha	NA	A0A291AWR1	Streptomyces_phage	35.8	8.9e-171
WP_062112419.1|1139562_1140807_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_062112421.1|1140872_1142621_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	26.9	6.5e-45
WP_062112423.1|1142661_1143702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062112425.1|1143777_1144887_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_082806947.1|1144891_1145860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082807290.1|1145880_1146912_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_062112429.1|1146950_1147922_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_062112431.1|1147929_1149393_-	ribonuclease G	NA	NA	NA	NA	NA
WP_061937951.1|1149389_1150010_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_061937954.1|1150106_1150577_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_061937957.1|1150601_1151231_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_062112433.1|1151231_1151906_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_062112435.1|1151920_1152850_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_062112437.1|1153004_1154279_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_061937972.1|1154305_1155031_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_062112439.1|1155122_1156625_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.5	4.4e-82
WP_062112441.1|1156756_1157668_+	DMT family transporter	NA	NA	NA	NA	NA
WP_061937981.1|1157765_1158740_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_061937984.1|1158741_1158921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062112443.1|1159036_1159690_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_062112444.1|1160213_1162925_+	aminopeptidase N	NA	NA	NA	NA	NA
WP_062112447.1|1162994_1163996_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	2.6e-54
WP_061937996.1|1164134_1164419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082806948.1|1164485_1165187_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_156479904.1|1165208_1166618_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.7	2.1e-17
WP_062112453.1|1166838_1167225_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_062112455.1|1167270_1167705_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062120376.1|1167785_1169009_+	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_062112458.1|1169022_1169883_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_061938010.1|1170232_1171231_+	zinc carboxypeptidase	NA	NA	NA	NA	NA
WP_062112460.1|1171223_1172009_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_061938018.1|1172362_1172749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156479905.1|1173195_1173801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062112463.1|1173812_1174649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062112465.1|1174638_1175532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062120380.1|1176275_1178426_+	preprotein translocase	NA	NA	NA	NA	NA
WP_156479906.1|1178543_1179248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062112468.1|1180040_1182521_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	42.4	6.4e-155
WP_062112470.1|1182523_1183309_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_082806949.1|1183324_1183870_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_082806950.1|1183872_1185609_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_062112478.1|1185621_1185879_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_156479907.1|1186078_1186975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062112482.1|1186981_1187194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062112484.1|1187190_1188255_-|portal	phage portal protein	portal	E5E3X1	Burkholderia_phage	61.6	1.3e-128
WP_062112486.1|1188251_1190039_-|terminase	terminase ATPase subunit family protein	terminase	E5FFI8	Burkholderia_phage	67.1	8.2e-237
1189923:1189939	attL	CAGGTGTTTGGCGATGG	NA	NA	NA	NA
WP_062112488.1|1190180_1191032_+|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	51.8	4.2e-66
WP_062112490.1|1191092_1192097_+|capsid	phage major capsid protein, P2 family	capsid	E5E3W8	Burkholderia_phage	63.7	2.9e-122
WP_062112492.1|1192098_1192815_+|integrase	integrase	integrase	A0A1S5NNA5	Burkholderia_phage	46.2	1.2e-45
WP_062112494.1|1192913_1193408_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	52.1	5.0e-35
WP_062112496.1|1193407_1193617_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	62.3	1.5e-17
WP_062112498.1|1193633_1193990_+	hypothetical protein	NA	E5FFI2	Burkholderia_phage	59.6	1.0e-26
WP_062112500.1|1193982_1194252_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_062112502.1|1194248_1194713_+	peptidase M15	NA	C7BGD8	Burkholderia_phage	58.8	1.9e-36
WP_082806951.1|1194616_1195126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062120383.1|1195224_1195713_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	48.5	2.7e-33
WP_062112506.1|1195709_1196177_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	55.3	1.7e-37
