The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014358	Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 chromosome, complete genome	4933574	361701	406649	4933574	lysis,protease,integrase,portal,coat,terminase	Enterobacteria_phage(77.27%)	67	352471:352487	415240:415256
352471:352487	attL	GATATTGAAATTCGCGT	NA	NA	NA	NA
WP_001043675.1|361701_362754_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	1.7e-112
WP_001285275.1|363036_364140_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893231.1|364151_365402_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	1.6e-98
WP_000051897.1|365607_366771_-|integrase	site-specific integrase	integrase	Q76H30	Enterobacteria_phage	100.0	3.7e-230
WP_155675089.1|367000_367141_-	hypothetical protein	NA	A0A0M4QWX3	Salmonella_phage	97.8	4.2e-16
WP_000002104.1|367209_367494_-	ASCH domain-containing protein	NA	Q76H28	Enterobacteria_phage	100.0	1.4e-50
WP_000371199.1|367486_367771_-	DUF4752 family protein	NA	Q76H46	Enterobacteria_phage	100.0	1.6e-49
WP_025617570.1|367770_368415_-	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	99.5	1.4e-122
WP_071533029.1|368401_368635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000812203.1|368631_369141_-	hypothetical protein	NA	Q76H44	Enterobacteria_phage	100.0	2.8e-89
WP_001214777.1|369137_369308_-	DUF2737 family protein	NA	Q76H43	Enterobacteria_phage	100.0	1.6e-25
WP_001111291.1|369318_369612_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	100.0	1.4e-48
WP_001253476.1|369658_369943_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_001046968.1|369942_370650_-	recombinase	NA	Q76H40	Enterobacteria_phage	100.0	3.1e-139
WP_000902092.1|370646_370790_-	hypothetical protein	NA	A0A2H5BFM6	Salmonella_phage	100.0	6.4e-20
WP_000156731.1|370779_370968_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000141641.1|370948_371107_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000776963.1|371191_371506_-	Superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	100.0	1.5e-56
WP_000713613.1|371781_372069_-	hypothetical protein	NA	Q76H36	Enterobacteria_phage	100.0	2.7e-49
WP_015974224.1|372102_372747_-	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	100.0	6.5e-51
WP_000213982.1|372830_373025_-	Restriction inhibitor protein ral	NA	Q76H34	Enterobacteria_phage	100.0	1.9e-30
WP_001066179.1|373238_373826_+	superinfection exclusion protein B	NA	Q76H59	Enterobacteria_phage	100.0	1.4e-100
WP_000216178.1|373838_374141_-	hypothetical protein	NA	Q76H58	Enterobacteria_phage	100.0	9.7e-50
WP_000834175.1|374504_374708_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	100.0	2.0e-27
WP_001532928.1|374746_375826_-	hypothetical protein	NA	A0A192Y6S0	Salmonella_phage	100.0	1.5e-193
WP_000712403.1|375990_376680_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	100.0	1.3e-126
WP_000182204.1|376790_377006_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	100.0	1.3e-32
WP_001103492.1|377116_377398_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000539342.1|377580_378402_+	replication protein	NA	Q76H52	Enterobacteria_phage	100.0	5.2e-154
WP_001248410.1|378398_379775_+	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	100.0	1.9e-254
WP_001036030.1|379771_380041_+	hypothetical protein	NA	Q76H50	Enterobacteria_phage	100.0	4.9e-45
WP_000736891.1|380114_380552_+	recombination protein NinB	NA	Q76H49	Enterobacteria_phage	100.0	4.5e-80
WP_000679703.1|380548_380722_+	hypothetical protein	NA	Q76H74	Enterobacteria_phage	100.0	2.3e-32
WP_000113770.1|380688_380865_+	NinE family protein	NA	Q76H73	Enterobacteria_phage	100.0	1.0e-27
WP_001532927.1|380867_381209_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000950963.1|381201_381378_+	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_001108073.1|381370_381982_+	recombination protein NinG	NA	Q76H70	Enterobacteria_phage	100.0	7.9e-99
WP_000036320.1|381978_382203_+	hypothetical protein	NA	Q76H69	Enterobacteria_phage	100.0	6.3e-38
WP_000149882.1|382199_382403_+	protein ninH	NA	I6RSQ6	Salmonella_phage	100.0	7.2e-33
WP_000219133.1|382383_382563_+	hypothetical protein	NA	Q76H67	Enterobacteria_phage	100.0	1.9e-24
WP_001047566.1|382559_383333_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	100.0	8.1e-133
WP_000286100.1|383763_383967_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_024136257.1|383944_384442_+	lysozyme	NA	B8K1G9	Salmonella_phage	100.0	4.5e-92
WP_001687043.1|384438_384906_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	100.0	1.7e-77
WP_000877028.1|385118_385649_+	KilA-N domain-containing protein	NA	Q76H61	Enterobacteria_phage	100.0	1.3e-94
WP_000808099.1|385871_386114_+	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|386117_386507_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_001687044.1|386506_386911_+	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_000729923.1|386914_387403_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_000417860.1|387380_388880_+|terminase	terminase	terminase	Q76H24	Enterobacteria_phage	100.0	2.8e-307
WP_000774652.1|388879_391057_+|portal	portal protein	portal	Q76H23	Enterobacteria_phage	100.0	0.0e+00
WP_000433855.1|391070_391982_+	scaffold protein	NA	Q76H22	Enterobacteria_phage	100.0	1.5e-162
WP_001196937.1|391981_393274_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000538670.1|393314_393875_+	hypothetical protein	NA	C6ZR11	Salmonella_phage	100.0	9.8e-104
WP_001166103.1|393858_394359_+	packaged DNA stabilization protein p27	NA	Q76H19	Enterobacteria_phage	100.0	4.2e-90
WP_001122420.1|394318_395737_+	Packaged DNA stabilization protein gp10	NA	Q76H18	Enterobacteria_phage	100.0	6.4e-277
WP_000774917.1|395740_396442_+	hypothetical protein	NA	Q76H17	Enterobacteria_phage	100.0	1.7e-76
WP_000627593.1|396441_396897_+	DUF2824 family protein	NA	Q76H16	Enterobacteria_phage	100.0	1.8e-87
WP_000964904.1|396899_397589_+	hypothetical protein	NA	A0A2H5BFK5	Salmonella_phage	100.0	2.9e-118
WP_000246977.1|397599_399036_+	phage DNA ejection protein	NA	Q76H14	Enterobacteria_phage	100.0	7.7e-246
WP_001029860.1|399035_401012_+	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_071533035.1|401150_401444_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000532177.1|401464_401713_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_000129933.1|401848_403852_+	endorhamnosidase	NA	Q76H47	Enterobacteria_phage	100.0	0.0e+00
