The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011769	Lactiplantibacillus plantarum strain Zhang-LL chromosome, complete genome	2952218	529622	538234	2952218		Streptococcus_phage(66.67%)	11	NA	NA
WP_003644909.1|529622_531320_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	37.0	3.9e-55
WP_003640956.1|531341_531650_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_003637790.1|531665_532265_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_003640957.1|532279_532531_+	YaaL family protein	NA	NA	NA	NA	NA
WP_016510978.1|532916_533582_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.7	1.4e-53
WP_003640965.1|533578_533908_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_003640966.1|533924_534944_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	33.5	2.1e-32
WP_003640967.1|534968_535316_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	33.3	2.4e-12
WP_003643942.1|535414_536311_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	55.7	9.9e-82
WP_003640969.1|536314_537100_+	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_015825197.1|537238_538234_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.2	2.6e-51
>prophage 2
NZ_CP011769	Lactiplantibacillus plantarum strain Zhang-LL chromosome, complete genome	2952218	1128159	1138006	2952218		Lactobacillus_phage(87.5%)	9	NA	NA
WP_045351821.1|1128159_1129398_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	96.7	7.9e-215
WP_015825455.1|1129488_1130460_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	99.4	1.8e-182
WP_003643099.1|1130645_1131593_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|1131936_1132551_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_061468263.1|1132553_1134992_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.4	0.0e+00
WP_003643095.1|1135079_1135640_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_045351826.1|1135710_1136151_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
WP_015380221.1|1136246_1136384_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_061468264.1|1137010_1138006_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.5	1.2e-51
>prophage 3
NZ_CP011769	Lactiplantibacillus plantarum strain Zhang-LL chromosome, complete genome	2952218	1983939	2043265	2952218	transposase,tail,integrase,portal,holin,terminase,head,capsid	Lactobacillus_phage(66.67%)	74	2029899:2029920	2043441:2043462
WP_016527163.1|1983939_1984950_-	Abi family protein	NA	A0A0H4U080	Erysipelothrix_phage	26.3	3.3e-25
WP_033611967.1|1985834_1986218_-|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	80.0	9.9e-15
WP_027821934.1|1986204_1986501_-	hypothetical protein	NA	A0A2K9VCD4	Lactobacillus_phage	73.5	2.4e-37
WP_061468441.1|1986501_1987617_-	LysM peptidoglycan-binding domain-containing protein	NA	O03950	Lactobacillus_phage	67.2	3.6e-33
WP_061468311.1|1987642_1987903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468312.1|1987877_1988252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468442.1|1988244_1988598_-	hypothetical protein	NA	D6PSR9	Lactobacillus_phage	49.1	6.7e-26
WP_061468313.1|1989066_1991628_-	SGNH/GDSL hydrolase family protein	NA	A0A2K9VC32	Lactobacillus_phage	47.3	1.2e-07
WP_061468314.1|1991605_1992061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468315.1|1992062_1993169_-|tail	phage tail protein	tail	A0A0B5CYL4	Listeria_phage	34.2	4.7e-41
WP_061468316.1|1993168_1994008_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_061468317.1|1993997_1998881_-	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	61.1	0.0e+00
WP_061468318.1|1998884_1999508_-	hypothetical protein	NA	O03936	Lactobacillus_phage	96.0	1.4e-103
WP_061468319.1|1999513_1999945_-	hypothetical protein	NA	O03935	Lactobacillus_phage	96.5	1.5e-72
WP_061468320.1|1999997_2000513_-	hypothetical protein	NA	O03972	Lactobacillus_phage	87.7	1.1e-77
WP_061468321.1|2000547_2000952_-|capsid	minor capsid protein	capsid	O03934	Lactobacillus_phage	94.8	1.4e-64
WP_061468322.1|2000951_2001293_-|capsid	minor capsid protein	capsid	O03933	Lactobacillus_phage	80.2	6.7e-47
WP_061468323.1|2001292_2001643_-|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	87.1	2.9e-53
WP_061468324.1|2001642_2002071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468325.1|2002097_2003114_-	hypothetical protein	NA	O03966	Lactobacillus_phage	97.3	3.4e-187
WP_061468326.1|2003131_2003746_-	phage scaffolding protein	NA	O03931	Lactobacillus_phage	82.8	6.3e-64
WP_061468327.1|2003891_2004122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468443.1|2006178_2007705_-|portal	phage portal protein	portal	O03928	Lactobacillus_phage	94.5	3.0e-280
WP_061468328.1|2007714_2009058_-|terminase	PBSX family phage terminase large subunit	terminase	O03927	Lactobacillus_phage	97.1	5.5e-262
WP_061468329.1|2009038_2009557_-|terminase	terminase small subunit	terminase	O03926	Lactobacillus_phage	76.2	5.9e-63
WP_041142773.1|2009618_2009918_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1Q1PVT7	Staphylococcus_phage	36.0	2.8e-09
WP_164742638.1|2009880_2010057_-	hypothetical protein	NA	E9LUP6	Lactobacillus_phage	80.9	4.5e-15
