The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014275	Martelella sp. AD-3, complete genome	4554702	249536	262122	4554702	transposase,capsid,tail,protease,head,portal,terminase	Streptococcus_phage(18.18%)	19	NA	NA
WP_024708552.1|249536_250298_+	hypothetical protein	NA	A0A240F4T8	Ochrobactrum_phage	38.5	5.4e-12
WP_024708553.1|250454_251687_+|portal	phage portal protein	portal	E4ZFM3	Streptococcus_phage	33.7	3.5e-45
WP_081725796.1|251724_252063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024708555.1|252065_252572_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0U2BX10	Paracoccus_phage	40.3	7.1e-21
WP_024708556.1|252568_253723_+|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	31.0	2.4e-40
WP_024708557.1|253734_254115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036237320.1|254149_254380_+	hypothetical protein	NA	I3UM19	Rhodobacter_phage	50.0	2.6e-10
WP_024708559.1|254384_254732_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	47.4	4.9e-13
WP_024708560.1|254742_255234_+	hypothetical protein	NA	A0A076GD25	Sinorhizobium_phage	41.4	1.4e-13
WP_156484712.1|255296_255437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081725793.1|255441_255543_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_152534486.1|255579_256808_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	66.5	2.5e-104
WP_082781115.1|256730_257075_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_024706305.1|257076_257493_+	HK97 gp10 family phage protein	NA	A0A0R8V1F4	Thermobifida_phage	32.8	1.2e-05
WP_024706306.1|257492_257903_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_024706307.1|257899_258229_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_024706308.1|258225_258642_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_036235642.1|258613_260233_+|terminase	terminase large subunit	terminase	A0A1X9I6B3	Streptococcus_phage	35.6	7.7e-85
WP_152534422.1|260406_262122_+	hypothetical protein	NA	A0A291AUM6	Sinorhizobium_phage	39.8	5.2e-63
>prophage 2
NZ_CP014275	Martelella sp. AD-3, complete genome	4554702	1317043	1378368	4554702	transposase,integrase,portal,terminase,tRNA	Sinorhizobium_phage(41.67%)	60	1324614:1324630	1376687:1376703
WP_024705982.1|1317043_1318822_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	34.4	1.1e-95
WP_152534399.1|1319850_1320258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024705980.1|1320268_1320475_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024705979.1|1320591_1321131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024705978.1|1321215_1321824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024705977.1|1321860_1323183_+|portal	phage portal protein	portal	Q9JMM5	Wolbachia_phage	30.7	2.1e-43
WP_024705976.1|1323179_1324991_+	hypothetical protein	NA	NA	NA	NA	NA
1324614:1324630	attL	AAGGGCAAGGGTGATGT	NA	NA	NA	NA
WP_036235351.1|1324990_1325236_+	hypothetical protein	NA	A0A291AUL5	Sinorhizobium_phage	57.9	1.6e-10
WP_024705974.1|1325232_1325553_+	DUF2190 family protein	NA	A0A2I7QRW1	Vibrio_phage	34.3	1.8e-06
WP_024705973.1|1325722_1325977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024705972.1|1325973_1327092_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	35.8	1.1e-50
WP_024707025.1|1328068_1328434_+	NADH-quinone oxidoreductase subunit A	NA	NA	NA	NA	NA
WP_024707024.1|1328424_1329003_+	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_024707023.1|1329018_1329615_+	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_024707022.1|1329625_1330060_+	GFA family protein	NA	NA	NA	NA	NA
WP_024707021.1|1330056_1331247_+	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_024707020.1|1331369_1332332_+	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_024707019.1|1332341_1333640_+	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_024707018.1|1333644_1333944_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_024707017.1|1334029_1336111_+	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_024707016.1|1336121_1337168_+	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_024707015.1|1337208_1337700_+	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_024707014.1|1337838_1338453_+	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_024707013.1|1338495_1338804_+	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_024707012.1|1338811_1340821_+	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_024707011.1|1340820_1342332_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_024707010.1|1342349_1343789_+	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_024707009.1|1343789_1344554_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_024707008.1|1344561_1346235_+	ribonuclease J	NA	NA	NA	NA	NA