WP_062112508.1|1196153_1196663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062112509.1|1196814_1197609_-	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	66.2	3.0e-106
WP_082806952.1|1197556_1197766_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	68.8	1.7e-13
WP_062120385.1|1198015_1198687_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	38.3	1.1e-21
WP_062120389.1|1198686_1199022_+	oxidoreductase	NA	Q9ZXK9	Pseudomonas_virus	53.1	1.3e-23
WP_062112510.1|1199018_1199909_+|plate	baseplate assembly protein	plate	R4JDM0	Burkholderia_phage	53.6	1.9e-77
WP_062112511.1|1199905_1200463_+|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	52.8	2.0e-48
WP_062112512.1|1200467_1202576_+	hypothetical protein	NA	E5E3Q7	Burkholderia_phage	50.9	3.0e-44
WP_062112513.1|1202575_1203172_+	hypothetical protein	NA	A0A2H4J9Z7	uncultured_Caudovirales_phage	34.4	3.3e-09
WP_062112515.1|1203199_1204372_+|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	71.1	6.3e-161
WP_062112516.1|1204399_1204909_+|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	60.4	2.9e-54
WP_082806954.1|1205034_1205385_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	57.1	2.1e-19
WP_082806955.1|1205393_1205510_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	59.5	1.9e-06
WP_062112518.1|1205522_1208255_+	phosphatidate cytidylyltransferase	NA	A4PE52	Ralstonia_virus	42.5	2.3e-174
WP_062112521.1|1208268_1208796_+|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	56.4	7.4e-37
WP_062112525.1|1208795_1210022_+	late control protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	46.2	3.2e-91
WP_062112528.1|1210153_1210618_-	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	45.6	3.4e-25
WP_062112531.1|1210697_1210898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062120394.1|1210980_1211262_+	hypothetical protein	NA	E5E3P2	Burkholderia_phage	74.7	9.4e-31
WP_082806956.1|1211339_1211600_+	ogr/Delta-like zinc finger family protein	NA	K4PAZ0	Burkholderia_phage	41.9	3.8e-10
WP_062112537.1|1211732_1211927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156479908.1|1211930_1212077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062112546.1|1212076_1212370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062112548.1|1212374_1215053_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	54.6	1.1e-274
WP_156479909.1|1215049_1215268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156479910.1|1215330_1216506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062112553.1|1216750_1217758_-|integrase	site-specific integrase	integrase	A0A248XD46	Klebsiella_phage	40.2	1.8e-60
WP_062112560.1|1219326_1220052_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_062120397.1|1220111_1220396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062112563.1|1220481_1220769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062112566.1|1220791_1221475_-	DUF159 family protein	NA	C7BGE4	Burkholderia_phage	45.5	1.2e-47
WP_062112569.1|1221504_1221846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156479911.1|1221934_1222246_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_062112575.1|1222723_1223788_+	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	39.8	6.0e-62
WP_062112577.1|1223765_1224179_+	ASCH domain-containing protein	NA	Q938L5	Temperate_phage	48.3	2.3e-25
WP_156479912.1|1224203_1224731_+	GNAT family N-acetyltransferase	NA	A0A1L7N199	Ralstonia_phage	36.4	9.4e-16
WP_156479913.1|1224689_1225931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062112583.1|1226048_1226582_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_062112586.1|1226810_1227020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062112589.1|1227016_1228081_-|portal	phage portal protein	portal	E5E3X1	Burkholderia_phage	62.4	7.5e-129
WP_062112592.1|1228077_1229865_-|terminase	terminase ATPase subunit family protein	terminase	E5FFI8	Burkholderia_phage	67.3	2.1e-237
WP_062112595.1|1230006_1230858_+|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	52.8	1.2e-68
WP_062112598.1|1230918_1231923_+|capsid	phage major capsid protein, P2 family	capsid	E5E3W8	Burkholderia_phage	63.4	1.2e-120
WP_062112601.1|1231924_1232641_+|integrase	integrase	integrase	A0A1S5NNA5	Burkholderia_phage	45.8	3.5e-45
WP_062112603.1|1232739_1233234_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	53.5	1.0e-32
WP_062112606.1|1233233_1233443_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	62.3	1.2e-17
WP_062112609.1|1233459_1233816_+	hypothetical protein	NA	E5FFI2	Burkholderia_phage	61.4	1.9e-28
WP_062112613.1|1233808_1234075_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_062112617.1|1234074_1234539_+	hypothetical protein	NA	C7BGD8	Burkholderia_phage	58.8	5.5e-36
WP_062112621.1|1234529_1234952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062120400.1|1235050_1235539_+|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	48.1	2.3e-32
WP_062112624.1|1235535_1236000_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	55.8	6.5e-37
1243768:1243784	attR	CCATCGCCAAACACCTG	NA	NA	NA	NA
>prophage 3
