The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014356	Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 chromosome, complete genome	4916170	364952	410236	4916170	head,integrase,terminase,coat,lysis,holin,protease,portal,tail	Salmonella_phage(57.35%)	68	355722:355738	418827:418843
355722:355738	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|364952_366005_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_061360658.1|367401_368652_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	9.5e-99
WP_000051900.1|368857_370021_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|370250_370886_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277764.1|370986_371166_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	100.0	1.9e-29
WP_000208022.1|371262_372216_-	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	100.0	1.9e-171
WP_024152293.1|372219_372408_-	hypothetical protein	NA	A0A075B8E3	Enterobacteria_phage	100.0	2.7e-26
WP_000065093.1|372410_373004_-	ead/Ea22-like family protein	NA	A0A2H4A316	Salmonella_phage	100.0	2.1e-104
WP_015975202.1|373000_373360_-	Eaf protein	NA	T1SA95	Salmonella_phage	100.0	4.0e-66
WP_015975203.1|373468_373966_-	hypothetical protein	NA	A0A0N6WGF1	Salmonella_phage	99.4	2.3e-88
WP_001214434.1|373953_374124_-	DUF2737 family protein	NA	A0A0N7CAQ8	Salmonella_phage	100.0	3.5e-25
WP_015975204.1|374134_374428_-	DUF2856 family protein	NA	A0A0N7CAQ6	Salmonella_phage	100.0	1.9e-50
WP_000031375.1|374758_375376_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001163402.1|375372_375516_-	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000158027.1|375505_375694_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|375674_375833_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|375918_376230_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|376377_376581_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|376580_376817_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|376853_377048_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|377262_377841_+	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_015975212.1|377861_378164_-	hypothetical protein	NA	A0A075B8K6	Enterobacteria_phage	100.0	3.7e-49
WP_001095984.1|378517_379168_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|379248_379434_+	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|379540_379819_+	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|379853_380000_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|379992_380808_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|380804_382181_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|382254_382692_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|382688_382862_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|382828_383005_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|383007_383340_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|383332_383509_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|383501_384113_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_061360659.1|384109_384337_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	98.7	4.1e-37
WP_000149925.1|384333_384537_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|384517_384697_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|384693_385317_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000738703.1|385751_386078_+|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_052923398.1|386061_386499_+	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	100.0	5.7e-75
WP_015975208.1|386495_386933_+|lysis	lysis protein	lysis	A0A0N6WGE8	Salmonella_phage	100.0	3.1e-73
WP_015975209.1|387082_387688_+	Rha	NA	A0A1R3Y613	Salmonella_virus	99.0	5.8e-110
WP_001279869.1|387953_388214_-	hypothetical protein	NA	A0A089FW14	Salmonella_phage	100.0	6.6e-39
WP_000807794.1|388521_388764_+	DUF2560 family protein	NA	A0A0N7CDV1	Salmonella_phage	100.0	1.3e-36
WP_015975211.1|388765_388945_+	hypothetical protein	NA	A0A2H4A350	Salmonella_phage	100.0	4.9e-25
WP_000729922.1|388968_389457_+	DNA-packaging protein gp3	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
WP_015975189.1|389434_390934_+|terminase	terminase large subunit	terminase	A0A192Y824	Salmonella_phage	100.0	4.8e-307
WP_061360660.1|390933_393111_+|portal	portal protein	portal	A0A192Y922	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|393124_394036_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|394035_395328_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|395366_395576_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_015975196.1|395559_396060_+|head	head completion protein	head	A0A192Y830	Salmonella_phage	100.0	3.2e-90
WP_001122424.1|396019_397438_+	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|397441_398143_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|398142_398598_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_061360661.1|398600_399290_+	hypothetical protein	NA	A0A192Y6A3	Salmonella_phage	99.6	4.3e-117
WP_015975198.1|399300_400716_+	phage DNA ejection protein	NA	A0A192Y834	Salmonella_phage	100.0	6.2e-248
WP_015975199.1|400715_402545_+	hypothetical protein	NA	A0A192Y934	Salmonella_phage	100.0	0.0e+00
WP_015975200.1|402567_403062_-	hypothetical protein	NA	A8CGD7	Salmonella_phage	100.0	3.8e-83
WP_000757526.1|403092_403458_+	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
WP_015975201.1|403471_403651_-	hypothetical protein	NA	A0A192Y6A8	Salmonella_phage	100.0	6.2e-28
WP_015975190.1|403750_404002_-	Arc family DNA-binding protein	NA	A0A192Y840	Salmonella_phage	100.0	9.9e-40
WP_015975191.1|404092_404254_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	100.0	1.2e-22
WP_015975192.1|404322_405225_+	phage antirepressor Ant	NA	A0A192Y6V0	Salmonella_phage	100.0	8.5e-174
WP_015975193.1|405435_407439_+|tail	tailspike protein	tail	A0A192Y6X2	Salmonella_phage	100.0	0.0e+00
WP_000671495.1|407497_408955_-	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000703640.1|408944_409877_-	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|409873_410236_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
418827:418843	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 2
NZ_CP014356	Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 chromosome, complete genome	4916170	1017095	1025827	4916170	protease,transposase	Dickeya_phage(14.29%)	7	NA	NA
WP_001201749.1|1017095_1018214_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1018210_1020157_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1020286_1020508_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1020831_1021152_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1021182_1023459_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1023650_1024109_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_085983316.1|1024571_1025827_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP014356	Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 chromosome, complete genome	4916170	1075919	1174726	4916170	integrase,terminase,lysis,tRNA,holin,protease,portal,tail	Salmonella_phage(42.86%)	99	1078828:1078847	1150614:1150633
WP_001154025.1|1075919_1076723_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1076715_1078038_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1078018_1078723_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572725.1|1078722_1083189_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1078828:1078847	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925871.1|1083533_1085375_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1085634_1086183_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1086210_1086858_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_023261971.1|1086919_1088110_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1088294_1089386_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1089992_1091393_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1091593_1092055_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1092371_1093586_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000191399.1|1095344_1096547_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1096741_1098034_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1098078_1098327_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1098367_1098607_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1098649_1099807_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_000017133.1|1099769_1102655_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1102781_1103081_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1103102_1103261_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_014343821.1|1103253_1103514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1103563_1103974_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_061360675.1|1104093_1104333_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	48.6	2.2e-12
