The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014522	Escherichia coli strain ZH063 chromosome, complete genome	5033359	824140	834020	5033359	portal,tail,capsid,terminase,protease,head	uncultured_Caudovirales_phage(88.89%)	14	NA	NA
WP_001576610.1|824140_825802_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.5	8.0e-279
WP_000113645.1|825785_826142_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_122992961.1|826261_826447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021546404.1|826430_826871_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	76.7	3.1e-65
WP_021523998.1|826870_827167_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	76.5	1.2e-39
WP_021523996.1|827163_827502_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	58.0	6.0e-32
WP_024189239.1|827498_828713_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	78.3	8.1e-188
WP_021523994.1|828714_829290_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	4.3e-62
WP_061363746.1|829325_830495_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	70.8	2.4e-152
WP_021546406.1|830778_831039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021546407.1|831029_831287_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_033808662.1|831297_831708_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000557476.1|831704_831983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061363747.1|832271_834020_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.2	2.1e-91
>prophage 2
NZ_CP014522	Escherichia coli strain ZH063 chromosome, complete genome	5033359	945104	1058675	5033359	transposase,holin,tail,capsid,tRNA,plate,integrase,protease	Burkholderia_virus(29.03%)	112	981897:981911	1051551:1051565
WP_000520781.1|945104_945425_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|945455_947732_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001576618.1|948528_949122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576620.1|949123_949738_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	41.1	1.3e-24
WP_001576621.1|949739_950267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576623.1|950507_950786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106376849.1|950782_951127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576626.1|951399_951591_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_073970534.1|952729_953698_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.7e-180
WP_001040187.1|954796_955015_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|955299_956004_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|956045_957767_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|957767_959534_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|959656_960622_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|961165_961660_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|961794_965901_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|966059_966671_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|966681_968025_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|968115_969408_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850306.1|969646_972091_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|972101_972719_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|972720_973584_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|973619_974246_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|974559_975708_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|975804_976545_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|976736_979019_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|979073_979931_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|980336_982097_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
981897:981911	attL	CGCTTTTTTGGTTGC	NA	NA	NA	NA
WP_000642852.1|982226_982919_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|983117_984206_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|984276_985560_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001385260.1|985729_986494_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|986666_987350_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|987460_989134_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|989293_989578_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705731.1|989783_992048_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|992084_993833_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000570547.1|993829_994816_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056492.1|994852_996085_+	YcaQ family DNA glycosylase	NA	NA	NA	NA	NA
WP_000350057.1|996136_996319_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011610.1|996315_997062_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436917.1|997215_998109_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|998085_998865_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001295930.1|999000_999786_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288856.1|999782_1001105_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295931.1|1001085_1001790_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572654.1|1001789_1006250_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925990.1|1006510_1008358_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|1008538_1009087_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109456.1|1009113_1009761_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|1009810_1011001_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977908.1|1011185_1012274_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	2.8e-99
WP_000117888.1|1012876_1014277_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
WP_001295933.1|1014445_1015648_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193867.1|1015913_1018526_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_001576683.1|1018909_1019482_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.6	7.9e-85
WP_024188925.1|1019553_1020057_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	48.6	1.0e-35
WP_024187909.1|1020085_1020541_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	6.8e-31
WP_001576687.1|1020547_1021162_-|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	2.3e-61
WP_072275200.1|1021161_1023093_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.8	4.1e-40