WP_061449646.1|1346583_1347456_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024708344.1|1347608_1348391_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_024708343.1|1348390_1348900_+	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_036237186.1|1348914_1350225_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_024708341.1|1350329_1351376_+	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_024708339.1|1351609_1352983_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_024708338.1|1353052_1354438_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024708337.1|1354434_1355580_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_024708336.1|1355633_1356293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061449647.1|1356420_1357617_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.5	5.2e-94
WP_081725905.1|1358602_1359667_+	hypothetical protein	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	24.8	9.8e-12
WP_036238546.1|1359691_1359919_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_024710204.1|1360296_1360563_+	DUF1467 family protein	NA	NA	NA	NA	NA
WP_024710203.1|1360782_1361403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024710202.1|1361971_1363300_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_024710201.1|1363313_1364615_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_152534662.1|1364648_1365323_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.8	8.6e-14
WP_024710198.1|1365842_1366103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024710197.1|1366659_1367952_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_024710196.1|1368070_1368349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152534658.1|1368330_1368942_-	hypothetical protein	NA	A0A291AUJ2	Sinorhizobium_phage	57.8	1.1e-20
WP_152534657.1|1369126_1369507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024710193.1|1369752_1370445_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024710192.1|1371021_1371525_+	hypothetical protein	NA	R9TQJ7	Rhizobium_phage	36.0	2.0e-15
WP_082781087.1|1371505_1372357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036236360.1|1372419_1373133_+	hypothetical protein	NA	A0A291AUT5	Sinorhizobium_phage	69.7	1.6e-90
WP_156484722.1|1373129_1373912_+	hypothetical protein	NA	A0A291AUS8	Sinorhizobium_phage	37.2	2.3e-34
WP_156484723.1|1374901_1375396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024707307.1|1375385_1376138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081725722.1|1376134_1376776_+	hypothetical protein	NA	NA	NA	NA	NA
1376687:1376703	attR	AAGGGCAAGGGTGATGT	NA	NA	NA	NA
WP_061449872.1|1377249_1378368_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP014275	Martelella sp. AD-3, complete genome	4554702	1437387	1450484	4554702	tRNA	uncultured_Mediterranean_phage(81.82%)	13	NA	NA
WP_024709303.1|1437387_1438218_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	35.7	7.6e-36
WP_024709304.1|1438214_1438925_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	42.2	2.2e-36
WP_051424124.1|1438978_1440064_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	30.1	2.5e-10
WP_024709305.1|1440106_1440313_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	70.5	6.7e-10
WP_024709306.1|1440358_1440919_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_024709307.1|1440915_1441746_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	40.9	2.3e-48
WP_024709308.1|1441853_1443137_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.5	9.7e-99
WP_024709309.1|1443146_1443902_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	39.8	3.9e-39
WP_024709310.1|1443918_1444572_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	34.5	7.6e-15
WP_024709311.1|1444738_1446274_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	34.2	3.6e-15
WP_081725845.1|1446309_1447113_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_024709313.1|1447400_1447751_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	34.8	7.9e-11
WP_061449653.1|1447919_1450484_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	47.2	1.3e-62
>prophage 4
NZ_CP014275	Martelella sp. AD-3, complete genome	4554702	1488534	1510562	4554702	capsid	Klebsiella_phage(53.33%)	19	NA	NA
WP_024709819.1|1488534_1489842_-	hypothetical protein	NA	A0A248SL32	Klebsiella_phage	70.2	6.8e-140
WP_024709820.1|1489838_1490270_-	GNAT family N-acetyltransferase	NA	A0A248SLB3	Klebsiella_phage	63.6	7.4e-51
WP_152534633.1|1490349_1491141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152534634.1|1491240_1491789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036238221.1|1491850_1493593_-	hypothetical protein	NA	H2DE51	Erwinia_phage	59.9	1.0e-204
