The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013262	Corynebacterium pseudotuberculosis strain MB30, complete genome	2368101	1753768	1831183	2368101	tRNA,protease,bacteriocin,integrase	Agrobacterium_phage(15.38%)	58	1805932:1805959	1811843:1811870
WP_041478401.1|1753768_1756504_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	38.9	8.3e-140
WP_013242455.1|1756670_1757651_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_014367460.1|1758253_1759012_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014367461.1|1759070_1760357_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.8e-132
WP_014523534.1|1760517_1763322_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1763398_1764028_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1764043_1764643_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014524025.1|1764853_1766206_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1766994_1767237_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1767373_1768150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1768236_1769247_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1769364_1769838_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1769904_1770525_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_061409822.1|1770858_1773474_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.5	1.7e-41
WP_151899125.1|1773610_1773916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014523536.1|1773894_1774473_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1774591_1774984_+	globin	NA	NA	NA	NA	NA
WP_013242473.1|1775895_1776504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1776509_1776938_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1777145_1778816_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014367473.1|1779005_1779566_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_014367476.1|1780093_1781848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1781844_1783383_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014523541.1|1783409_1784888_+	nitroreductase	NA	NA	NA	NA	NA
WP_014367479.1|1784884_1787488_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1787487_1788501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1788497_1789478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367482.1|1789516_1789687_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014733038.1|1789760_1791212_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1791233_1791992_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1791988_1792912_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_014367486.1|1793002_1795048_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_096561858.1|1795640_1797926_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014367489.1|1797945_1798146_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014733040.1|1800586_1801582_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014523547.1|1801708_1802512_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1802577_1803237_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014367495.1|1803416_1804244_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1804297_1805488_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1805932:1805959	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_050494099.1|1806106_1806784_+	hypothetical protein	NA	A0A1X9SFC1	Mycobacterium_phage	34.0	5.1e-22
WP_075140840.1|1806897_1807239_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032802512.1|1807689_1808694_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_052399380.1|1808690_1809128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367498.1|1810581_1811139_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.2	4.0e-33
WP_014367502.1|1812182_1813181_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1811843:1811870	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_014655718.1|1813380_1813935_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014800825.1|1813943_1814288_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_013242498.1|1814409_1814685_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1814773_1815253_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1815290_1815944_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013242501.1|1815956_1816346_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014367505.1|1816476_1825575_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1825799_1826105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655722.1|1826265_1827381_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014367508.1|1827377_1828004_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014367509.1|1828047_1829079_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_014524035.1|1829260_1830019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367511.1|1830517_1831183_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP013262	Corynebacterium pseudotuberculosis strain MB30, complete genome	2368101	1985706	1994167	2368101	holin	Pandoravirus(33.33%)	11	NA	NA
WP_014367621.1|1985706_1987455_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.5	4.9e-61
WP_014367622.1|1987432_1988101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367623.1|1988108_1988495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367624.1|1988491_1989007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242641.1|1989017_1989464_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014367625.1|1989460_1989916_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_014655799.1|1989917_1990259_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014523608.1|1990245_1991028_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014367628.1|1991029_1991593_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_088428658.1|1991585_1993541_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.6e-111
WP_014300955.1|1993585_1994167_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
