The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012487	Enterobacter sp. FY-07, complete genome	5118646	1188759	1265381	5118646	head,capsid,protease,portal,holin,tail,terminase,lysis,plate,tRNA,integrase	Shigella_phage(20.78%)	106	1204688:1204703	1262922:1262937
WP_061493526.1|1188759_1188963_+	transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	65.4	2.9e-13
WP_071889880.1|1189340_1191302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061493527.1|1191350_1192544_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.4	4.5e-106
WP_061493528.1|1192820_1194011_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	68.2	4.3e-149
WP_071889882.1|1193971_1194178_-	excisionase	NA	I6PBM8	Cronobacter_phage	72.1	4.5e-22
WP_061493529.1|1194204_1194480_-	hypothetical protein	NA	K7PKM4	Enterobacterial_phage	48.9	3.9e-13
WP_061493530.1|1194479_1194875_-	hypothetical protein	NA	S4TTI6	Salmonella_phage	65.6	7.2e-45
WP_061493531.1|1194920_1195508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061493532.1|1195601_1195823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082794136.1|1195819_1196155_-	hypothetical protein	NA	A0A1P8DTU9	Salmonella_phage	64.7	7.0e-33
WP_061493533.1|1196151_1196661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061493534.1|1196651_1197194_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	72.9	4.7e-71
WP_061493535.1|1197323_1198148_-	DUF2303 domain-containing protein	NA	A0A0P0ZBZ4	Stx2-converting_phage	65.7	1.5e-97
WP_061493536.1|1198187_1198550_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	72.6	8.9e-42
WP_061493537.1|1199182_1199839_-	LexA family transcriptional repressor	NA	K7PLZ5	Enterobacterial_phage	82.1	6.3e-102
WP_061493538.1|1199938_1200136_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	75.4	4.3e-22
WP_061493539.1|1200164_1200716_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	51.6	1.1e-43
WP_061493540.1|1200879_1201059_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	63.6	9.6e-13
WP_061493541.1|1201048_1201921_+	GntR family transcriptional regulator	NA	K7PLZ7	Enterobacterial_phage	62.6	1.1e-42
WP_061493542.1|1201917_1202346_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_061493543.1|1202342_1203227_+	DNA methylase	NA	A0A1C9II58	Salmonella_phage	68.6	1.3e-118
WP_061499808.1|1203709_1204519_+	DNA-binding protein	NA	A5LH75	Enterobacteria_phage	77.0	1.8e-114
WP_061493544.1|1204526_1205516_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	72.0	4.8e-146
1204688:1204703	attL	CCAGCCGCTGGCGGAA	NA	NA	NA	NA
WP_061493545.1|1205530_1206289_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	67.5	3.4e-91
WP_061493546.1|1206453_1206720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020454456.1|1206832_1207213_+|holin	holin	holin	F1C592	Cronobacter_phage	80.2	1.9e-50
WP_061493547.1|1207199_1207484_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	52.2	1.6e-17
WP_061493548.1|1207483_1207924_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	79.9	7.5e-59
WP_061493549.1|1207920_1208391_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	61.1	9.2e-39
WP_061493550.1|1208394_1208634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082794137.1|1208850_1209003_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_061493551.1|1209090_1209294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889891.1|1209361_1209712_+	HNH endonuclease	NA	Q8SBD7	Shigella_phage	78.4	6.6e-50
WP_061493552.1|1209839_1210334_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	95.1	3.1e-85
WP_061493553.1|1210330_1212064_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	94.7	0.0e+00
WP_061493554.1|1212211_1213438_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	87.4	7.4e-213
WP_061493555.1|1213430_1214030_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	3.5e-91
WP_061493556.1|1214039_1215266_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	75.4	4.5e-170
WP_061493557.1|1215340_1215664_+|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	63.2	8.5e-36
WP_061493558.1|1215660_1216071_+|head,tail	head-tail adaptor protein	head,tail	M1FJ87	Enterobacteria_phage	72.1	1.3e-49
WP_061493559.1|1216045_1216552_+	hypothetical protein	NA	Q8SBH5	Shigella_phage	80.4	3.6e-73
WP_061493560.1|1216548_1217121_+	hypothetical protein	NA	U5P4H6	Shigella_phage	77.8	2.8e-82
WP_071889894.1|1217128_1217302_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	84.2	1.0e-19
WP_061493561.1|1217291_1218791_+|tail	phage tail protein	tail	S5FKL0	Shigella_phage	82.9	9.3e-234
WP_061493562.1|1218790_1219147_+|tail	phage tail protein	tail	Q8W622	Enterobacteria_phage	79.7	4.4e-49
WP_061493563.1|1219143_1219413_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	84.1	1.1e-36
WP_071889896.1|1219379_1219562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061493564.1|1219554_1221330_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	79.0	2.9e-234