WP_001574095.1|1104298_1104673_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_061360676.1|1104757_1105741_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	99.7	9.6e-163
WP_000800010.1|1105743_1106493_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1106503_1106851_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_061360677.1|1106847_1107159_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	95.8	3.6e-31
WP_014343823.1|1107236_1107527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1107818_1108052_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1108163_1108385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000929805.1|1108467_1109070_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_001096552.1|1109278_1109890_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1109886_1110033_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|1110022_1110820_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001534733.1|1111376_1111502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1111637_1112087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1112447_1113134_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1113409_1113739_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_014343824.1|1113722_1114175_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	96.6	5.1e-79
WP_001541990.1|1114192_1114672_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1114879_1115413_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1115369_1117508_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1117504_1117711_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|1117707_1119255_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|1119178_1121260_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1121350_1121674_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1121666_1121966_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1121946_1122513_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1122509_1122911_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1122922_1123672_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1123717_1124116_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1124112_1124442_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1124521_1127509_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1127505_1127838_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1127936_1128434_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1128550_1129084_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152415.1|1129173_1129869_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000606351.1|1129878_1130616_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_000246065.1|1130513_1131218_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_139133709.1|1133070_1134639_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	63.9	7.2e-128
WP_000178849.1|1134677_1134920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144679.1|1134973_1137412_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000143167.1|1137411_1137993_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001533476.1|1138468_1139437_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000334547.1|1140084_1140711_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1140779_1141079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1141063_1141750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1142020_1142212_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1142638_1145251_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|1145458_1146469_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1146634_1147177_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1147173_1148283_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086486.1|1148381_1150490_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1150502_1152410_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1150614:1150633	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1152424_1153678_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1153682_1155323_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1155319_1155883_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1156138_1156306_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1156405_1156924_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156453.1|1156992_1158753_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1158938_1159391_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1159462_1160515_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1160871_1161381_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1161597_1162203_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1162189_1164343_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1164361_1164808_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1164931_1166986_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1167021_1167480_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1167574_1168237_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1168410_1168824_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1168868_1169186_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1169243_1170455_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1170669_1171218_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1171243_1172023_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1172071_1172353_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1172349_1172679_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1172765_1173425_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1174045_1174726_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP014356	Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 chromosome, complete genome	4916170	2032723	2112090	4916170	capsid,head,terminase,integrase,plate,lysis,transposase,holin,protease,portal,tail	Salmonella_phage(84.85%)	102	2039261:2039276	2113713:2113728
WP_000502119.1|2032723_2033182_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000659251.1|2033362_2034568_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000079805.1|2034646_2036134_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_000146802.1|2036390_2037794_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2037808_2038216_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2038215_2038584_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2038655_2040140_+	alpha-amylase	NA	NA	NA	NA	NA