WP_024709824.1|1493592_1493964_-	hypothetical protein	NA	A0A248SL86	Klebsiella_phage	51.7	3.9e-24
WP_024709825.1|1493967_1496385_-	hypothetical protein	NA	G0YQI6	Erwinia_phage	58.5	5.6e-281
WP_024709826.1|1496480_1498823_-	hypothetical protein	NA	H2DE46	Erwinia_phage	44.8	6.7e-29
WP_152534635.1|1498815_1501779_-	cellulase family glycosylhydrolase	NA	A0A248SL44	Klebsiella_phage	38.2	2.7e-152
WP_024709828.1|1501861_1502464_-	hypothetical protein	NA	A0A248SL37	Klebsiella_phage	50.8	1.8e-47
WP_024709829.1|1502463_1503195_-	hypothetical protein	NA	H2DE43	Erwinia_phage	56.2	5.4e-70
WP_024709830.1|1503254_1503896_-	hypothetical protein	NA	A0A248SKU9	Klebsiella_phage	58.3	7.4e-31
WP_024709831.1|1504093_1504546_-	hypothetical protein	NA	A0A248SL88	Klebsiella_phage	58.4	9.5e-41
WP_036238223.1|1504622_1505726_-|capsid	N4-gp56 family major capsid protein	capsid	H2DE40	Erwinia_phage	77.1	8.8e-165
WP_024709832.1|1505920_1506526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152534636.1|1506607_1506781_-	carbon storage regulator	NA	NA	NA	NA	NA
WP_036238237.1|1506804_1507746_-	hypothetical protein	NA	H2DE38	Erwinia_phage	45.2	2.2e-39
WP_051424165.1|1507768_1510138_-	hypothetical protein	NA	H2DE37	Erwinia_phage	65.1	2.7e-264
WP_024709835.1|1510130_1510562_-	hypothetical protein	NA	A0A248SL50	Klebsiella_phage	55.9	4.2e-46
>prophage 5
NZ_CP014275	Martelella sp. AD-3, complete genome	4554702	1518848	1526684	4554702		Klebsiella_phage(22.22%)	12	NA	NA
WP_051424169.1|1518848_1519157_+	hypothetical protein	NA	A0A248SL54	Klebsiella_phage	57.8	1.0e-25
WP_152534637.1|1519442_1520498_+	hypothetical protein	NA	I6NW17	Burkholderia_virus	66.7	3.0e-29
WP_024709843.1|1520487_1521126_+	hypothetical protein	NA	A0A248SL55	Klebsiella_phage	55.3	2.4e-37
WP_024709844.1|1521386_1521668_+	DUF2312 domain-containing protein	NA	A0A0F6R615	Sinorhizobium_phage	77.6	1.0e-29
WP_061449656.1|1521667_1522072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024709846.1|1522068_1523208_+	DNA polymerase III subunit beta	NA	R9TRR6	Rhizobium_phage	36.3	1.4e-45
WP_081725884.1|1523200_1523440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024709848.1|1523436_1524636_+	site-specific DNA-methyltransferase	NA	M4R1Z8	Salicola_phage	41.6	8.3e-60
WP_024709849.1|1524625_1525135_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	60.0	8.1e-49
WP_024709850.1|1525148_1525961_+	hypothetical protein	NA	A0A2I7REB9	Vibrio_phage	39.0	2.0e-12
WP_156484724.1|1525957_1526116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081725885.1|1526294_1526684_+	helix-turn-helix transcriptional regulator	NA	A0A223W054	Agrobacterium_phage	57.6	4.4e-10
>prophage 6
NZ_CP014275	Martelella sp. AD-3, complete genome	4554702	1638327	1723504	4554702	transposase,capsid,tail,head,integrase,terminase,portal,tRNA	Sinorhizobium_phage(40.0%)	79	1655021:1655038	1694154:1694171
WP_152534473.1|1638327_1639332_-|integrase	tyrosine-type recombinase/integrase	integrase	I6NSG1	Burkholderia_phage	59.6	1.7e-111
WP_152534471.1|1640233_1643374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024707195.1|1643364_1643805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024706304.1|1644193_1645720_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_024706303.1|1645709_1646510_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	35.1	8.1e-35
WP_024708357.1|1646616_1646907_-	Pyocin activator protein PrtN	NA	NA	NA	NA	NA
WP_152534544.1|1646903_1647455_-	hypothetical protein	NA	A0A291AUJ2	Sinorhizobium_phage	54.4	1.4e-17
WP_152534543.1|1647461_1647722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036237190.1|1648545_1648740_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_152534542.1|1649095_1649410_+	hypothetical protein	NA	A0A291AUS4	Sinorhizobium_phage	38.1	5.8e-05
WP_152534541.1|1649563_1649980_+	hypothetical protein	NA	K4JV62	Caulobacter_virus	35.2	1.8e-06
WP_081725786.1|1650073_1651117_+	YdaU family protein	NA	A0A076GD06	Sinorhizobium_phage	36.4	4.4e-25
WP_024708349.1|1651100_1651547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024708348.1|1651539_1652271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081725785.1|1652168_1652903_+	hypothetical protein	NA	A0A068C9G5	Rhizobium_phage	29.8	1.2e-08
WP_024708346.1|1653199_1653940_+	hypothetical protein	NA	A0A291AUL1	Sinorhizobium_phage	53.7	6.1e-61
WP_024709062.1|1654087_1654750_+	hypothetical protein	NA	A0A291AUL0	Sinorhizobium_phage	44.7	2.1e-36
WP_024709061.1|1654746_1656813_+|terminase	terminase	terminase	A0A291AUK9	Sinorhizobium_phage	69.0	6.4e-294