WP_061493565.1|1221406_1222087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061493566.1|1222174_1223485_+	DNA circularization protein	NA	S5FUX4	Shigella_phage	71.0	2.8e-178
WP_061493567.1|1223481_1224552_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	81.3	1.1e-169
WP_061493568.1|1224551_1225100_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	70.3	1.2e-69
WP_061493569.1|1225099_1225525_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	87.9	2.0e-69
WP_061493570.1|1225511_1226570_+|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	78.1	5.6e-161
WP_061493571.1|1226560_1227145_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	80.9	5.2e-92
WP_061493572.1|1228202_1228397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061493573.1|1228532_1228772_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	78.2	9.4e-32
WP_061493574.1|1228771_1229089_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	58.8	1.3e-28
WP_061493575.1|1229795_1230278_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.4e-29
WP_061493576.1|1230437_1230875_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
WP_061493577.1|1230864_1231161_+	RnfH family protein	NA	NA	NA	NA	NA
WP_061493578.1|1231167_1231686_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_061493579.1|1231742_1232087_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_061493580.1|1232235_1233897_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_061493581.1|1233984_1234863_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_061493582.1|1234960_1235581_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_061493583.1|1235632_1236919_-	magnesium/cobalt efflux protein	NA	NA	NA	NA	NA
WP_061499811.1|1236935_1237724_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_061493584.1|1237892_1239254_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_061493585.1|1239504_1239753_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_061493586.1|1239771_1240320_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_061493587.1|1240350_1241124_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|1241163_1241511_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_061493588.1|1241687_1241882_-	late control protein B	NA	Q37973	Salmonella_virus	78.1	1.8e-25
WP_061493589.1|1241965_1243120_-	hypothetical protein	NA	Q6K1G4	Salmonella_virus	48.0	2.9e-94
WP_061493590.1|1243116_1243578_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	57.0	2.9e-45
WP_061493591.1|1243580_1245311_-	hypothetical protein	NA	M1T2S3	Escherichia_phage	27.2	1.4e-44
WP_061493592.1|1245303_1245423_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	87.2	7.5e-14
WP_061493593.1|1245455_1245737_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	78.4	3.9e-29
WP_061493594.1|1245799_1246318_-|tail	phage tail protein	tail	Q858V0	Yersinia_virus	89.0	5.0e-86
WP_061493595.1|1246330_1247512_-|tail	phage tail protein	tail	S4TRX2	Salmonella_phage	87.8	6.9e-200
WP_082794138.1|1247643_1248108_-	hypothetical protein	NA	K7P7H0	Enterobacteria_phage	37.7	1.6e-11
WP_082794199.1|1248076_1249000_-	hypothetical protein	NA	A0A2I8TVA9	Erwinia_phage	67.9	1.5e-64
WP_061493597.1|1249129_1249726_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	60.4	8.0e-64
WP_061493598.1|1249725_1250799_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	46.6	7.8e-110
WP_061493599.1|1250976_1252011_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	63.1	2.7e-115
WP_061493600.1|1252007_1252619_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	76.5	1.4e-87
WP_061493601.1|1252611_1253520_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	78.8	3.7e-129
WP_061493602.1|1253524_1253872_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	69.6	4.0e-39
WP_061493603.1|1253868_1254504_-|plate	phage baseplate assembly protein V	plate	M1SV78	Escherichia_phage	83.9	1.2e-97
WP_061493604.1|1254590_1255058_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	57.5	1.7e-45
WP_082794139.1|1254996_1255266_-|holin	holin	holin	S4TNY4	Salmonella_phage	71.6	2.3e-26
WP_061493605.1|1255165_1255579_-	protein lysB	NA	Q6K1I0	Salmonella_virus	59.1	2.1e-15
WP_061493606.1|1255575_1256085_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	73.6	9.6e-66
WP_061493607.1|1256068_1256290_-|holin	holin	holin	A0A218M4L5	Erwinia_phage	42.5	6.5e-11
WP_061493608.1|1256280_1256484_-|tail	phage tail protein	tail	Q858W3	Yersinia_virus	74.2	8.3e-21
WP_061493609.1|1256702_1256888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082794140.1|1256935_1258942_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	71.1	3.1e-261
WP_061493610.1|1258942_1259164_-	hypothetical protein	NA	Q6K1F5	Salmonella_virus	67.6	2.2e-19
WP_061493611.1|1259259_1259598_-	hypothetical protein	NA	A0A218M4I7	Erwinia_phage	67.6	1.1e-36
WP_061493612.1|1259636_1260014_-	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	71.4	3.5e-41
WP_061493613.1|1260129_1260981_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	60.9	2.6e-92