NZ_CP013236	Collimonas pratensis strain Ter291, complete genome	5585899	1239524	1292355	5585899	transposase,plate,tail,tRNA,protease,integrase	Burkholderia_phage(23.33%)	54	1250563:1250579	1279543:1279559
WP_082806958.1|1239524_1240367_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	48.4	2.5e-47
WP_082806959.1|1240335_1240524_-	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	70.8	5.3e-14
WP_062120416.1|1240776_1241448_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	37.7	7.3e-21
WP_062120419.1|1241447_1241783_+	oxidoreductase	NA	Q9ZXK9	Pseudomonas_virus	54.0	1.0e-23
WP_062112638.1|1241779_1242670_+|plate	baseplate assembly protein	plate	R4JDM0	Burkholderia_phage	54.3	3.8e-78
WP_062112641.1|1242666_1243227_+|tail	phage tail protein I	tail	E5FFH2	Burkholderia_phage	53.4	4.8e-50
WP_062112644.1|1243232_1245341_+	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	53.5	3.3e-43
WP_062112647.1|1245469_1245940_+	hypothetical protein	NA	A0A2H4J9Z7	uncultured_Caudovirales_phage	34.4	2.6e-09
WP_062112650.1|1245967_1247140_+|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	70.6	9.0e-160
WP_062112653.1|1247167_1247677_+|tail	phage major tail tube protein	tail	E5E3U9	Burkholderia_phage	60.4	2.2e-54
WP_156479915.1|1247743_1248094_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	57.1	1.6e-19
WP_082806961.1|1248102_1248219_+|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	62.2	6.6e-07
WP_062112655.1|1248231_1250964_+	phosphatidate cytidylyltransferase	NA	A4PE52	Ralstonia_virus	43.0	8.5e-177
1250563:1250579	attL	GGCTGGTTCAAGGAAAA	NA	NA	NA	NA
WP_062112658.1|1250977_1251505_+|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	56.4	5.7e-37
WP_062112661.1|1251504_1252770_+	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	44.0	2.9e-87
WP_062112664.1|1252867_1254259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156479916.1|1254844_1255366_-	helix-turn-helix domain-containing protein	NA	E5E3P4	Burkholderia_phage	37.7	5.3e-19
WP_062112531.1|1255428_1255629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062120394.1|1255711_1255993_+	hypothetical protein	NA	E5E3P2	Burkholderia_phage	74.7	9.4e-31
WP_082807291.1|1256071_1256332_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_062112672.1|1256464_1256659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156479917.1|1256662_1256845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156479918.1|1256844_1257138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062112676.1|1257142_1259815_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	54.5	1.9e-274
WP_082806962.1|1260015_1260228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082806964.1|1260505_1261222_-|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	55.9	1.1e-62
WP_156479919.1|1261294_1262381_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_062112684.1|1262391_1262709_-	hypothetical protein	NA	A0A0M3LQN1	Mannheimia_phage	44.3	1.9e-11
WP_156479920.1|1263409_1264570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061945869.1|1264723_1264954_+	ubiquitin	NA	Q65810	Bovine_viral_diarrhea_virus	96.1	2.2e-33
WP_082807292.1|1265366_1265708_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_062112689.1|1265765_1266986_+	class C beta-lactamase	NA	NA	NA	NA	NA
WP_062112692.1|1267005_1267821_+	class D beta-lactamase	NA	NA	NA	NA	NA
WP_061938044.1|1267833_1268460_-	LysE family translocator	NA	NA	NA	NA	NA
WP_062112695.1|1268684_1271156_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_062112698.1|1271364_1272417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061938053.1|1272438_1273203_-	histidine kinase	NA	NA	NA	NA	NA
WP_062112701.1|1273627_1275535_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.5e-50
WP_062120429.1|1275564_1276134_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_062112705.1|1276143_1276995_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_062112708.1|1277196_1278747_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_061938064.1|1279072_1279342_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_062112710.1|1279499_1279955_-	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	37.3	1.2e-11
1279543:1279559	attR	TTTTCCTTGAACCAGCC	NA	NA	NA	NA
WP_061945875.1|1280109_1280340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062112712.1|1280494_1281064_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_061938073.1|1281203_1282457_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	6.8e-12
WP_009665919.1|1282621_1282825_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	1.4e-23
WP_061938076.1|1283152_1283461_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.1e-11
WP_061938080.1|1283457_1285758_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.5	5.5e-169
WP_156479921.1|1285849_1286953_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_062112717.1|1286949_1287399_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	64.4	9.4e-49
WP_061938089.1|1287564_1288770_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.0	3.1e-38
WP_061938092.1|1288831_1289347_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_062112720.1|1289460_1292355_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.6	8.4e-74