WP_000138756.1|1023095_1023674_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001576690.1|1023666_1024770_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	6.4e-107
WP_000859111.1|1024760_1025108_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148267.1|1025162_1025759_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	1.4e-36
WP_061363748.1|1025755_1026910_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.3	3.2e-85
WP_000478224.1|1026897_1027110_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|1027109_1027994_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_059320006.1|1027993_1031206_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.0	1.2e-81
WP_001202894.1|1031281_1031440_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|1031363_1031699_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001513983.1|1031796_1032078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162832341.1|1032080_1032605_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000729834.1|1032601_1034029_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000666499.1|1034018_1034270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|1034269_1034734_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|1034733_1035180_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|1035181_1035520_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|1035529_1036483_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|1036497_1037613_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001576693.1|1037827_1038286_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.2	3.4e-30
WP_000117560.1|1038288_1039110_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	1.2e-97
WP_001576694.1|1039090_1040587_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	2.6e-167
WP_001576695.1|1040586_1042110_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.7	6.2e-185
WP_000533684.1|1042106_1042649_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
WP_000227704.1|1042651_1042963_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_000175097.1|1042962_1043289_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_001299256.1|1043285_1043897_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	34.2	6.9e-10
WP_001104438.1|1043925_1044663_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
WP_000793145.1|1044665_1045016_-|holin	putative holin	holin	A4JWP3	Burkholderia_virus	53.9	9.0e-23
WP_000194949.1|1045146_1045890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573938.1|1045865_1046267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069609.1|1046268_1046484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573937.1|1046675_1047440_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	4.0e-100
WP_032143164.1|1047556_1047895_-	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	34.4	3.7e-05
WP_000123378.1|1047995_1048184_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047758.1|1048236_1048545_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
WP_000533819.1|1048555_1049467_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	55.3	2.0e-74
WP_001529009.1|1049470_1051240_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.7	1.6e-229
WP_000960680.1|1051250_1052417_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
1051551:1051565	attR	GCAACCAAAAAAGCG	NA	NA	NA	NA
WP_001576698.1|1052419_1052689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001576700.1|1052716_1053247_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|1053535_1053808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|1053817_1054114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763553.1|1054128_1054344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001576702.1|1054340_1055024_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.5	3.8e-33
WP_000631813.1|1055020_1055251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|1055240_1055447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001576703.1|1055448_1055898_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	1.4e-23
WP_001576704.1|1055869_1056268_+	hypothetical protein	NA	Q6QIE8	Burkholderia_phage	55.9	1.0e-30
WP_000460689.1|1056382_1057015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001571575.1|1057018_1057180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023363144.1|1057883_1058675_-	aliphatic sulfonate ABC transporter permease SsuC	NA	G3M9Y4	Bacillus_virus	24.5	1.4e-15
>prophage 3
NZ_CP014522	Escherichia coli strain ZH063 chromosome, complete genome	5033359	1226566	1292507	5033359	portal,holin,lysis,tail,capsid,tRNA,terminase,integrase,head	Enterobacteria_phage(40.68%)	87	1246369:1246408	1285393:1285432
WP_001576717.1|1226566_1227685_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	7.7e-84
WP_000003742.1|1227653_1227923_-	excisionase	NA	NA	NA	NA	NA
WP_001576719.1|1227984_1230426_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_001070255.1|1230519_1230711_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854564.1|1230707_1230896_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171946.1|1231464_1231683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1231842_1231998_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000362155.1|1232263_1232683_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|1232783_1233065_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693837.1|1233048_1233474_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262379.1|1233545_1234610_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	7.9e-62
WP_001151225.1|1234650_1235073_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.3e-64
WP_000403785.1|1235130_1235487_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|1235580_1235763_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753059.1|1235755_1235932_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	9.7e-26
WP_000813254.1|1236853_1237009_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001429486.1|1237467_1237746_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_001265034.1|1237747_1238797_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.9e-109
WP_000904092.1|1238809_1239166_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	1.8e-34
WP_000762890.1|1239180_1240002_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