2039261:2039276	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_061360696.1|2040179_2040629_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2040814_2042020_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2042016_2042250_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2042514_2042901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2043020_2043335_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2043551_2045234_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2045226_2046222_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2046214_2046922_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2046921_2048292_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2048313_2048757_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2048753_2049971_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2050075_2050543_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2050547_2051552_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2051548_2051962_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2051961_2052339_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2052338_2053076_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2053085_2053355_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2053363_2054158_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2054439_2055063_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2055101_2055350_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2055424_2055652_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2055961_2056777_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119819.1|2056755_2058468_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2058632_2058878_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2058894_2059806_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2059981_2060902_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2060890_2061361_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2061341_2062772_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2062845_2063541_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2063632_2063932_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2064581_2065778_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2066038_2066227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2066237_2066450_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2066904_2068173_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2068175_2068595_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2068721_2068883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526483.1|2069513_2069735_-	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000492926.1|2069947_2070955_+	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_015701331.1|2071239_2071839_-|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000554737.1|2071808_2073371_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_001207832.1|2073357_2073945_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785580.1|2073947_2075027_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
WP_000605050.1|2075019_2075433_-	hypothetical protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_001273649.1|2075437_2075971_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_001066636.1|2075970_2077029_-	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_000863818.1|2077025_2078366_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_000785385.1|2078399_2080328_-|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000588852.1|2080412_2080739_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|2080735_2081092_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007991.1|2081091_2082588_-|tail	tail sheath protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000497739.1|2082577_2082742_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779218.1|2082745_2083306_-	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_001135697.1|2083302_2083815_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000702408.1|2083786_2084191_-|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_000927378.1|2084187_2084511_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601353.1|2084513_2084714_-	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000257528.1|2084764_2085970_-|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_001193639.1|2085984_2086635_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000466254.1|2086612_2087854_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_000605609.1|2087853_2088036_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088182.1|2088047_2089781_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000929191.1|2089777_2090272_-|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_001135225.1|2090397_2090748_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_001292890.1|2090808_2091111_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_000877027.1|2091330_2091750_-	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001050825.1|2091962_2092448_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_001005901.1|2092444_2093059_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001527046.1|2093061_2093406_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_014343859.1|2093567_2094002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001527054.1|2093931_2094189_-	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_000188927.1|2094321_2094945_-	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001202277.1|2094955_2095945_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_001061457.1|2095952_2096813_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001241579.1|2096829_2097219_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2097215_2098109_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2098108_2098591_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2098592_2099411_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2099407_2099632_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2099628_2100786_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2100782_2101337_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2101365_2101590_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2101687_2102383_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_000997190.1|2103197_2103569_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000080415.1|2103626_2104454_+	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000008351.1|2104590_2105130_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000764235.1|2105200_2105431_+	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000071070.1|2105427_2105943_+	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000065095.1|2105939_2106557_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000208068.1|2106553_2107387_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_001061334.1|2107390_2107960_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2107984_2108227_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2108228_2109218_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2109509_2110307_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2110678_2110969_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2111616_2112090_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2113713:2113728	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 5
NZ_CP014356	Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 chromosome, complete genome	4916170	2198084	2208590	4916170		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2198084_2199398_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2199424_2200504_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2200508_2201282_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2201278_2202271_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2202276_2202828_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2202828_2203707_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2203754_2204654_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2204653_2205739_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2206115_2207009_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2207186_2208590_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 6