WP_061468330.1|2011080_2011698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033611988.1|2011962_2012424_-	transcriptional regulator	NA	D6PSV8	Lactobacillus_phage	56.3	4.1e-39
WP_080444023.1|2012551_2012764_-	hypothetical protein	NA	E9LUP4	Lactobacillus_phage	86.0	1.6e-11
WP_052048925.1|2012756_2012981_-	helix-turn-helix transcriptional regulator	NA	D2IZX1	Enterococcus_phage	37.5	1.4e-05
WP_064505709.1|2013105_2013270_+	YjzC family protein	NA	A0A0A7RTS6	Clostridium_phage	66.0	3.0e-13
WP_061468332.1|2013916_2014435_-	hypothetical protein	NA	O03915	Lactobacillus_phage	52.6	8.6e-38
WP_013355745.1|2014431_2014719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468333.1|2014715_2015648_-	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	44.0	5.1e-57
WP_052748123.1|2015730_2016696_-	hypothetical protein	NA	A6M982	Geobacillus_virus	54.5	5.3e-65
WP_024002536.1|2016707_2017238_-	host-nuclease inhibitor Gam family protein	NA	E9LUU0	Lactobacillus_phage	59.2	6.1e-55
WP_061468334.1|2017739_2018252_-	helix-turn-helix transcriptional regulator	NA	D6PST4	Lactobacillus_phage	42.9	5.2e-27
WP_061468335.1|2018319_2018625_-	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_003642792.1|2018636_2018807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468336.1|2018884_2019088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060417487.1|2019117_2019366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468337.1|2019424_2019646_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	66.2	1.4e-18
WP_061468338.1|2019642_2019843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468339.1|2019839_2020067_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011101778.1|2020195_2020558_+	helix-turn-helix domain-containing protein	NA	A0A2R2ZGJ3	Clostridioides_phage	48.4	1.7e-08
WP_061468340.1|2020569_2020983_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_061468341.1|2021008_2022355_+	DUF4041 domain-containing protein	NA	A0A1B0Y697	Lactobacillus_phage	51.8	1.1e-81
WP_061468342.1|2022405_2023278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080444026.1|2023698_2023875_+	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	51.7	3.3e-10
WP_061468343.1|2024035_2024983_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_121018932.1|2024971_2025747_-|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
WP_061468344.1|2025751_2026729_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_061468345.1|2026739_2027756_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	34.0	2.8e-48
WP_061468346.1|2027913_2029035_+|integrase	site-specific integrase	integrase	D6PSS4	Lactobacillus_phage	32.1	1.1e-45
WP_003642774.1|2029385_2029592_-	hypothetical protein	NA	NA	NA	NA	NA
2029899:2029920	attL	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
WP_061468347.1|2030005_2030317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468348.1|2030399_2030771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468349.1|2030937_2031207_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_061468350.1|2031299_2032826_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.7	3.1e-43
WP_061468351.1|2032822_2033923_-|portal	phage portal protein	portal	A0A2H4J9Q5	uncultured_Caudovirales_phage	34.6	1.4e-48
WP_061468352.1|2033923_2034124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468353.1|2034077_2035781_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	40.7	1.9e-121
WP_061468354.1|2035777_2036251_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_061468355.1|2036864_2037254_-	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	45.2	3.0e-19
WP_061468356.1|2037246_2037585_-|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	35.6	4.6e-08
WP_024971524.1|2037594_2037777_-	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_003645297.1|2037801_2038221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061468357.1|2038364_2039759_-	virulence protein	NA	Q4ZD27	Staphylococcus_phage	35.8	2.7e-70
WP_061468358.1|2039758_2040559_-	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_061468359.1|2040555_2040774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643619.1|2041056_2041236_-	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	89.7	2.5e-21
WP_003643618.1|2041384_2042029_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_061468360.1|2042107_2043265_+|integrase	site-specific integrase	integrase	Q938N9	Temperate_phage	34.8	6.6e-54
2043441:2043462	attR	AGTCAGCCAAAAGGACAGCCAA	NA	NA	NA	NA
>prophage 4
NZ_CP011769	Lactiplantibacillus plantarum strain Zhang-LL chromosome, complete genome	2952218	2246285	2254796	2952218		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2246285_2246864_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_015380733.1|2246856_2247882_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.2e-59
WP_003642591.1|2247878_2249333_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_021356102.1|2249317_2251537_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.1	3.5e-144