WP_000562553.1|1240894_1241026_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000871291.1|1241306_1241642_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|1241902_1242091_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001327246.1|1242087_1242249_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	2.0e-14
WP_000372595.1|1242398_1242614_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193296.1|1242618_1242963_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	92.9	7.0e-36
WP_000370546.1|1242928_1243201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992105.1|1243306_1243840_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_001327248.1|1243836_1244304_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	89.7	5.0e-69
WP_001139682.1|1244291_1244444_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001059340.1|1244646_1245171_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	93.6	2.9e-86
WP_001537735.1|1245473_1245884_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_000105081.1|1245941_1246175_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	4.3e-21
1246369:1246408	attL	GTTACGGGGCGGCGACCTCGCGGGTTTTCGCTATTTATGA	NA	NA	NA	NA
WP_001576724.1|1246568_1247078_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	3.6e-12
WP_001576726.1|1247049_1248978_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_000258993.1|1248961_1249168_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|1249164_1250757_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001576727.1|1250746_1252252_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256835.1|1252288_1252636_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_000522583.1|1252693_1253722_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	8.6e-114
WP_000201498.1|1253773_1254157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204571.1|1254149_1254503_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000974995.1|1254518_1255052_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.1	1.2e-55
WP_000683079.1|1255048_1255444_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235037.1|1255451_1256198_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_001299690.1|1256216_1256648_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533402.1|1256674_1257088_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082402.1|1257068_1259630_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.0	0.0e+00
WP_000847298.1|1259626_1259956_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001327694.1|1259955_1260654_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_001576728.1|1260659_1261403_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	8.3e-143
WP_072258937.1|1261348_1261981_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	92.3	1.7e-96
WP_000514735.1|1262324_1266017_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_001228261.1|1266084_1266684_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_000216560.1|1266835_1268899_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	3.7e-148
WP_001204582.1|1268895_1269174_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_000355700.1|1269183_1269477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586406.1|1269516_1269615_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000742376.1|1269669_1270326_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937496.1|1270394_1270661_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_000799406.1|1270892_1271756_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1271739_1272876_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1273125_1274352_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1274400_1275522_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085269.1|1275770_1277000_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	1.1e-131
WP_000953274.1|1277365_1277554_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	1.5e-13
WP_001617541.1|1277606_1278893_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000076671.1|1278889_1279120_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_001372127.1|1279109_1279331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204077.1|1279323_1279545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204962.1|1279546_1279780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770152.1|1279785_1280085_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761835.1|1280081_1281836_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.3	9.2e-92
WP_001260558.1|1282124_1282382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126698.1|1282378_1282789_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233305.1|1282799_1283048_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000796960.1|1283302_1283509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000216279.1|1283508_1284564_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.6	1.3e-69
WP_000380877.1|1284575_1284911_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224596.1|1284923_1285337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000565609.1|1285499_1285934_+	hypothetical protein	NA	NA	NA	NA	NA
1285393:1285432	attR	GTTACGGGGCGGCGACCTCGCGGGTTTTCGCTATTTATGA	NA	NA	NA	NA
WP_000133413.1|1286213_1286495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735412.1|1287049_1288510_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1288509_1289181_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423736.1|1289349_1290720_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.9e-107
WP_001295971.1|1290723_1291365_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001295972.1|1291400_1292507_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP014522	Escherichia coli strain ZH063 chromosome, complete genome	5033359	1903476	1997038	5033359	portal,transposase,holin,tail,capsid,tRNA,terminase,protease,head	Enterobacteria_phage(35.48%)	105	NA	NA
WP_000984517.1|1903476_1904358_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055794.1|1904549_1906598_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431388.1|1906617_1907316_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001029106.1|1907412_1907910_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001531756.1|1908039_1909323_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001298452.1|1909291_1911925_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001296139.1|1912004_1913444_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|1913560_1913797_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|1913901_1914093_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812745.1|1914093_1914750_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	2.3e-56