1655021:1655038	attL	GCACGCTCGATCTCGACC	NA	NA	NA	NA
WP_152534578.1|1656829_1657063_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_024709059.1|1657059_1658820_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	72.7	3.5e-248
WP_081725828.1|1658843_1659701_+	S49 family peptidase	NA	A0A291AUM2	Sinorhizobium_phage	71.5	5.3e-109
WP_024709057.1|1659727_1660273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024709056.1|1660277_1660634_+|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	63.2	2.2e-32
WP_024709055.1|1660674_1661706_+|capsid	major capsid protein	capsid	A0A291AUL7	Sinorhizobium_phage	74.8	2.3e-151
WP_024709054.1|1661764_1662193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024709053.1|1662189_1662525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024709052.1|1662524_1662989_+	hypothetical protein	NA	A0A291AUM4	Sinorhizobium_phage	51.0	1.1e-39
WP_152534577.1|1663001_1663253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024709050.1|1663281_1663698_+	hypothetical protein	NA	A0A291AUM5	Sinorhizobium_phage	50.4	2.6e-29
WP_152534579.1|1663975_1664332_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_024709047.1|1664328_1666251_+	hypothetical protein	NA	A0A291AUM6	Sinorhizobium_phage	33.1	1.4e-56
WP_024709046.1|1666250_1666598_+	hypothetical protein	NA	A0A1B1IV54	uncultured_Mediterranean_phage	36.8	1.6e-11
WP_024709045.1|1666594_1666963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024709044.1|1666959_1667715_+|tail	phage minor tail protein L	tail	L7TNY8	Rhizobium_phage	44.1	4.0e-52
WP_024709043.1|1667728_1668424_+	hypothetical protein	NA	L7TLZ5	Rhizobium_phage	37.3	1.2e-39
WP_024709042.1|1668411_1668672_-	HicB family protein	NA	A0A0D4DCG1	Acinetobacter_phage	42.6	4.8e-05
WP_081725826.1|1668668_1669022_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_024709040.1|1669071_1669368_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_024709039.1|1669385_1669667_-	Killer protein	NA	NA	NA	NA	NA
WP_024709038.1|1669759_1670356_+|tail	tail assembly protein	tail	L7TS77	Rhizobium_phage	39.7	4.3e-25
WP_061449659.1|1670374_1673572_+	host specificity protein J	NA	W6E8G0	Rhizobium_phage	41.8	2.3e-165
WP_024708615.1|1673568_1674423_+	hypothetical protein	NA	W6EKG4	Rhizobium_phage	47.1	1.7e-11
WP_024708616.1|1674422_1675067_+	DUF4376 domain-containing protein	NA	A0A2L0V114	Agrobacterium_phage	68.7	1.3e-38
WP_024708617.1|1675071_1675338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024708618.1|1675341_1676466_+	hypothetical protein	NA	G8GWG3	Rhodobacter_phage	30.3	2.9e-14
WP_024708619.1|1676458_1676815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024708620.1|1676854_1677214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024708621.1|1677336_1678281_+	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_024708622.1|1678280_1678700_+	hypothetical protein	NA	A0A1X9HVL7	Ruegeria_phage	47.4	7.0e-30
WP_024708623.1|1678712_1679036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152534554.1|1679154_1680177_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.0	2.2e-21
WP_152534477.1|1680281_1681633_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_156484726.1|1681891_1682038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024708114.1|1682791_1683616_+	DNA methyltransferase	NA	A0A291AUP9	Sinorhizobium_phage	78.8	1.1e-116
WP_024708115.1|1683644_1684718_-|integrase	site-specific integrase	integrase	I6NSG1	Burkholderia_phage	55.8	5.6e-116
WP_051424059.1|1684813_1685833_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_024708117.1|1686226_1688881_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	35.2	2.0e-74
WP_024708118.1|1689044_1690127_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.1	3.7e-115
WP_024708119.1|1690285_1691941_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.9	8.6e-39
WP_024708120.1|1692107_1692962_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_024708121.1|1692968_1693826_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024708122.1|1694098_1695031_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
1694154:1694171	attR	GCACGCTCGATCTCGACC	NA	NA	NA	NA
WP_024708123.1|1695094_1696618_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024708124.1|1696651_1697611_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024708125.1|1697610_1698450_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024708126.1|1698446_1700195_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	4.0e-18
WP_024708127.1|1700194_1701208_+	serine hydrolase	NA	NA	NA	NA	NA