WP_061493614.1|1260988_1262038_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	72.2	9.0e-151
WP_061493615.1|1262220_1262673_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_061493616.1|1262736_1264101_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
1262922:1262937	attR	CCAGCCGCTGGCGGAA	NA	NA	NA	NA
WP_061493617.1|1264310_1265381_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B6VT43	Edwardsiella_phage	51.8	2.4e-90
>prophage 2
NZ_CP012487	Enterobacter sp. FY-07, complete genome	5118646	1794371	1806447	5118646		Enterobacteria_phage(33.33%)	14	NA	NA
WP_061494077.1|1794371_1795787_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.6	1.7e-19
WP_061494078.1|1795968_1796862_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.9	1.9e-45
WP_061494081.1|1798375_1799242_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	66.0	6.3e-110
WP_061494087.1|1799270_1800161_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	34.9	2.8e-28
WP_061494089.1|1800178_1800724_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.5	7.9e-50
WP_082794147.1|1800727_1800976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494091.1|1800962_1801655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494093.1|1801730_1802492_+	glycosyl transferase family 2	NA	A0A1D8KNV9	Synechococcus_phage	45.6	1.8e-52
WP_061494094.1|1802488_1803124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494096.1|1803131_1803749_+	HAD family phosphatase	NA	M1H9H9	Acanthocystis_turfacea_Chlorella_virus	47.2	2.4e-39
WP_061494098.1|1803776_1804517_+	hypothetical protein	NA	A0A1D8KNV9	Synechococcus_phage	32.2	2.7e-32
WP_061494100.1|1804503_1804824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494102.1|1804984_1805725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494104.1|1805721_1806447_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	27.1	8.4e-07
>prophage 3
NZ_CP012487	Enterobacter sp. FY-07, complete genome	5118646	2050314	2089828	5118646	protease,head,tail,plate	Burkholderia_virus(42.5%)	53	NA	NA
WP_061494356.1|2050314_2051364_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	33.6	6.1e-06
WP_023480048.1|2051381_2051771_+	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	32.2	7.7e-07
WP_061494357.1|2051782_2052427_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_082794203.1|2052539_2053151_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071890685.1|2054045_2054171_+	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_045285358.1|2054140_2054722_-	DNA-invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.1	7.6e-67
WP_061494361.1|2054771_2055245_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	62.1	2.1e-43
WP_061494365.1|2055826_2056423_-|tail	phage tail protein	tail	A0A218M4J2	Erwinia_phage	54.8	7.0e-60
WP_071889942.1|2056422_2057379_-	hypothetical protein	NA	M1TAS6	Escherichia_phage	57.9	1.8e-65
WP_061494367.1|2057381_2057960_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.3	1.3e-66
WP_061494368.1|2057952_2059056_-|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	52.7	2.1e-105
WP_000859115.1|2059046_2059394_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	7.8e-35
WP_021544460.1|2059448_2059961_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	37.9	2.1e-20
WP_061494369.1|2059960_2061130_-	Cro/Cl family transcriptional regulator	NA	Q6QIA2	Burkholderia_phage	48.6	3.9e-86
WP_006687305.1|2061117_2061333_-|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_061494370.1|2061329_2062214_-	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	2.6e-50
WP_061494371.1|2062213_2064679_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.4	8.2e-171
WP_000084225.1|2064874_2065189_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_061494372.1|2065287_2065569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006687298.1|2065571_2066093_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.8	1.4e-67
WP_061494373.1|2066092_2067520_-|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	78.6	2.0e-217
WP_061494374.1|2067509_2067764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304058.1|2067760_2068225_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	52.3	5.7e-41
WP_061494375.1|2068224_2068671_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.0	5.1e-31
WP_055311821.1|2068672_2069029_-	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
WP_061494376.1|2069039_2069993_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.0	1.9e-62
WP_032438842.1|2070006_2071104_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	50.1	2.0e-97
WP_061494377.1|2071318_2071777_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	42.4	3.2e-28
WP_061494378.1|2071779_2072601_-|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	62.3	1.4e-98
WP_061494379.1|2072581_2074078_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	61.3	3.7e-174
WP_061494380.1|2074077_2075601_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.2	9.9e-183