WP_000976472.1|1915144_1915486_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879317.1|1915498_1916371_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|1916374_1916749_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1916887_1917118_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011664.1|1917219_1917876_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1917899_1918562_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000024724.1|1920826_1921486_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|1921812_1922169_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|1922235_1922526_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_000173466.1|1922659_1923838_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800503.1|1923893_1924535_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069461.1|1924571_1926383_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|1926617_1928093_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056695.1|1928430_1929300_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091149.1|1929427_1930870_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_001296141.1|1931001_1931973_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|1932091_1933414_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001347089.1|1933429_1934362_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1934440_1935196_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571478.1|1935192_1935978_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_099156434.1|1936171_1937520_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000568520.1|1937629_1938640_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1938648_1939260_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|1939398_1939464_-	stress response small protein YobI	NA	NA	NA	NA	NA
WP_001024911.1|1939534_1940137_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1940138_1940660_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|1940694_1941435_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|1941463_1941916_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|1941908_1943681_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|1943990_1944557_+	hydrolase	NA	NA	NA	NA	NA
WP_001217553.1|1944911_1945160_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_001555069.1|1945417_1945711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204581.1|1945720_1945999_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_021566403.1|1945995_1948062_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	6.9e-147
WP_001513563.1|1948126_1948726_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.5	1.8e-108
WP_021516998.1|1948793_1952492_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	74.7	0.0e+00
WP_021516997.1|1952552_1953200_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.7	1.3e-112
WP_000194743.1|1953097_1953841_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_001152453.1|1953845_1954544_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	8.1e-132
WP_001115183.1|1954543_1954885_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	7.1e-41
WP_061363754.1|1954877_1958105_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	94.6	0.0e+00
WP_000978930.1|1958151_1958430_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.8	3.6e-43
WP_000164661.1|1958453_1958825_-|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000097528.1|1958839_1959544_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	2.8e-116
WP_001206699.1|1959603_1959948_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.8e-55
WP_023910305.1|1959944_1960394_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.9	2.7e-64
WP_001147816.1|1960390_1960729_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	89.3	1.7e-50
WP_000719066.1|1960737_1961055_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766109.1|1961131_1962349_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|1962363_1962963_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923132.1|1962955_1964182_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	1.5e-202
WP_000811487.1|1964171_1964333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140907.1|1964329_1966087_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_001330091.1|1966086_1966569_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	2.5e-84
WP_001111090.1|1966716_1967067_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
WP_000351660.1|1967205_1967745_+	YfbU family protein	NA	NA	NA	NA	NA
WP_001100260.1|1967750_1968017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001228685.1|1968234_1968420_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000992100.1|1968636_1969170_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_000193282.1|1969220_1969565_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.8e-36
WP_000839572.1|1969569_1969785_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000024332.1|1970526_1971576_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.4	4.1e-188
WP_000917767.1|1971727_1971925_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_001204806.1|1972140_1972521_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	100.0	4.9e-67
WP_021517452.1|1972538_1973528_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	1.1e-193
WP_021517453.1|1973580_1973838_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	68.8	6.2e-21
WP_000203849.1|1973834_1975235_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.0	1.4e-244
WP_000988266.1|1975231_1976131_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
WP_000092416.1|1976141_1977134_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.4	4.6e-56
WP_000618007.1|1977426_1977651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000626793.1|1977647_1977842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587264.1|1977838_1978687_-	Rha family phage regulatory protein	NA	A5LH69	Enterobacteria_phage	65.4	3.8e-91