NZ_CP014356	Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 chromosome, complete genome	4916170	2276897	2286068	4916170	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2276897_2278931_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2279171_2279630_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2279801_2280332_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2280388_2280856_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2280902_2281622_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2281618_2283304_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2283526_2284258_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2284317_2284425_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2284405_2285137_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2285120_2286068_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP014356	Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 chromosome, complete genome	4916170	2305481	2371903	4916170	holin,lysis,tail	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|2305481_2306177_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2306330_2307215_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2307391_2308111_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2308107_2308353_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2308557_2309799_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2309792_2311028_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2311102_2312113_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2312128_2313649_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2313782_2314781_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2315279_2316302_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2316451_2317594_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2317608_2318277_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2318606_2319464_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2319452_2319842_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2319846_2321214_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2321430_2322318_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2322350_2323673_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2323716_2325708_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2326052_2327522_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2327711_2328575_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2328695_2329745_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2329823_2330681_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2330745_2332434_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2332450_2333389_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2333388_2334519_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2334887_2336069_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2336133_2336799_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2336800_2336923_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2337310_2337565_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2337888_2338461_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2338673_2339660_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2339689_2340409_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2340822_2341395_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2341720_2343277_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2343383_2345189_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2345198_2346293_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2346292_2347318_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2347319_2348909_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2348912_2349257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2349647_2350838_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2350865_2351561_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2351712_2353473_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2353597_2353882_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2353990_2354611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2354638_2355646_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2355825_2356053_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2356084_2357845_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2358125_2358629_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2358656_2358947_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2359321_2361151_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2361204_2361648_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2362025_2362553_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2362555_2363797_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2364389_2364719_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_061360699.1|2365015_2366347_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.9	1.2e-19
WP_010989045.1|2366375_2366744_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2366758_2367748_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|2368076_2370443_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|2370611_2370815_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2371111_2371903_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 8
NZ_CP014356	Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 chromosome, complete genome	4916170	2710891	2818067	4916170	capsid,head,terminase,integrase,lysis,transposase,tRNA,protease,holin,portal,tail	Salmonella_phage(34.43%)	112	2735436:2735452	2825971:2825987
WP_000940032.1|2710891_2711623_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2711741_2712545_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2712689_2713568_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2713749_2714793_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_061360708.1|2714796_2715615_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2715625_2716639_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2716639_2717626_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2717616_2718255_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2718380_2719658_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2719652_2720792_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2720987_2722241_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883142.1|2722565_2723756_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187149.1|2723937_2725482_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2725842_2727174_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2727256_2729401_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2729456_2730917_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2730965_2731304_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2731380_2732718_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2732714_2733479_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2733480_2734911_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2735436:2735452	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2735560_2739448_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2739469_2739703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2739703_2741248_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2741298_2741850_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2741874_2742510_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361664.1|2742513_2743875_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2743885_2744779_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2744894_2745743_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2745781_2746699_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276370.1|2746720_2747917_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2748032_2748959_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2748996_2749257_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2749368_2749749_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2749748_2750480_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2750491_2751220_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2751231_2752137_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2752133_2752814_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2753087_2754062_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2754078_2755878_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2756282_2757776_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_154071814.1|2758148_2758292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542312.1|2758296_2758434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2759146_2759311_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2759890_2759956_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2760018_2760231_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2760337_2760565_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2760661_2761240_