WP_011410682.1|2075597_2076143_-	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	67.6	1.2e-58
WP_061494381.1|2076142_2076454_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	61.6	4.0e-30
WP_000175096.1|2076446_2076779_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_061494382.1|2076775_2077426_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	31.0	3.4e-07
WP_061494383.1|2077409_2078138_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.2	3.7e-63
WP_016191696.1|2078140_2078491_-	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	1.2e-22
WP_061494384.1|2078738_2079509_+	restriction endonuclease subunit M	NA	A2I2Y7	Vibrio_virus	65.3	1.0e-98
WP_061494385.1|2079498_2080704_-	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	31.5	1.4e-46
WP_061494386.1|2080706_2081714_-	nucleoid-associated protein	NA	A0A291AUQ0	Sinorhizobium_phage	36.0	3.2e-57
WP_061494387.1|2081784_2082192_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001041677.1|2082280_2082505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494388.1|2082501_2082807_+	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	58.0	5.4e-24
WP_061494389.1|2082816_2083725_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.7	3.7e-76
WP_011410679.1|2085507_2086674_+	hypothetical protein	NA	A4JWN1	Burkholderia_virus	61.1	1.3e-121
WP_023214064.1|2086676_2086946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494390.1|2086963_2087575_+	DUF3164 domain-containing protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.0	3.6e-75
WP_032639427.1|2087654_2087843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494391.1|2087839_2088136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494392.1|2088122_2088812_+	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	34.2	1.3e-25
WP_061494393.1|2088808_2089024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494394.1|2089013_2089442_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	48.9	1.4e-25
WP_061494395.1|2089438_2089828_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	52.5	8.4e-30
>prophage 4
NZ_CP012487	Enterobacter sp. FY-07, complete genome	5118646	2470292	2530961	5118646	protease,portal,holin,tail,lysis,integrase	Enterobacteria_phage(32.56%)	71	2486452:2486511	2531741:2531842
WP_061494711.1|2470292_2472053_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_061494712.1|2472233_2472686_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_061494713.1|2472765_2473821_-	porin OmpA	NA	NA	NA	NA	NA
WP_061494714.1|2474188_2474698_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_061494715.1|2474915_2475536_+	competence protein	NA	NA	NA	NA	NA
WP_061494716.1|2475532_2477659_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_061494717.1|2477676_2478123_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_061494718.1|2478245_2480300_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	28.1	9.4e-19
WP_061494719.1|2480327_2480786_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_061494720.1|2480922_2481336_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_061494721.1|2481362_2481680_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_061494722.1|2481740_2482931_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_061494723.1|2483023_2483305_+	acylphosphatase	NA	NA	NA	NA	NA
WP_061494724.1|2483301_2483631_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_061494725.1|2483721_2484381_-	transmembrane protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	54.9	4.4e-47
WP_061494726.1|2484652_2486281_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
2486452:2486511	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_082794154.1|2486608_2487640_-|integrase	integrase	integrase	A0A192Y7M7	Salmonella_phage	47.4	8.1e-80
WP_071889967.1|2487578_2487857_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_061494727.1|2487927_2490093_-	exonuclease	NA	K7PJT5	Enterobacteria_phage	40.5	6.5e-95
WP_061494728.1|2490234_2490591_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_061494729.1|2490625_2490811_-	DUF1482 domain-containing protein	NA	NA	NA	NA	NA
WP_061494730.1|2491256_2491640_-	transcriptional regulator	NA	K7PH71	Enterobacterial_phage	53.5	5.6e-18
WP_071889969.1|2491745_2491958_+	XRE family transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	62.1	2.9e-16
WP_061494731.1|2491960_2492515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494732.1|2492570_2493374_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	44.2	2.1e-51
WP_061494733.1|2493376_2494117_+	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	70.4	2.6e-96
WP_061494734.1|2494136_2494577_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_061494735.1|2494570_2494882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494736.1|2494878_2495472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494737.1|2495474_2495819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494738.1|2495811_2496081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494739.1|2496077_2498057_+	DNA methyltransferase	NA	H9C171	Pectobacterium_phage	53.6	2.1e-201