WP_024708128.1|1701207_1702335_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_024708129.1|1702406_1702820_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_152534525.1|1703202_1703874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024708131.1|1703920_1705855_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_024708132.1|1706061_1706499_-	DedA family protein	NA	NA	NA	NA	NA
WP_082781118.1|1707304_1714018_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_024707977.1|1714103_1714892_+	HXXEE domain-containing protein	NA	NA	NA	NA	NA
WP_152534515.1|1714896_1717422_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_024707975.1|1717753_1718494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024707974.1|1718804_1719473_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_024707973.1|1719625_1720375_+	DUF2497 domain-containing protein	NA	NA	NA	NA	NA
WP_024707972.1|1720591_1723504_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.6	7.3e-134
>prophage 7
NZ_CP014275	Martelella sp. AD-3, complete genome	4554702	2097653	2106989	4554702		uncultured_Mediterranean_phage(66.67%)	7	NA	NA
WP_024707855.1|2097653_2098154_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	51.2	1.3e-35
WP_024707854.1|2098277_2098856_-	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	57.3	8.1e-45
WP_024707853.1|2098893_2099388_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.9	1.5e-26
WP_024707852.1|2099519_2102318_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.5	4.9e-103
WP_024707851.1|2102551_2103196_+	MarC family protein	NA	NA	NA	NA	NA
WP_024707850.1|2103304_2103820_-	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	74.6	1.1e-45
WP_024707849.1|2104067_2106989_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	61.2	0.0e+00
>prophage 8
NZ_CP014275	Martelella sp. AD-3, complete genome	4554702	2179759	2188009	4554702	protease	Bacillus_phage(33.33%)	6	NA	NA
WP_018066007.1|2179759_2180035_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	55.7	7.6e-17
WP_024709590.1|2180245_2182663_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	48.1	1.5e-193
WP_024709589.1|2182904_2184182_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.6	7.1e-134
WP_024709588.1|2184528_2185155_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.7	4.2e-63
WP_081725863.1|2185364_2186630_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	2.8e-13
WP_024709586.1|2186725_2188009_-	O-acetylhomoserine aminocarboxypropyltransferase	NA	A0A0B5JD48	Pandoravirus	27.5	8.7e-15
>prophage 9
NZ_CP014275	Martelella sp. AD-3, complete genome	4554702	2325739	2390618	4554702	transposase,capsid,head,tail,integrase,portal,terminase	Sinorhizobium_phage(40.0%)	77	2346030:2346077	2392608:2392655
WP_061449609.1|2325739_2326936_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	46.1	1.8e-94
WP_152534610.1|2327160_2327541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152534611.1|2327537_2328131_+	hypothetical protein	NA	A0A068C9C1	Rhizobium_phage	34.6	6.4e-13
WP_036238014.1|2328172_2328418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024709484.1|2328392_2329574_+	hypothetical protein	NA	F8TUV0	EBPR_podovirus	26.4	2.0e-18
WP_024709485.1|2329874_2330789_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_036238006.1|2330825_2331572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024709488.1|2331691_2332918_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_081725859.1|2333437_2334061_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024709490.1|2334099_2334585_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_024709491.1|2334581_2334965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024709492.1|2335030_2336050_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_024709493.1|2336105_2336729_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024709494.1|2337378_2337870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024709495.1|2337896_2338751_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024709496.1|2338747_2339680_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024709497.1|2339676_2341335_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	2.4e-17
WP_051424137.1|2341344_2342904_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024709499.1|2343016_2343898_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_024709500.1|2344038_2344995_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_152534612.1|2345345_2345546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024709502.1|2345542_2345896_+	glyoxalase	NA	NA	NA	NA	NA
2346030:2346077	attL	TGGCGACCCCTGCAGGATTCGAACCTGCGACCGTCGGCTTAGAAGGCC	NA	NA	NA	NA
WP_024709503.1|2346498_2347542_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.3	6.4e-24