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2761229_2762054_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_001144691.1|2762050_2764423_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000178853.1|2764476_2764719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246126.1|2768174_2768822_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2768719_2769457_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2769463_2770162_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2770171_2770501_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_000372065.1|2770503_2773599_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_010989052.1|2773570_2773909_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2773905_2774301_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|2774351_2775098_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2775105_2775507_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000817263.1|2775615_2776746_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000677089.1|2776794_2777373_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083294.1|2777400_2777784_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000201486.1|2777794_2778154_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2778211_2779240_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2779294_2779642_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189503.1|2779654_2781151_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000831821.1|2781140_2782721_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2782717_2782921_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623091.1|2782904_2784836_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_001102153.1|2784807_2785353_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669690.1|2785639_2786041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001533543.1|2786276_2786729_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000984581.1|2786746_2787199_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001574216.1|2787182_2787512_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2787787_2788474_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000657897.1|2788688_2788877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|2789383_2789947_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_001097241.1|2790219_2790897_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000801757.1|2790893_2791034_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001096550.1|2791030_2791642_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000929791.1|2791850_2792453_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2792487_2792736_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2792852_2793086_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877757.1|2793328_2793961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000664368.1|2794068_2794767_-	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000801766.1|2794780_2795476_-	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_010835408.1|2796447_2796822_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000643689.1|2796781_2797024_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_000660736.1|2797123_2797519_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_001111772.1|2797577_2798417_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000356948.1|2798409_2798796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000950426.1|2798795_2799458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917562.1|2799914_2800073_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001539619.1|2800094_2800445_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000017125.1|2800571_2803499_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_077248255.1|2803461_2804619_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_001237031.1|2804661_2804901_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2804941_2805226_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001007939.1|2805203_2806433_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_000589087.1|2806930_2807410_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2807406_2808363_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2808362_2809013_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2809044_2809620_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2809616_2809781_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000989177.1|2810044_2811667_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2811651_2812389_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2812519_2813854_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2813871_2814771_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2814873_2815461_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2815522_2815906_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2816224_2816914_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2817029_2818067_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2825971:2825987	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 9
NZ_CP014356	Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 chromosome, complete genome	4916170	2844877	2941830	4916170	capsid,head,terminase,integrase,plate,lysis,transposase,tRNA,portal,tail	Salmonella_phage(84.0%)	88	2912226:2912241	2940277:2940292
WP_000469804.1|2844877_2845645_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2845689_2846238_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2846256_2846505_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460050.1|2846818_2848180_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2848345_2849137_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_145857061.1|2849156_2850443_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_001518875.1|2851204_2851795_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059155.1|2851917_2852796_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2852881_2854543_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2854691_2855030_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2855195_2855486_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2855475_2855952_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2856100_2856583_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237669.1|2857196_2868671_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533858.1|2868735_2870145_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196159.1|2870141_2872322_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_010989057.1|2872329_2873493_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980500.1|2874044_2874263_-	hypothetical protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|2874331_2875432_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|2875428_2875914_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001677191.1|2875910_2878718_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	100.0	0.0e+00
WP_000763316.1|2878710_2878830_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280963.1|2878844_2879147_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_001207651.1|2879201_2879717_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046108.1|2879726_2880899_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_000974843.1|2881001_2881226_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|2882095_2882671_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001274649.1|2882670_2884524_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_001086804.1|2884520_2885126_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_000268332.1|2885118_2886027_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000189373.1|2886013_2886373_-|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|2886369_2886948_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|2887025_2887877_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|2887878_2888325_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|2888317_2888749_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|2888844_2889273_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_061360710.1|2889269_2889785_-	lysozyme	NA	E5G6N1	Salmonella_phage	99.4	2.6e-95