WP_011101895.1|2251529_2252210_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2252209_2252464_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_045351673.1|2252465_2253197_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.2e-37
WP_045351670.1|2253199_2254330_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2254313_2254796_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
>prophage 5
NZ_CP011769	Lactiplantibacillus plantarum strain Zhang-LL chromosome, complete genome	2952218	2854279	2918234	2952218	protease,transposase	Lactobacillus_phage(37.5%)	55	NA	NA
WP_045353583.1|2854279_2855455_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_022638265.1|2855862_2856897_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_003643067.1|2857019_2858015_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_022638266.1|2858341_2859364_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011102185.1|2859547_2859916_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003643070.1|2859980_2862272_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	51.7	6.7e-42
WP_003643071.1|2862264_2863221_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_015826115.1|2863254_2864013_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	31.4	4.4e-22
WP_003643073.1|2864036_2864921_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003643563.1|2865059_2865989_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_045353189.1|2866022_2867264_-	MFS transporter	NA	NA	NA	NA	NA
WP_045353191.1|2867265_2868144_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003643077.1|2868161_2869046_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_003643078.1|2869133_2869973_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024971378.1|2870000_2870852_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_003643080.1|2871075_2871981_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061468451.1|2872278_2873472_+	MFS transporter	NA	NA	NA	NA	NA
WP_045353194.1|2873594_2873966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045353197.1|2873958_2874750_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_003643084.1|2874779_2875511_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003645681.1|2875731_2877069_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_061468432.1|2877273_2878176_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_024521987.1|2878172_2879096_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_045353202.1|2879092_2880181_+	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_003642875.1|2880402_2881863_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_045353205.1|2881855_2883730_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_003643570.1|2883854_2884700_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_061468433.1|2886682_2887846_-	putative C-S lyase	NA	NA	NA	NA	NA
WP_045353583.1|2888623_2889799_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_061468434.1|2889906_2890914_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_072535185.1|2891398_2892457_-	zinc-binding dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	24.5	4.4e-12
WP_045353026.1|2892537_2893809_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_003642909.1|2893843_2894140_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_045353024.1|2894187_2894658_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_045353023.1|2894985_2895753_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_045353021.1|2895908_2898299_+	phosphoketolase family protein	NA	NA	NA	NA	NA
WP_045353019.1|2898556_2899438_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_061468453.1|2899687_2900875_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_045353016.1|2901392_2902079_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_045353014.1|2902217_2903423_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003642922.1|2903890_2904262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003642923.1|2904457_2905006_-	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_003643582.1|2905351_2905597_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_045353011.1|2905942_2907397_+	catalase	NA	A0A2K9L572	Tupanvirus	46.7	5.1e-104
WP_003642927.1|2907554_2907992_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_045353439.1|2908347_2909091_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003642929.1|2909083_2910346_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_003643585.1|2910355_2910484_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_003642930.1|2910464_2911061_-	accessory gene regulator AgrB	NA	NA	NA	NA	NA
WP_061468435.1|2911428_2913576_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	38.9	3.7e-119
WP_002816285.1|2913600_2913852_+|transposase	IS3 family transposase	transposase	Q6J1X3	Lactobacillus_phage	96.4	9.2e-38
WP_061468255.1|2913905_2914748_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	99.3	3.9e-157
WP_003642932.1|2915287_2915521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003642933.1|2916149_2917250_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_121018932.1|2917459_2918234_+|transposase	IS5-like element ISLpl3 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	53.2	2.1e-27