WP_024709504.1|2347531_2348200_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024709505.1|2348386_2349175_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024708623.1|2350004_2350328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024709506.1|2350340_2350760_-	hypothetical protein	NA	A0A1X9HVL7	Ruegeria_phage	46.7	7.0e-30
WP_024709507.1|2350759_2351704_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_024709508.1|2351765_2352122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024709509.1|2352118_2353234_-	hypothetical protein	NA	G8GWG3	Rhodobacter_phage	32.5	4.0e-16
WP_024709510.1|2353223_2353583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024709511.1|2353587_2354235_-	DUF4376 domain-containing protein	NA	A0A2L0V114	Agrobacterium_phage	68.7	5.2e-40
WP_061449676.1|2354234_2355092_-	hypothetical protein	NA	W6EKG4	Rhizobium_phage	45.9	3.9e-11
WP_051424145.1|2355088_2358286_-	host specificity protein J	NA	W6E8G0	Rhizobium_phage	42.2	6.5e-168
WP_024709686.1|2358304_2358901_-|tail	tail assembly protein	tail	L7TS77	Rhizobium_phage	41.3	1.1e-23
WP_024709685.1|2358992_2359175_+	addiction module toxin, HicA family	NA	A0A0R6PJD4	Moraxella_phage	57.9	4.5e-10
WP_024709684.1|2359190_2359583_+	CopG family transcriptional regulator	NA	A0A0R6PJ17	Moraxella_phage	33.6	3.7e-09
WP_024709683.1|2359798_2360095_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_152534623.1|2360144_2360324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156484729.1|2361350_2361497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024709680.1|2361474_2362191_-	hypothetical protein	NA	L7TLZ5	Rhizobium_phage	36.9	1.1e-40
WP_024709679.1|2362204_2362960_-|tail	phage minor tail protein L	tail	L7TNY8	Rhizobium_phage	44.1	4.0e-52
WP_024709678.1|2362956_2363325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024709677.1|2363321_2363669_-	hypothetical protein	NA	A0A1B1IV54	uncultured_Mediterranean_phage	36.8	3.5e-11
WP_024709676.1|2363668_2365591_-	hypothetical protein	NA	A0A291AUM6	Sinorhizobium_phage	36.3	2.9e-54
WP_152534624.1|2365587_2365944_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_024709673.1|2366221_2366638_-	hypothetical protein	NA	A0A291AUM5	Sinorhizobium_phage	51.8	6.9e-30
WP_024709672.1|2366666_2366918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024709671.1|2367053_2367863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024709670.1|2367893_2368358_-	hypothetical protein	NA	A0A291AUM4	Sinorhizobium_phage	49.7	3.5e-38
WP_036238117.1|2368357_2368693_-	hypothetical protein	NA	A0A291AUL9	Sinorhizobium_phage	57.9	1.3e-23
WP_024709668.1|2368689_2369118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024709667.1|2369176_2370208_-|capsid	phage capsid protein	capsid	A0A291AUL7	Sinorhizobium_phage	74.5	4.0e-151
WP_024709666.1|2370249_2370606_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	64.1	7.5e-33
WP_024709665.1|2370611_2371157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081725871.1|2371182_2372040_-	S49 family peptidase	NA	A0A291AUM2	Sinorhizobium_phage	71.8	2.2e-110
WP_024709663.1|2372063_2373839_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	71.6	7.3e-246
WP_152534622.1|2373835_2374069_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_024709661.1|2374087_2376163_-|terminase	terminase	terminase	A0A291AUK9	Sinorhizobium_phage	68.9	1.9e-293
WP_024709660.1|2376159_2376822_-	hypothetical protein	NA	A0A291AUL0	Sinorhizobium_phage	44.5	9.3e-37
WP_061449872.1|2377039_2378158_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_024706384.1|2378516_2379257_-	hypothetical protein	NA	A0A291AUL1	Sinorhizobium_phage	53.3	6.1e-61
WP_024706383.1|2379555_2380191_-	hypothetical protein	NA	A0A068C9G5	Rhizobium_phage	30.2	4.6e-09
WP_024706382.1|2380187_2380919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024706381.1|2380911_2381358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024706380.1|2381341_2382175_-	YdaU family protein	NA	A0A076GD06	Sinorhizobium_phage	45.2	3.8e-27
WP_024706379.1|2382264_2382510_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_024706378.1|2382516_2382867_+	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	30.1	1.7e-05
WP_152534428.1|2382938_2383220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152534427.1|2383216_2383786_-	hypothetical protein	NA	K4JV62	Caulobacter_virus	32.5	1.2e-05
WP_024706375.1|2383787_2384270_-	hypothetical protein	NA	A0A291AUS4	Sinorhizobium_phage	33.1	7.8e-09
WP_024706373.1|2384776_2385397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024706372.1|2385880_2386423_+	hypothetical protein	NA	A0A291AUJ2	Sinorhizobium_phage	54.4	2.7e-18