WP_000171565.1|2889765_2889981_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|2889984_2890188_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673537.1|2890187_2890652_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000059173.1|2890745_2891396_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730759.1|2891399_2892461_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000216276.1|2892477_2893311_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|2893453_2895220_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|2895219_2896260_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284991.1|2896363_2898028_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|2898341_2899019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|2899132_2899366_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154433.1|2899376_2899565_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000017507.1|2899717_2902132_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_000104187.1|2902128_2902986_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000752613.1|2902982_2903210_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|2903209_2903443_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000963474.1|2903510_2903852_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_000956190.1|2903815_2904016_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|2904023_2904533_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000102105.1|2904566_2904809_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_000932273.1|2904930_2905563_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000218402.1|2905565_2906582_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000360326.1|2907134_2907797_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_001542208.1|2908127_2909192_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	62.5	1.6e-118
WP_001542209.1|2909205_2909373_+	hypothetical protein	NA	A0A1B5FPC6	Escherichia_phage	61.9	1.1e-07
WP_010989063.1|2909419_2910013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248794.1|2910402_2911596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161781.1|2911930_2912758_-	hypothetical protein	NA	NA	NA	NA	NA
2912226:2912241	attL	ACAAACATATATTCTT	NA	NA	NA	NA
WP_000701821.1|2913208_2913424_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001520307.1|2913459_2915529_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	35.1	1.7e-73
WP_001520831.1|2916031_2917315_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010989064.1|2917359_2918178_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_010989065.1|2918330_2918687_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000749979.1|2918781_2919066_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	5.4e-18
WP_000480483.1|2919178_2919700_+	PTS sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000973738.1|2919696_2920071_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001098984.1|2920067_2921048_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_001033832.1|2921058_2922072_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000889012.1|2922366_2923569_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000776032.1|2923642_2924278_-	3-hexulose-6-phosphate synthase	NA	NA	NA	NA	NA
WP_001682344.1|2924301_2924865_-	6-phospho-3-hexuloisomerase	NA	NA	NA	NA	NA
WP_000811366.1|2924864_2925707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000819716.1|2925836_2927378_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000021514.1|2927600_2929280_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000088556.1|2930396_2931272_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_014343881.1|2931437_2933312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989066.1|2933571_2934855_-	membrane protein	NA	NA	NA	NA	NA
WP_077948569.1|2935432_2936029_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B5FPC6	Escherichia_phage	90.8	1.0e-98
WP_000061088.1|2937772_2938411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000073810.1|2938407_2940390_-	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
2940277:2940292	attR	AAGAATATATGTTTGT	NA	NA	NA	NA
WP_085983317.1|2940668_2941830_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.9	5.2e-51
>prophage 10
NZ_CP014356	Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 chromosome, complete genome	4916170	4267281	4360539	4916170	capsid,head,integrase,terminase,plate,lysis,tRNA,protease,holin,portal,tail	Salmonella_phage(54.55%)	104	4300188:4300234	4330636:4330682
WP_000560974.1|4267281_4267719_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|4267763_4268705_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259011.1|4268719_4269166_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558166.1|4269162_4269474_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_001127703.1|4269559_4270489_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001159630.1|4270706_4271018_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|4271018_4271309_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|4271355_4272285_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|4272281_4272917_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|4272913_4273816_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_010989087.1|4273828_4276879_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	2.7e-06
WP_000710966.1|4278176_4279208_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000828052.1|4279390_4280491_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527676.1|4280845_4281169_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|4281168_4281828_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010989088.1|4281910_4282477_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619478.1|4282565_4282880_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_000009249.1|4282876_4284025_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179685.1|4284151_4284979_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211463.1|4285121_4286381_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000143970.1|4286377_4287847_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|4288134_4288971_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013290.1|4289123_4289972_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063541.1|4289968_4291003_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|4291621_4292305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000566800.1|4292462_4293770_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|4293762_4294278_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000812819.1|4294296_4295280_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000122635.1|4295608_4296229_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	1.4e-63
WP_014343930.1|4296235_4296988_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133444.1|4296999_4297395_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|4297445_4298819_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|4298815_4299514_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|4299664_4300165_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4300188:4300234	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_001526255.1|4300349_4301330_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	97.9	2.4e-182
WP_001017512.1|4301399_4301693_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	100.0	4.0e-48
WP_000453532.1|4301828_4302101_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	100.0	5.3e-47
WP_000217670.1|4302270_4302771_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4302834_4303059_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001526254.1|4303058_4303361_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	99.0	5.9e-47
WP_001113264.1|4303360_4303585_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|4303581_4303857_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001526225.1|4303846_4306126_+	replication endonuclease	NA	Q858T4	Yersinia_virus	96.7	0.0e+00