WP_001090258.1|1978795_1979503_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	91.1	3.9e-118
WP_000838344.1|1979838_1980495_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	97.7	3.1e-125
WP_001538850.1|1980598_1981015_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	93.5	4.6e-66
WP_000606214.1|1981183_1981411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001436867.1|1981749_1981956_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	97.1	6.9e-31
WP_001538853.1|1982151_1982511_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	73.6	3.2e-39
WP_000002321.1|1982510_1982726_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	63.4	1.2e-17
WP_001538854.1|1982912_1983305_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	57.1	1.4e-35
WP_001538856.1|1983550_1984378_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	97.8	4.5e-129
WP_024239125.1|1984419_1984791_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	96.7	9.4e-63
WP_001538858.1|1984822_1985065_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	95.0	1.4e-35
WP_001030139.1|1985068_1985215_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	95.8	3.1e-22
WP_000528718.1|1985223_1985460_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001538859.1|1985515_1986829_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.4	9.2e-246
WP_042040108.1|1986810_1987581_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252980.1|1987633_1988029_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|1988069_1988813_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_001576787.1|1988809_1989781_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|1989820_1992250_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|1992274_1993375_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|1993762_1994509_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|1994522_1995089_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|1995304_1997038_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 5
NZ_CP014522	Escherichia coli strain ZH063 chromosome, complete genome	5033359	2024427	2050401	5033359	portal,holin,tail,capsid,plate,terminase	Escherichia_phage(36.36%)	37	NA	NA
WP_001296152.1|2024427_2024847_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531766.1|2025013_2026057_-	hypothetical protein	NA	R9TNM7	Vibrio_phage	28.5	2.0e-33
WP_001531767.1|2026060_2026285_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_001531768.1|2026446_2026836_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|2026871_2028512_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|2028620_2028902_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|2028914_2029427_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000117510.1|2029444_2030947_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|2030943_2031333_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_001531771.1|2031332_2032517_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|2032509_2033136_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_001576796.1|2033138_2034059_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.8	8.3e-68
WP_000901289.1|2034055_2034397_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|2034399_2035302_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|2035282_2035819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2035815_2036496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|2036527_2036908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|2036904_2037324_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|2037358_2038393_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|2038451_2038781_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|2038780_2040088_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|2040087_2041662_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|2041658_2041892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|2041891_2043754_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|2043740_2044307_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|2044675_2044921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|2044980_2045175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|2045182_2045662_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|2045661_2045934_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|2045933_2046317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|2046429_2047101_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|2047100_2047394_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|2047390_2047987_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|2048064_2048244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2048395_2049037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|2049280_2049514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2049912_2050401_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
>prophage 6
NZ_CP014522	Escherichia coli strain ZH063 chromosome, complete genome	5033359	2054462	2066631	5033359	integrase	Pectobacterium_phage(66.67%)	17	2064492:2064506	2071244:2071258
WP_001531776.1|2054462_2055251_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|2055932_2056157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2056153_2056465_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|2056461_2056698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|2056699_2057110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|2057148_2058564_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|2058553_2059309_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|2059305_2059530_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|2059569_2060046_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|2060104_2060335_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|2060433_2060847_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|2061857_2062178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|2062208_2064425_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|2064421_2064991_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
2064492:2064506	attL	TGACGCCAGAGATGA	NA	NA	NA	NA
WP_000916334.1|2064990_2065173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|2065382_2065646_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|2065614_2066631_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2071244:2071258	attR	TCATCTCTGGCGTCA	NA	NA	NA	NA