WP_152534426.1|2386425_2386668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024706371.1|2386645_2387716_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A141GEZ3	Brucella_phage	35.0	1.6e-54
WP_081725655.1|2387780_2389238_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_152534486.1|2389390_2390618_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	66.5	2.5e-104
2392608:2392655	attR	TGGCGACCCCTGCAGGATTCGAACCTGCGACCGTCGGCTTAGAAGGCC	NA	NA	NA	NA
>prophage 10
NZ_CP014275	Martelella sp. AD-3, complete genome	4554702	2610492	2621694	4554702	head,protease,capsid,tail	Paracoccus_phage(28.57%)	13	NA	NA
WP_024706490.1|2610492_2614341_-	hypothetical protein	NA	A0A0K1Y6G6	Rhodobacter_phage	38.6	8.5e-207
WP_024706491.1|2614554_2614989_-	peptidase P60	NA	A0A1V0DYB6	Dinoroseobacter_phage	46.3	5.5e-30
WP_024706492.1|2614985_2615876_-	DUF2163 domain-containing protein	NA	A0A0B5A5B8	Paracoccus_phage	38.3	4.0e-51
WP_024706493.1|2615872_2616514_-	DUF2460 domain-containing protein	NA	A0A0B5A2K3	Paracoccus_phage	48.3	1.3e-48
WP_024706494.1|2616729_2617314_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	38.7	1.6e-11
WP_081725665.1|2617313_2617484_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_024706495.1|2617540_2617921_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_024706496.1|2617917_2618328_-|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_024706497.1|2618362_2618770_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_036235844.1|2618766_2619096_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_024706499.1|2619095_2619662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036235849.1|2619737_2620967_-|capsid	phage major capsid protein	capsid	Q3HQT0	Burkholderia_phage	42.2	2.2e-79
WP_024706501.1|2621007_2621694_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PKF0	Moraxella_phage	44.1	6.1e-31
>prophage 11
NZ_CP014275	Martelella sp. AD-3, complete genome	4554702	3936426	3989531	4554702	transposase	Lactococcus_phage(40.0%)	40	NA	NA
WP_156484717.1|3936426_3937777_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024708725.1|3938702_3939359_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_024708723.1|3940236_3942777_-	helicase	NA	NA	NA	NA	NA
WP_024708722.1|3942776_3944579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036237462.1|3944590_3945793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061449813.1|3945792_3948999_-	AAA family ATPase	NA	A0A172PZX3	Pseudomonas_phage	33.9	6.4e-06
WP_051424041.1|3948995_3951503_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_024707691.1|3951606_3951996_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_024707692.1|3951992_3952346_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_036236820.1|3953449_3954220_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.0	1.8e-31
WP_024707693.1|3954209_3955745_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_024707382.1|3957434_3958931_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_024707381.1|3958927_3959686_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	40.1	2.5e-41
WP_024706843.1|3960325_3961777_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024706842.1|3961901_3962735_-	3-(cis-5,6-dihydroxycyclohexa-1, 3-dien-1-yl)propanoate dehydrogenase	NA	NA	NA	NA	NA
WP_024706841.1|3962766_3963072_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_024706840.1|3963082_3963640_-	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_036236102.1|3963724_3965089_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	S4S2K9	Puniceispirillum_phage	39.0	3.9e-05
WP_024706838.1|3965270_3966242_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_024706837.1|3966326_3968267_+	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_024706836.1|3968326_3969037_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_024706835.1|3969033_3969681_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_024706834.1|3969747_3970992_+	CoA transferase	NA	NA	NA	NA	NA
WP_024706833.1|3970988_3971945_+	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_024706832.1|3971973_3973218_+	cytochrome P450	NA	NA	NA	NA	NA
WP_024706831.1|3973311_3974169_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_081725685.1|3974229_3974622_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024706829.1|3974942_3975257_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_081725684.1|3975911_3976307_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_024706827.1|3976303_3978667_-	transketolase	NA	NA	NA	NA	NA
WP_024706826.1|3978795_3979260_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_024706825.1|3980107_3981172_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_024706824.1|3981249_3982245_+	aldolase	NA	NA	NA	NA	NA