>prophage 4
NZ_CP013236	Collimonas pratensis strain Ter291, complete genome	5585899	1498620	1548434	5585899	transposase,plate,tail,tRNA,integrase	Pseudomonas_phage(15.0%)	55	1501514:1501530	1523271:1523287
WP_062113117.1|1498620_1499979_+	hypothetical protein	NA	Q8W619	Enterobacteria_phage	26.1	1.9e-23
WP_156479937.1|1499968_1501168_+	hypothetical protein	NA	C9DGQ3	Escherichia_phage	33.2	7.3e-48
WP_082806987.1|1501167_1501668_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	40.5	5.8e-23
1501514:1501530	attL	AGGTGCCGCTGCTGGAG	NA	NA	NA	NA
WP_062113125.1|1501667_1502129_+	hypothetical protein	NA	Q8W616	Enterobacteria_phage	32.5	4.4e-09
WP_062113128.1|1502128_1503184_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	41.9	1.9e-60
WP_082806988.1|1503128_1503779_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_062113134.1|1504316_1504730_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	39.0	4.8e-15
WP_062113137.1|1504773_1505133_+	hypothetical protein	NA	Q6J1Q7	Burkholderia_virus	54.5	9.9e-25
WP_062113140.1|1505116_1505383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156480204.1|1505466_1506036_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	50.0	9.2e-33
WP_156479938.1|1506032_1506230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113150.1|1506226_1506871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113154.1|1506899_1507706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156479939.1|1507827_1508043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113160.1|1508177_1508642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113162.1|1508821_1509034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156479940.1|1509130_1509859_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_062113168.1|1509861_1510050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113173.1|1510399_1510945_+	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	50.3	2.3e-33
WP_156479941.1|1510941_1511439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113179.1|1511435_1511756_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	52.9	9.4e-19
WP_062113182.1|1511752_1512220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113185.1|1512216_1512495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113189.1|1512491_1514405_+	DNA methyltransferase	NA	L7TH64	Pseudomonas_virus	58.5	4.7e-190
WP_062113192.1|1514521_1515130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113195.1|1515272_1518029_+	hypothetical protein	NA	E5E3N5	Burkholderia_phage	64.0	0.0e+00
WP_082806990.1|1518703_1519702_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	22.7	9.8e-14
WP_156479942.1|1520176_1520503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082807293.1|1521234_1522074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061938501.1|1522217_1523435_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
1523271:1523287	attR	CTCCAGCAGCGGCACCT	NA	NA	NA	NA
WP_062113206.1|1523562_1525644_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_062113209.1|1525936_1526728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113212.1|1526935_1527709_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061938514.1|1528037_1528520_+	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_062113214.1|1528537_1529791_+	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	31.8	7.7e-32
WP_014007107.1|1529919_1530318_+	Fe-S cluster assembly scaffold IscU	NA	A0A2H4N7M4	Lake_Baikal_phage	81.6	1.4e-51
WP_014007106.1|1530402_1530726_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.3	1.4e-25
WP_062120488.1|1530878_1531394_+	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_062113217.1|1531446_1532064_+	LysE family translocator	NA	NA	NA	NA	NA
WP_062113220.1|1532105_1533971_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.3	4.7e-102
WP_062113223.1|1534023_1534362_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_061938529.1|1534376_1534571_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_061938533.1|1534657_1535323_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_062113224.1|1535753_1536707_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062113227.1|1536750_1538127_-	MFS transporter	NA	NA	NA	NA	NA
WP_062113230.1|1538238_1539690_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_062113233.1|1539930_1540926_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_062113235.1|1540959_1541463_+	formaldehyde-activating enzyme	NA	NA	NA	NA	NA
WP_062113238.1|1541659_1543186_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	34.9	2.4e-80
WP_099047169.1|1543285_1544390_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	42.4	2.9e-06
WP_082806991.1|1544593_1545349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113241.1|1545369_1545651_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_061938543.1|1545806_1546409_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_062113244.1|1546396_1547404_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062113247.1|1547423_1548434_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	33.3	2.3e-26