>prophage 7
NZ_CP014522	Escherichia coli strain ZH063 chromosome, complete genome	5033359	2188585	2259794	5033359	portal,transposase,holin,tail,lysis,terminase,integrase,protease,head	Enterobacteria_phage(55.07%)	95	2204287:2204302	2264832:2264847
WP_001296203.1|2188585_2189782_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_000235219.1|2189977_2190184_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000813432.1|2190277_2190880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001327829.1|2191353_2191569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970353.1|2191905_2192598_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_000255956.1|2192597_2193620_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001296206.1|2195144_2196290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163787.1|2196820_2197078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000016207.1|2197131_2197899_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_000217077.1|2197895_2198954_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000778018.1|2198972_2199962_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001576800.1|2199972_2202138_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001069649.1|2202566_2203001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531797.1|2203218_2205603_+	dynamin family protein	NA	NA	NA	NA	NA
2204287:2204302	attL	GTTGATGAAGCCTGGG	NA	NA	NA	NA
WP_000203551.1|2205599_2206505_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102631.1|2206501_2207572_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_001362823.1|2207707_2208385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846703.1|2208400_2208811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|2209031_2209850_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|2209849_2210095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|2210188_2210662_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|2210677_2211154_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2211216_2211438_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|2211456_2212101_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_001280918.1|2212116_2212485_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854815.1|2212573_2212948_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|2212944_2213139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|2213151_2213265_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001296208.1|2213753_2213936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2214036_2214366_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001200889.1|2214537_2215596_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105368.1|2215793_2216267_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001296209.1|2216385_2217552_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_125093545.1|2218391_2220863_-|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	86.1	7.4e-71
WP_001576805.1|2221194_2221446_+	Arc family DNA-binding protein	NA	B8K1J0	Salmonella_phage	91.6	1.9e-35
WP_000757525.1|2221737_2222103_-	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	99.2	8.1e-67
WP_001576809.1|2222140_2222470_+	hypothetical protein	NA	Q9AYY8	Salmonella_phage	95.4	1.1e-49
WP_001576810.1|2222470_2224639_-	hypothetical protein	NA	Q9AYY9	Salmonella_phage	94.9	0.0e+00
WP_000246980.1|2224638_2225988_-	DNA transfer protein	NA	Q9AYZ0	Salmonella_phage	99.3	4.3e-246
WP_000964872.1|2225998_2226691_-	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.8	5.8e-114
WP_000614036.1|2226693_2227149_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.0	2.6e-86
WP_001576811.1|2227148_2228102_-	hypothetical protein	NA	Q716G6	Shigella_phage	84.5	1.0e-92
WP_001576812.1|2228101_2229520_-	packaged DNA stabilization protein gp10	NA	A0A088CQ70	Enterobacteria_phage	99.6	5.4e-276
WP_001140510.1|2229529_2229991_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001576814.1|2229971_2230160_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.4	6.5e-28
WP_001576816.1|2230201_2231455_-	hypothetical protein	NA	A0A088CQ56	Enterobacteria_phage	99.5	3.7e-236
WP_001576818.1|2231473_2232367_-	hypothetical protein	NA	A0A088CPT0	Enterobacteria_phage	97.6	1.5e-127
WP_001576819.1|2232460_2234656_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	97.0	0.0e+00
WP_000200766.1|2234657_2236073_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	1.2e-278
WP_000113732.1|2236069_2236510_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000807785.1|2236512_2236755_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001576820.1|2237002_2237488_-	GIY-YIG nuclease family protein	NA	C6ZR70	Salmonella_phage	99.4	1.9e-87
WP_001139677.1|2237692_2237845_-	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	98.0	8.1e-21
WP_001576821.1|2237832_2238270_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	97.2	5.5e-70
WP_000229392.1|2238266_2238743_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|2238726_2239050_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000027554.1|2239558_2240077_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	5.9e-95
WP_000994516.1|2240073_2240262_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008200.1|2240258_2240621_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000002243.1|2240617_2240908_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001001006.1|2240900_2241113_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	3.6e-35
WP_000950962.1|2241105_2241282_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001576824.1|2241274_2241643_-	DUF2591 family protein	NA	A5VW89	Enterobacteria_phage	47.5	5.4e-18
WP_001254220.1|2241645_2241822_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_001576826.1|2241818_2242229_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	96.3	7.4e-69
WP_000344561.1|2242231_2242498_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	64.8	1.0e-26
WP_000049638.1|2242509_2242710_-	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
WP_000796282.1|2242706_2243033_-	hypothetical protein	NA	Q716D0	Shigella_phage	100.0	3.3e-59
WP_001248394.1|2243105_2244482_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.8e-253
WP_001576828.1|2244478_2245366_-	replication protein	NA	A5VW95	Enterobacteria_phage	99.0	6.9e-144