WP_061494740.1|2498108_2498888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071889972.1|2499729_2499969_+	hypothetical protein	NA	H6WRY6	Salmonella_phage	57.1	3.6e-15
WP_061494741.1|2500101_2500308_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	50.0	2.6e-14
WP_061494742.1|2500304_2500673_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	66.7	1.8e-42
WP_061494743.1|2500657_2501653_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	63.4	2.0e-128
WP_061494744.1|2501666_2502287_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	55.9	1.3e-61
WP_061494745.1|2502510_2502702_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	66.7	6.8e-17
WP_061494746.1|2502851_2503913_+	site-specific DNA-methyltransferase	NA	K7PKK9	Enterobacteria_phage	78.5	9.6e-169
WP_061494747.1|2504053_2504374_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	77.1	9.7e-40
WP_061494748.1|2504360_2504792_+	lysozyme	NA	A0A0B5KND4	Acinetobacter_phage	57.9	3.2e-38
WP_061494749.1|2504788_2505259_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	49.7	5.1e-29
WP_061494750.1|2505785_2506058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494751.1|2506114_2506297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494752.1|2506727_2507222_+	DUF1441 domain-containing protein	NA	K7PJY2	Enterobacterial_phage	82.8	3.5e-65
WP_061494753.1|2507221_2509330_+	DNA packaging protein	NA	K7PH52	Enterobacterial_phage	83.5	0.0e+00
WP_061494754.1|2509326_2509542_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	82.9	4.5e-25
WP_061494755.1|2509538_2511050_+|portal	phage portal protein	portal	K7PHM5	Enterobacterial_phage	82.3	2.0e-244
WP_082794155.1|2510976_2513010_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	84.9	0.0e+00
WP_061494756.1|2513091_2513418_+	DUF2190 domain-containing protein	NA	K7PJY3	Enterobacterial_phage	66.4	4.0e-33
WP_061494757.1|2513410_2513683_+	hypothetical protein	NA	K7PH43	Enterobacteria_phage	54.9	2.7e-19
WP_061494758.1|2513691_2514243_+|tail	phage tail protein	tail	K7P7A8	Enterobacteria_phage	76.4	7.2e-59
WP_061494759.1|2514239_2514638_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	64.6	5.2e-43
WP_061494760.1|2514648_2515383_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	71.4	4.9e-95
WP_061494761.1|2515415_2515820_+|tail	phage minor tail protein G	tail	NA	NA	NA	NA
WP_061494762.1|2515828_2516137_+|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	48.5	1.5e-21
WP_061494763.1|2516117_2518625_+|tail	phage tail tape measure protein	tail	K7PKR0	Enterobacteria_phage	38.3	3.8e-139
WP_061499955.1|2518629_2518977_+|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	59.1	5.9e-35
WP_061494764.1|2518973_2519729_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	82.9	3.9e-124
WP_061494765.1|2519730_2520441_+	peptidase P60	NA	K7P7C3	Enterobacteria_phage	81.4	1.6e-119
WP_061494766.1|2520452_2521052_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	75.9	1.1e-76
WP_061494767.1|2521113_2524290_+	host specificity protein J	NA	O64335	Escherichia_phage	78.1	0.0e+00
WP_061494768.1|2524710_2525295_+	hypothetical protein	NA	A0A1B2AP04	Escherichia_phage	40.9	2.6e-22
WP_061494769.1|2525408_2525645_+	hypothetical protein	NA	Q38624	Escherichia_phage	58.4	1.0e-17
WP_061494771.1|2527352_2527730_+|tail	tail fiber assembly protein	tail	I7LEG3	Yersinia_phage	49.2	6.3e-30
WP_061494772.1|2527863_2528286_+	translesion error-prone DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	57.5	1.5e-35
WP_061494773.1|2528288_2529554_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	88.4	4.0e-222
WP_061494774.1|2529546_2530218_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	58.6	7.1e-77
WP_061494775.1|2530300_2530498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061494776.1|2530496_2530961_+	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	32.7	1.8e-07
2531741:2531842	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAGATTAAACAAGGGGTTACCGAAAGGTAACCCCTTTGTTTTTT	NA	NA	NA	NA
>prophage 5
NZ_CP012487	Enterobacter sp. FY-07, complete genome	5118646	2754610	2818959	5118646	head,holin,tail,transposase,terminase,plate,tRNA	Pectobacterium_phage(44.44%)	74	NA	NA
WP_061495082.1|2754610_2756539_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	1.2e-129
WP_071532057.1|2756542_2757085_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	8.2e-15
WP_001124225.1|2757177_2757375_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_013366084.1|2757424_2757781_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_061495084.1|2758066_2759050_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	6.4e-34
WP_061495086.1|2759064_2761452_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_006820203.1|2761456_2761756_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_061495088.1|2761856_2762837_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_061495090.1|2762871_2763423_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_082794162.1|2763428_2764172_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	2.4e-09