>prophage 5
NZ_CP013236	Collimonas pratensis strain Ter291, complete genome	5585899	2238563	2248972	5585899	integrase,transposase	Bathycoccus_sp._RCC1105_virus(12.5%)	10	2244340:2244354	2247352:2247366
WP_061941607.1|2238563_2240450_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5ESM9	Bathycoccus_sp._RCC1105_virus	42.8	1.5e-111
WP_062114514.1|2240636_2241491_+	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	30.4	1.8e-24
WP_062114516.1|2241525_2242863_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_061941601.1|2242914_2243613_+	response regulator	NA	W8CYM9	Bacillus_phage	38.5	5.6e-32
WP_062114519.1|2243615_2244932_+	phosphate regulon sensor histidine kinase PhoR	NA	A0A1V0SGX0	Hokovirus	26.8	4.9e-13
2244340:2244354	attL	GCGAGGAAACCCGCC	NA	NA	NA	NA
WP_062114522.1|2245525_2246191_-|integrase	site-specific integrase	integrase	Q774Z5	Bordetella_phage	46.1	1.4e-45
WP_156479994.1|2246172_2246589_+	hypothetical protein	NA	F1C5D2	Cronobacter_phage	58.2	2.2e-23
WP_062114529.1|2246585_2247107_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	38.0	4.0e-11
WP_082807307.1|2247193_2248210_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
2247352:2247366	attR	GGCGGGTTTCCTCGC	NA	NA	NA	NA
WP_062114532.1|2248507_2248972_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	35.1	4.7e-11
>prophage 6
NZ_CP013236	Collimonas pratensis strain Ter291, complete genome	5585899	3032303	3039020	5585899		uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_061940285.1|3032303_3032714_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.1	1.1e-19
WP_062115974.1|3033008_3033704_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	37.1	2.5e-24
WP_062115977.1|3033789_3035139_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	25.1	6.1e-27
WP_061946134.1|3035261_3036233_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.9	4.4e-35
WP_062115980.1|3036301_3037297_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_062115984.1|3037392_3038286_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.4	2.1e-36
WP_062115987.1|3038282_3039020_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	54.9	1.2e-69
>prophage 7
NZ_CP013236	Collimonas pratensis strain Ter291, complete genome	5585899	3368080	3446802	5585899	head,capsid,tail,tRNA,protease,portal,integrase,terminase,coat	Burkholderia_virus(21.43%)	89	3386531:3386553	3446829:3446851
WP_082792752.1|3368080_3368608_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_062116542.1|3368658_3369099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082807119.1|3369088_3370468_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_061939758.1|3370535_3371213_-	NAD(P)H dehydrogenase	NA	NA	NA	NA	NA
WP_062116548.1|3371338_3372250_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_062116551.1|3372274_3373477_-	MFS transporter	NA	NA	NA	NA	NA
WP_062116554.1|3373529_3374156_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_082807331.1|3374267_3375341_-	serine hydrolase	NA	NA	NA	NA	NA
WP_062116557.1|3375590_3376196_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_061939749.1|3376437_3377514_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_082807332.1|3377555_3379088_+	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_062116561.1|3379129_3379807_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_062116565.1|3379809_3380040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156480088.1|3380080_3380497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062116568.1|3380567_3381227_-|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_082807120.1|3381407_3382670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082807121.1|3382765_3383716_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_062116571.1|3383816_3384800_-	EamA family transporter	NA	NA	NA	NA	NA
WP_082807333.1|3384943_3385861_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062116578.1|3385980_3386343_+	hypothetical protein	NA	NA	NA	NA	NA
3386531:3386553	attL	TGGTGGGAAGTACAAGTTTCGAA	NA	NA	NA	NA
WP_062116581.1|3387001_3387523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082807122.1|3387696_3388326_-	TonB family protein	NA	NA	NA	NA	NA
WP_082807123.1|3388368_3389889_-	TolC family protein	NA	NA	NA	NA	NA
WP_156480089.1|3389945_3394490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156480090.1|3394508_3395717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062116595.1|3396048_3396849_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062116598.1|3396852_3398259_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_156480091.1|3398248_3400417_-	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.8	9.5e-54
WP_082807124.1|3400586_3401654_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_062116604.1|3401894_3402413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062116608.1|3402409_3403066_-	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	48.1	6.8e-40
WP_062116611.1|3403062_3403329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062116616.1|3403312_3403660_-	hypothetical protein	NA	Q6J1Q7	Burkholderia_virus	55.6	2.8e-24