WP_001576829.1|2245428_2245701_-	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	4.6e-43
WP_000251072.1|2245723_2246017_-	lambda phage CII family protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000437875.1|2246135_2246336_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274755.1|2246436_2247150_+	LexA family transcriptional regulator	NA	A4KWS8	Enterobacteria_phage	100.0	2.1e-127
WP_001576830.1|2247268_2248174_+	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	94.1	5.7e-162
WP_072093907.1|2248520_2248979_+	antitermination protein N	NA	J3JZZ6	Escherichia_phage	86.9	2.4e-55
WP_001576832.1|2248990_2249614_+	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	97.1	3.3e-108
WP_001576833.1|2249677_2250148_+	hypothetical protein	NA	G9L670	Escherichia_phage	98.1	1.7e-85
WP_000065374.1|2250298_2250667_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001576834.1|2250701_2251670_+	hypothetical protein	NA	G5DA88	Enterobacteria_phage	99.7	1.7e-55
WP_000638547.1|2251694_2251826_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2251810_2251963_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000050554.1|2252038_2252209_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_001576835.1|2252219_2252825_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	9.2e-108
WP_000951323.1|2252824_2253208_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
WP_001111302.1|2253231_2253525_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.5e-50
WP_001576836.1|2253535_2253700_+	DUF2737 family protein	NA	K7P7M6	Enterobacteria_phage	100.0	5.5e-23
WP_001576837.1|2253696_2254170_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	70.8	2.9e-56
WP_001576838.1|2254166_2254835_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	70.7	2.3e-75
WP_001576840.1|2255404_2255689_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	97.9	5.9e-49
WP_001576841.1|2255761_2255929_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001576843.1|2256268_2256460_+	hypothetical protein	NA	A0A0P0ZBL0	Stx2-converting_phage	98.4	9.2e-30
WP_024188919.1|2256440_2257619_-|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.2	7.5e-231
WP_001576845.1|2257800_2259225_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001531805.1|2259335_2259794_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
2264832:2264847	attR	GTTGATGAAGCCTGGG	NA	NA	NA	NA
>prophage 8
NZ_CP014522	Escherichia coli strain ZH063 chromosome, complete genome	5033359	2282941	2289244	5033359		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|2282941_2283484_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|2283488_2284367_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|2284424_2285324_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|2285323_2286409_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|2286781_2287675_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|2287849_2289244_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 9
NZ_CP014522	Escherichia coli strain ZH063 chromosome, complete genome	5033359	2383419	2392864	5033359		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|2383419_2384556_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|2384552_2386556_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|2386680_2387142_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2387182_2387653_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2387699_2388419_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2388415_2390101_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|2390322_2391054_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|2391113_2391221_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|2391201_2391933_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|2391937_2392864_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 10
NZ_CP014522	Escherichia coli strain ZH063 chromosome, complete genome	5033359	2972215	2979355	5033359		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|2972215_2974777_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|2974882_2975539_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001296319.1|2975589_2976357_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|2976552_2977461_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|2977457_2978720_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|2978716_2979355_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 11
NZ_CP014522	Escherichia coli strain ZH063 chromosome, complete genome	5033359	3225387	3283762	5033359	transposase,lysis,tRNA,integrase,protease	Staphylococcus_phage(25.0%)	48	3245325:3245340	3284161:3284176
WP_001327406.1|3225387_3226146_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|3226349_3227270_-	agmatinase	NA	NA	NA	NA	NA
WP_000758911.1|3227405_3228137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3228282_3230259_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3230267_3230399_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|3230534_3230750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3231053_3232208_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3232643_3234038_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3234114_3234612_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001327408.1|3234706_3235414_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3235493_3236225_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593261.1|3236237_3237188_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3237296_3237860_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3237859_3238276_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001327409.1|3238449_3239430_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3239447_3240152_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3240169_3240736_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3240732_3241023_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174738.1|3241030_3241624_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239981.1|3241616_3242753_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745192.1|3242821_3243829_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394106.1|3243945_3244992_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3245167_3245887_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