WP_061495093.1|2764249_2764714_+	endopeptidase	NA	A0A217EQL1	Bacillus_phage	36.7	6.6e-13
WP_061495095.1|2765038_2765752_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_061495097.1|2765813_2767256_+	YdiU family protein	NA	NA	NA	NA	NA
WP_061495099.1|2767263_2767455_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_061495101.1|2767604_2768651_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	46.5	5.7e-81
WP_061495103.1|2768805_2769639_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_061495105.1|2769969_2772348_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.1	6.1e-171
WP_061495107.1|2772505_2772760_-	pyocin activator protein PrtN	NA	A0A1W6JP35	Morganella_phage	53.6	3.7e-18
WP_061495109.1|2772844_2773108_-	DUF4060 domain-containing protein	NA	K7PHF4	Enterobacteria_phage	72.0	2.2e-21
WP_061495111.1|2773094_2773277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061495112.1|2773317_2774397_-	enterohemolysin	NA	H6WRX0	Salmonella_phage	53.7	1.8e-101
WP_061495114.1|2774407_2777305_-	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	57.8	1.5e-272
WP_061495117.1|2777437_2777725_-	hypothetical protein	NA	H6WRX2	Salmonella_phage	58.9	2.0e-28
WP_061499990.1|2778436_2778646_+	DUF2767 domain-containing protein	NA	I6R0R9	Salmonella_phage	63.8	8.8e-18
WP_061495119.1|2778753_2779230_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_061495121.1|2779430_2780111_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	72.4	4.5e-87
WP_061495124.1|2780239_2780470_+	transcriptional regulator	NA	A0A2H4FNF3	Salmonella_phage	54.1	1.4e-16
WP_061495126.1|2780502_2780823_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	70.8	2.2e-36
WP_061495128.1|2780908_2781904_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	82.3	2.4e-113
WP_061495130.1|2781887_2782625_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	62.1	5.4e-78
WP_061495132.1|2782627_2782948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061495133.1|2783105_2784212_+	ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	31.1	1.6e-20
WP_061495136.1|2784216_2786445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004723446.1|2786719_2786983_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_082794163.1|2787006_2787840_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.9	1.9e-50
WP_061495139.1|2788071_2788569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061495141.1|2788661_2789261_+	DUF1367 domain-containing protein	NA	S4TTI0	Salmonella_phage	84.4	2.1e-96
WP_071890701.1|2789263_2789464_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	61.9	5.7e-14
WP_061499996.1|2789456_2789750_+	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	77.3	1.8e-40
WP_061495150.1|2789853_2790567_+	antiterminator	NA	I6PDF8	Cronobacter_phage	53.4	1.5e-56
WP_061495152.1|2790704_2790896_+	hypothetical protein	NA	Q8SBE3	Shigella_phage	69.8	3.1e-17
WP_061495154.1|2791045_2792116_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	79.6	2.6e-169
WP_061495157.1|2792165_2792459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061495159.1|2792459_2793287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061495161.1|2793279_2793474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061495163.1|2793528_2793744_+|holin	holin	holin	Q9ZWW2	Enterobacteria_phage	77.5	9.1e-26
WP_061495165.1|2793743_2794256_+	lysozyme	NA	I6PBN2	Cronobacter_phage	64.3	6.7e-51
WP_071890004.1|2794475_2794676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071890007.1|2795261_2795435_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_061495169.1|2795503_2796526_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	41.6	2.3e-34
WP_061495171.1|2796758_2798399_+|terminase	terminase	terminase	H9C191	Pectobacterium_phage	89.7	3.2e-304
WP_061495174.1|2798401_2799793_+	hypothetical protein	NA	H9C192	Pectobacterium_phage	78.4	1.1e-212
WP_061495176.1|2799842_2800592_+|head	phage head morphogenesis protein	head	H9C193	Pectobacterium_phage	73.9	1.1e-99
WP_061495177.1|2800610_2801810_+	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	82.2	9.6e-149
WP_061495180.1|2801809_2802328_+	hypothetical protein	NA	H9C195	Pectobacterium_phage	66.5	8.9e-51
WP_061495181.1|2802342_2803293_+	DUF2184 domain-containing protein	NA	H9C196	Pectobacterium_phage	84.1	6.2e-151
WP_061495183.1|2803295_2803649_+	hypothetical protein	NA	H9C197	Pectobacterium_phage	43.1	1.1e-20
WP_061495185.1|2803678_2804101_+	DUF4054 domain-containing protein	NA	H9C198	Pectobacterium_phage	87.1	6.3e-63
WP_061495187.1|2804097_2804565_+	hypothetical protein	NA	H9C199	Pectobacterium_phage	80.6	2.2e-64
WP_061495189.1|2804567_2804987_+	hypothetical protein	NA	H9C1A0	Pectobacterium_phage	85.0	6.9e-70
WP_061495191.1|2804986_2805511_+	hypothetical protein	NA	H9C1A1	Pectobacterium_phage	82.2	1.1e-80