WP_024706823.1|3982241_3982838_+	2-hydroxychromene-2-carboxylate isomerase	NA	NA	NA	NA	NA
WP_024706822.1|3982871_3983777_+	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_024706821.1|3983877_3985083_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_081725682.1|3985159_3985822_+	OmpW family protein	NA	NA	NA	NA	NA
WP_024706819.1|3985890_3986490_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_024706818.1|3987034_3988288_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_152534486.1|3988303_3989531_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	66.5	2.5e-104
>prophage 12
NZ_CP014275	Martelella sp. AD-3, complete genome	4554702	4250452	4283782	4554702	holin,protease,tRNA	Planktothrix_phage(40.0%)	35	NA	NA
WP_024709114.1|4250452_4250890_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_024709115.1|4250893_4251544_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
WP_024709116.1|4251695_4252694_-	type I pantothenate kinase	NA	NA	NA	NA	NA
WP_024709117.1|4252690_4253014_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_024709118.1|4253030_4253813_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_024709119.1|4253809_4254544_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_024709120.1|4254582_4255233_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_024709121.1|4255244_4255697_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_024709122.1|4255707_4256316_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_024709123.1|4256549_4257044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024709124.1|4257040_4257481_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024709125.1|4257580_4258138_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_024709126.1|4258127_4258628_+	acetyltransferase	NA	NA	NA	NA	NA
WP_024709127.1|4258641_4259949_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	32.2	5.9e-43
WP_152534584.1|4260146_4260890_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_024709129.1|4261826_4263653_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_061449827.1|4263723_4264287_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024706705.1|4264336_4264861_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_051423985.1|4264941_4265295_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_024706707.1|4265371_4266229_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_024706708.1|4266230_4267751_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_024706709.1|4267747_4268719_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_061449828.1|4268874_4269777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152534626.1|4269844_4270405_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_024709707.1|4270812_4272408_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024709708.1|4272476_4273484_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024709709.1|4273494_4274403_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024709710.1|4274407_4275253_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	8.6e-19
WP_024709711.1|4275249_4276095_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	2.0e-20
WP_024709712.1|4276161_4277826_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	5.7e-59
WP_036238159.1|4278050_4279508_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_024709714.1|4279557_4281075_-|holin	choline-sulfatase	holin	A0A1V0SA98	Catovirus	25.0	1.7e-17
WP_152534627.1|4281071_4281647_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_024709716.1|4281855_4282794_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_024709717.1|4282939_4283782_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
>prophage 13
NZ_CP014275	Martelella sp. AD-3, complete genome	4554702	4499068	4507937	4554702		Mycobacterium_phage(33.33%)	8	NA	NA
WP_024706755.1|4499068_4500994_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	53.6	7.1e-154
WP_024706754.1|4501085_4502228_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	28.3	5.5e-29
WP_024706753.1|4502519_4503644_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_036236057.1|4503652_4503856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024706751.1|4503988_4504966_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.6	4.4e-136
WP_036236053.1|4504983_4507149_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	53.5	8.2e-215
WP_024706749.1|4507193_4507595_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J6X7	uncultured_Caudovirales_phage	45.7	2.5e-16
WP_024706748.1|4507715_4507937_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	58.3	5.5e-18