3245325:3245340	attL	AATGGGTTACCGCCGC	NA	NA	NA	NA
WP_001107565.1|3246070_3246397_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786915.1|3246396_3247116_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001327411.1|3247276_3248329_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091699.1|3248356_3248632_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_061363756.1|3248696_3249776_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001327414.1|3249977_3251234_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839794.1|3251282_3253418_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234491.1|3253816_3254524_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|3254902_3256168_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|3256423_3257467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|3258965_3259517_+	HTH-type transcriptional regulator PapX	NA	NA	NA	NA	NA
WP_000006213.1|3262202_3262436_+	major pilus subunit operon transcriptional regulator PapI	NA	NA	NA	NA	NA
WP_001513409.1|3264303_3264417_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|3266250_3266511_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|3266552_3267113_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|3267152_3267581_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_103103190.1|3268289_3269517_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
WP_000074472.1|3269630_3270824_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|3270959_3272684_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|3272684_3273632_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|3273631_3275374_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001576313.1|3275370_3276648_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|3276729_3278931_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_011076574.1|3279481_3279625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034083.1|3279874_3283762_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
3284161:3284176	attR	AATGGGTTACCGCCGC	NA	NA	NA	NA
>prophage 1
NZ_CP014523	Escherichia coli strain ZH063 plasmid pZH063_1, complete sequence	114223	54003	87107	114223	transposase,integrase	Escherichia_phage(28.57%)	28	55668:55688	79109:79129
WP_000952372.1|54003_55176_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
WP_000544830.1|55175_55973_+	IS21-like element IS21 family helper ATPase IstB	NA	U5N3V8	Enterobacteria_phage	99.6	1.9e-145
55668:55688	attL	GATGAAATAGGCTATCTGCCG	NA	NA	NA	NA
WP_001298676.1|55966_56797_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000343766.1|57215_58436_-|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_000115885.1|58454_58973_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000619112.1|59107_59356_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.2e-13
WP_000109079.1|59352_59790_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	47.6	1.1e-25
WP_000340835.1|61064_61457_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001103694.1|61461_62433_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	9.7e-67
WP_000633911.1|62661_63306_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.5	8.8e-40
WP_000239529.1|63299_63575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016979.1|63712_64522_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.5	7.8e-54
WP_001159871.1|64522_64828_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|64829_65048_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000990667.1|67369_68011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309253.1|69185_70163_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.5	6.1e-101
WP_001066947.1|70405_71146_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001332784.1|71266_71455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|71821_72991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|73837_74110_-	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_001298664.1|75352_77323_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_000977394.1|77329_78121_+	DUF4198 domain-containing protein	NA	NA	NA	NA	NA
WP_001323403.1|78859_79639_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
79109:79129	attR	CGGCAGATAGCCTATTTCATC	NA	NA	NA	NA
WP_001310017.1|79638_80661_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.7	3.2e-201
WP_000612626.1|81740_82088_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|82084_82489_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001189113.1|82990_84499_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	6.2e-44
WP_000143800.1|85607_87107_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP014524	Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence	49467	0	9474	49467	transposase,integrase	Burkholderia_phage(40.0%)	6	3038:3055	10221:10238
WP_001749988.1|2564_3134_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
3038:3055	attL	CCTGATAGATTTGCTCAC	NA	NA	NA	NA
WP_000845048.1|3526_4540_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|4695_5169_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|5389_5656_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|5798_6563_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_072094655.1|8070_9474_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
10221:10238	attR	GTGAGCAAATCTATCAGG	NA	NA	NA	NA
>prophage 2
NZ_CP014524	Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence	49467	22549	26135	49467	transposase	Wolbachia_phage(33.33%)	4	NA	NA
WP_000792636.1|22549_23083_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	33.9	5.8e-21
WP_002210551.1|23256_23385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|24054_24759_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000509966.1|25529_26135_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
>prophage 3
NZ_CP014524	Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence	49467	29286	29991	49467	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_001067855.1|29286_29991_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 4
NZ_CP014524	Escherichia coli strain ZH063 plasmid pZH063_2, complete sequence	49467	45878	47572	49467		Morganella_phage(50.0%)	2	NA	NA
WP_000861760.1|45878_46319_+	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_001749980.1|46306_47572_+	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	53.8	2.2e-119