WP_061495192.1|2805519_2806674_+	DUF3383 domain-containing protein	NA	H9C1A2	Pectobacterium_phage	87.5	1.6e-193
WP_061495194.1|2806680_2807085_+	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	95.5	5.8e-66
WP_061495196.1|2807084_2807471_+	hypothetical protein	NA	H9C1A4	Pectobacterium_phage	65.9	8.9e-40
WP_061495198.1|2807733_2809431_+	lysozyme	NA	H9C1A7	Pectobacterium_phage	59.2	5.3e-177
WP_061495200.1|2809433_2810078_+	hypothetical protein	NA	H9C1A8	Pectobacterium_phage	77.1	1.4e-74
WP_061495202.1|2810074_2810365_+	hypothetical protein	NA	H9C1A9	Pectobacterium_phage	77.1	6.3e-38
WP_061495204.1|2810357_2811248_+	hypothetical protein	NA	H9C1B0	Pectobacterium_phage	78.0	1.7e-142
WP_082794164.1|2811244_2811847_+	hypothetical protein	NA	H9C1B1	Pectobacterium_phage	66.5	8.1e-80
WP_061495207.1|2811909_2812260_+	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	80.2	6.0e-51
WP_061495209.1|2812259_2813474_+|plate	phage baseplate protein	plate	H9C1B3	Pectobacterium_phage	72.1	2.0e-162
WP_061495211.1|2813460_2814363_+	DUF2612 domain-containing protein	NA	H9C1B4	Pectobacterium_phage	67.7	2.1e-108
WP_061495213.1|2814364_2816830_+	carbohydrate-binding protein	NA	H9C1B5	Pectobacterium_phage	49.9	3.1e-202
WP_061495215.1|2816901_2818959_+|tail	phage tail protein	tail	H9C1B7	Pectobacterium_phage	51.6	4.8e-172
>prophage 6
NZ_CP012487	Enterobacter sp. FY-07, complete genome	5118646	2980835	2989535	5118646		Escherichia_phage(66.67%)	10	NA	NA
WP_061495581.1|2980835_2981447_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	38.7	6.6e-29
WP_061495583.1|2981524_2982382_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	32.2	1.2e-20
WP_061495584.1|2982383_2983001_-	dimethylsulfoxide reductase, chain B	NA	A0A077SL61	Escherichia_phage	60.6	1.1e-76
WP_061495586.1|2983011_2985450_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.1	8.9e-218
WP_061495588.1|2985601_2985883_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_061500011.1|2986055_2986775_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_061495590.1|2986793_2987351_-	spermidine acetyltransferase	NA	NA	NA	NA	NA
WP_061495592.1|2987403_2987742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061495593.1|2987881_2988208_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.5	6.0e-21
WP_061495595.1|2988320_2989535_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	29.5	1.4e-46
>prophage 7
NZ_CP012487	Enterobacter sp. FY-07, complete genome	5118646	3637966	3688535	5118646	head,tail,plate,tRNA,integrase	Burkholderia_virus(41.46%)	64	3648742:3648758	3690168:3690184
WP_061496711.1|3637966_3639745_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	29.1	2.8e-11
WP_061496713.1|3640011_3640578_+	hydrolase	NA	NA	NA	NA	NA
WP_061496715.1|3640574_3641393_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-58
WP_061496717.1|3641444_3641840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061496718.1|3641879_3642620_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	NA	NA	NA	NA
WP_061496720.1|3642616_3643588_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_061496722.1|3643673_3644417_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_061496724.1|3644494_3645055_-	VOC family protein	NA	NA	NA	NA	NA
WP_061496726.1|3645201_3646935_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L2F0	Tupanvirus	34.5	4.4e-86
WP_061496728.1|3647046_3648186_-	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_061496729.1|3648196_3649774_-	MFS transporter	NA	NA	NA	NA	NA
3648742:3648758	attL	CCAGCAGCAGTAACGCG	NA	NA	NA	NA
WP_061496730.1|3650073_3650484_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_061496731.1|3650483_3652562_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_061496732.1|3653276_3653666_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.7	6.5e-30
WP_061496734.1|3653662_3654091_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	48.1	1.2e-24
WP_071890037.1|3654080_3654296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061496736.1|3654292_3654985_-	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	33.6	7.7e-26
WP_061496738.1|3655161_3655365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061496740.1|3655354_3655567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061496742.1|3655645_3656257_-	DUF3164 domain-containing protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.7	1.4e-74
WP_061496744.1|3656258_3656522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835317.1|3656546_3656816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061496746.1|3656818_3657985_-	hypothetical protein	NA	A4JWN1	Burkholderia_virus	60.6	3.7e-121
WP_061496748.1|3657995_3659765_-|integrase	integrase	integrase	Q6QIE0	Burkholderia_phage	67.8	2.4e-228
WP_061496750.1|3659768_3660677_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.1	5.3e-75
WP_020803508.1|3660686_3660992_-	IclR family transcriptional regulator	NA	Q5ZR02	Pseudomonas_phage	59.0	7.1e-24
WP_045285382.1|3661044_3661233_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	69.4	1.1e-16