WP_061360742.1|4306363_4308847_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000517958.1|4309226_4310273_-|portal	phage portal protein	portal	S4TNX7	Salmonella_phage	99.4	4.4e-190
WP_061360743.1|4310272_4312042_-|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.3	0.0e+00
WP_001609322.1|4312207_4313062_+|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	94.4	1.8e-149
WP_001609323.1|4313138_4314206_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.4	2.6e-198
WP_024143114.1|4314209_4314959_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	97.2	9.9e-128
WP_000214255.1|4315052_4315559_+|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_000868400.1|4315558_4315762_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
WP_000134659.1|4315765_4316062_+|holin	holin	holin	S4TP56	Salmonella_phage	100.0	4.4e-47
WP_001144116.1|4316048_4316546_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_000866102.1|4316542_4316956_+|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	100.0	2.6e-45
WP_001394645.1|4316927_4317101_+	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_061360744.1|4317063_4317531_+|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	99.4	7.2e-84
WP_050178735.1|4317523_4317973_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	94.6	1.6e-69
WP_061360745.1|4318041_4318683_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	96.2	2.5e-111
WP_061360746.1|4318679_4319027_+|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	9.4e-57
WP_050178738.1|4319033_4319942_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	99.3	2.8e-161
WP_050178739.1|4319934_4320465_+|tail	phage tail protein I	tail	S4TTA8	Salmonella_phage	99.4	3.5e-103
WP_061360747.1|4320475_4322587_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	86.5	4.2e-216
WP_077948573.1|4322556_4323177_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	88.2	4.2e-100
WP_001279029.1|4323345_4324533_+|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.5	2.9e-222
WP_001207675.1|4324548_4325067_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_001029726.1|4325129_4325465_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	100.0	1.4e-52
WP_085984508.1|4325461_4325617_+|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_061360749.1|4325609_4328054_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	99.6	0.0e+00
WP_001526252.1|4328068_4328554_+|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	99.4	6.7e-85
WP_001526245.1|4328550_4329720_+	phage late control D family protein	NA	S4TRX8	Salmonella_phage	96.9	2.3e-208
WP_000468311.1|4329797_4330016_+	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_061360750.1|4330066_4330474_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	98.5	5.1e-70
WP_001077318.1|4330760_4331663_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4330636:4330682	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591793.1|4331847_4332810_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758711.1|4333013_4334003_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000750761.1|4334103_4334859_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000777317.1|4335121_4336456_+	MFS transporter	NA	NA	NA	NA	NA
WP_000646499.1|4336466_4337426_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000557889.1|4337435_4338476_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_001519915.1|4338538_4339261_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000061008.1|4339358_4339523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621104.1|4339538_4339670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001173080.1|4339759_4340110_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000113085.1|4340123_4341716_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001283048.1|4341803_4342763_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001167250.1|4343018_4344554_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_000911134.1|4344547_4345591_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_000981826.1|4345587_4346589_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000090737.1|4346617_4347640_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774147.1|4347668_4348544_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_001738619.1|4348626_4348917_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001088049.1|4348926_4349691_+	epimerase	NA	NA	NA	NA	NA
WP_001216339.1|4349782_4350550_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802242.1|4350662_4351259_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155237.1|4351359_4351788_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000796300.1|4351894_4352641_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250625.1|4352737_4353748_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136809.1|4353859_4355368_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084285.1|4355388_4356234_-	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000051370.1|4356632_4356872_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872918.1|4357093_4357579_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139639.1|4357671_4358601_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293360.1|4358667_4359999_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000208240.1|4360008_4360539_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 11
NZ_CP014356	Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 chromosome, complete genome	4916170	4479913	4497807	4916170	plate,tail	Burkholderia_phage(47.37%)	22	NA	NA
WP_061360751.1|4479913_4481659_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	5.5e-52
WP_000359500.1|4481661_4482294_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4482286_4483402_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4483392_4483752_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4483915_4485463_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4485462_4486392_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4486388_4486751_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4487078_4487801_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4487810_4488854_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4488841_4489051_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271423.1|4489050_4490004_-	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_061360752.1|4490003_4492358_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_001185654.1|4492454_4492583_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4492542_4492860_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4492911_4493436_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4493435_4494863_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4494852_4495050_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4495046_4495502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4495661_4495976_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4495988_4496594_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4496596_4496884_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4497459_4497807_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP014357	Salmonella enterica subsp. enterica serovar Typhimurium strain SO2 isolate SOHS 02-20 plasmid pSO2_STV, complete sequence	93837	40861	50157	93837	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_001541564.1|40861_41278_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|41461_41797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|41853_42420_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|42451_43393_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|43807_45013_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064274.1|45012_45987_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_000457541.1|46068_47343_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.0e-156
WP_000925627.1|47342_47765_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|48275_48746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|48738_49095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|49476_50157_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