WP_062116619.1|3403719_3403929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062116624.1|3403925_3404216_-	hypothetical protein	NA	A0A2H4J9Z7	uncultured_Caudovirales_phage	51.6	1.8e-16
WP_062116627.1|3404225_3404984_-	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	32.7	4.5e-27
WP_062116630.1|3405064_3405718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062116633.1|3405717_3405999_-	hypothetical protein	NA	Q3HQU6	Burkholderia_phage	38.8	3.8e-08
WP_062116636.1|3405998_3409319_-|tail	phage tail protein	tail	A4JX16	Burkholderia_virus	53.0	0.0e+00
WP_062116639.1|3409315_3409882_-|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	54.3	3.7e-50
WP_062116643.1|3409960_3410713_-	C40 family peptidase	NA	Q8W6T2	Burkholderia_virus	52.8	3.1e-68
WP_062116645.1|3410709_3411435_-|tail	phage minor tail protein L	tail	A0A2R3UA90	Siphoviridae_environmental_samples	49.4	9.8e-64
WP_062116649.1|3411431_3411770_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	49.1	2.0e-27
WP_062116652.1|3411769_3415270_-|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	29.5	5.4e-59
WP_062116655.1|3415266_3415512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156480092.1|3415550_3415982_-	hypothetical protein	NA	A0A0R8VCP4	Thermobifida_phage	31.1	9.7e-11
WP_062116659.1|3415978_3416392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062116661.1|3416466_3416808_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_062116664.1|3416804_3417284_-	hypothetical protein	NA	S4TR46	Salmonella_phage	27.5	8.0e-06
WP_062116667.1|3417276_3417603_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	47.3	5.8e-16
WP_082807125.1|3417602_3418022_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	34.7	9.2e-06
WP_062120916.1|3418222_3419443_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	62.1	6.8e-134
WP_062116676.1|3419617_3420316_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	64.1	3.9e-70
WP_062116679.1|3420305_3421616_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	55.9	5.0e-135
WP_062116682.1|3421626_3423318_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	53.9	2.2e-167
WP_062116685.1|3423327_3423729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062116691.1|3424578_3425280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156480093.1|3425829_3426957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062116697.1|3427068_3427836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082807127.1|3428066_3429284_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_062116703.1|3429573_3429864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156480094.1|3429869_3430325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156480095.1|3430498_3431086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062116713.1|3431134_3431602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156480096.1|3431579_3432002_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	45.5	2.0e-21
WP_062116715.1|3432220_3432646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062116717.1|3432603_3433368_-	DUF1376 domain-containing protein	NA	H2BD69	Pseudomonas_phage	52.5	7.7e-27
WP_082807128.1|3433364_3433847_-	DUF1364 family protein	NA	NA	NA	NA	NA
WP_156480097.1|3434019_3434340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156480098.1|3434483_3434717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156480099.1|3434811_3435423_-	hypothetical protein	NA	A0A0S2SYA8	Pseudomonas_phage	45.5	1.9e-31
WP_082807129.1|3435777_3436530_+	helix-turn-helix domain-containing protein	NA	A0A2I7S9A5	Vibrio_phage	27.5	5.1e-15
WP_062116736.1|3436748_3437348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062116739.1|3437600_3437885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062116742.1|3438004_3438202_-	hypothetical protein	NA	Q3HQV3	Burkholderia_phage	72.1	2.5e-22
WP_062116745.1|3438671_3438902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062116748.1|3438898_3439165_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_062116751.1|3439554_3440460_+	recombination-associated protein RdgC	NA	A0A0U1SXS1	Pseudomonas_phage	34.2	8.0e-39
WP_062116754.1|3440513_3440744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062116758.1|3440746_3441022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156480100.1|3441312_3441498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062116764.1|3441540_3441798_-	DUF1488 family protein	NA	NA	NA	NA	NA
WP_156480101.1|3442654_3442978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062116770.1|3442974_3443565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156480102.1|3443561_3443867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082807130.1|3443863_3444478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062116776.1|3444725_3445418_+	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	40.1	1.7e-33
WP_062120928.1|3445426_3445621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082807131.1|3445578_3446802_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	36.6	1.2e-61
3446829:3446851	attR	TGGTGGGAAGTACAAGTTTCGAA	NA	NA	NA	NA