WP_054181123.1|3661322_3661688_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_061496751.1|3661808_3662075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061496753.1|3662132_3662903_-	restriction endonuclease subunit M	NA	A2I2Y7	Vibrio_virus	66.5	3.1e-100
WP_071890039.1|3663140_3663713_+	DUF2441 domain-containing protein	NA	NA	NA	NA	NA
WP_061496759.1|3663733_3663991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054622930.1|3664169_3664520_+	hypothetical protein	NA	A4JWP3	Burkholderia_virus	53.9	9.0e-23
WP_061496761.1|3664519_3665257_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.8	1.7e-63
WP_061496762.1|3665246_3665900_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	29.7	4.4e-07
WP_000175096.1|3665896_3666229_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_061494381.1|3666221_3666533_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	61.6	4.0e-30
WP_011410682.1|3666532_3667078_+	DUF3486 domain-containing protein	NA	A4JWJ3	Burkholderia_virus	67.6	1.2e-58
WP_061494380.1|3667074_3668598_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.2	9.9e-183
WP_061494379.1|3668597_3670094_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	61.3	3.7e-174
WP_061494378.1|3670074_3670896_+|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	62.3	1.4e-98
WP_061494377.1|3670898_3671357_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	42.4	3.2e-28
WP_032438842.1|3671571_3672669_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	50.1	2.0e-97
WP_061494376.1|3672682_3673636_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.0	1.9e-62
WP_055311821.1|3673646_3674003_+	DUF2190 domain-containing protein	NA	NA	NA	NA	NA
WP_061494375.1|3674004_3674451_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.0	5.1e-31
WP_023304058.1|3674450_3674915_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	52.3	5.7e-41
WP_061494374.1|3674911_3675166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061494373.1|3675155_3676583_+|tail	phage tail protein	tail	A4JWK5	Burkholderia_virus	78.6	2.0e-217
WP_006687298.1|3676582_3677104_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.8	1.4e-67
WP_061494372.1|3677106_3677388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084225.1|3677486_3677801_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_061494371.1|3677996_3680462_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.4	8.2e-171
WP_061494370.1|3680461_3681346_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	47.0	2.6e-50
WP_006687305.1|3681342_3681558_+|tail	bacteriophage tail fiber protein	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_061494369.1|3681545_3682715_+	Cro/Cl family transcriptional regulator	NA	Q6QIA2	Burkholderia_phage	48.6	3.9e-86
WP_021544460.1|3682714_3683227_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	37.9	2.1e-20
WP_000859115.1|3683281_3683629_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	7.8e-35
WP_061494368.1|3683619_3684723_+|plate	baseplate protein	plate	A4JWL6	Burkholderia_virus	52.7	2.1e-105
WP_061494367.1|3684715_3685294_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.3	1.3e-66
WP_071889942.1|3685296_3686253_+	hypothetical protein	NA	M1TAS6	Escherichia_phage	57.9	1.8e-65
WP_061494365.1|3686252_3686849_+|tail	phage tail protein	tail	A0A218M4J2	Erwinia_phage	54.8	7.0e-60
WP_061494361.1|3687430_3687904_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	62.1	2.1e-43
WP_045285358.1|3687953_3688535_+	DNA-invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.1	7.6e-67
3690168:3690184	attR	CCAGCAGCAGTAACGCG	NA	NA	NA	NA
>prophage 8
NZ_CP012487	Enterobacter sp. FY-07, complete genome	5118646	4491445	4507375	5118646	integrase,transposase	Shigella_phage(20.0%)	12	4487924:4487939	4512071:4512086
4487924:4487939	attL	CCACCTGCGCCCCGGC	NA	NA	NA	NA
WP_000537152.1|4491445_4491730_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_082794149.1|4491726_4492581_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	2.3e-80
WP_061498076.1|4492620_4493046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082794212.1|4493023_4493326_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_061498082.1|4493864_4494689_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.3	7.5e-44
WP_004853352.1|4494721_4494985_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_061498086.1|4495791_4496412_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_061498090.1|4497001_4499974_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.7	2.3e-18
WP_061498095.1|4500083_4501331_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_061498098.1|4502574_4504182_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	41.3	7.6e-101
WP_061498101.1|4504547_4505801_-|integrase	integrase	integrase	B7SYF8	Stenotrophomonas_phage	42.7	4.3e-83
WP_061498105.1|4506163_4507375_+|integrase	integrase	integrase	NA	NA	NA	NA
4512071:4512086	attR	CCACCTGCGCCCCGGC	NA	NA	NA	NA