WP_000671496.1|403910_405368_-	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000703639.1|405357_406290_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|406286_406649_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
415240:415256	attR	GATATTGAAATTCGCGT	NA	NA	NA	NA
>prophage 2
NZ_CP014358	Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 chromosome, complete genome	4933574	999584	1008316	4933574	transposase,protease	Dickeya_phage(14.29%)	7	NA	NA
WP_001201751.1|999584_1000703_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|1000699_1002646_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|1002775_1002997_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1003320_1003641_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|1003671_1005948_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|1006139_1006598_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_085983316.1|1007060_1008316_-|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
>prophage 3
NZ_CP014358	Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 chromosome, complete genome	4933574	1058379	1157188	4933574	tail,tRNA,lysis,protease,integrase,portal,terminase,holin	Salmonella_phage(42.59%)	98	1061288:1061307	1133076:1133095
WP_001154025.1|1058379_1059183_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|1059175_1060498_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|1060478_1061183_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_022742649.1|1061182_1065649_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
1061288:1061307	attL	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000925872.1|1065993_1067835_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|1068094_1068643_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|1068670_1069318_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|1069379_1070570_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|1070754_1071846_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|1072452_1073853_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|1074053_1074515_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|1074831_1076046_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000191399.1|1077803_1079006_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262306.1|1079200_1080493_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000065276.1|1080537_1080786_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|1080826_1081066_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|1081108_1082266_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_022742652.1|1082228_1085114_-	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	97.3	0.0e+00
WP_001668146.1|1085240_1085540_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000917564.1|1085561_1085720_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_010989002.1|1085712_1085973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038966.1|1086022_1086433_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_000370145.1|1086552_1086792_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001574095.1|1086757_1087132_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1087216_1088200_+	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1088202_1088952_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113629.1|1088962_1089310_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000065108.1|1089306_1089618_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_014343823.1|1089695_1089986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|1090277_1090511_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_000807548.1|1090622_1090844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001096552.1|1091737_1092349_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001617856.1|1092345_1092492_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_022742653.1|1092481_1093279_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	5.2e-151
WP_010989004.1|1093345_1093663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|1093836_1093962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798705.1|1094097_1094547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001141973.1|1094907_1095594_-|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_001574216.1|1095869_1096199_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1096182_1096635_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1096652_1097132_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000371784.1|1097339_1097873_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989241.1|1097829_1099968_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000196190.1|1099964_1100171_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009207.1|1100167_1101715_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_010989008.1|1101638_1103720_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001107908.1|1103810_1104134_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|1104126_1104426_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453194.1|1104406_1104973_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000196702.1|1104969_1105371_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000132756.1|1105382_1106132_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478859.1|1106177_1106576_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|1106572_1106902_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_010989010.1|1106981_1109969_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_000978296.1|1109965_1110298_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_000725267.1|1110396_1110894_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|1111010_1111544_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_022742655.1|1111633_1112329_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.2	6.5e-89
WP_000246065.1|1112973_1113678_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_126834981.1|1115532_1117101_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	63.9	1.2e-127
WP_000178849.1|1117139_1117382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742660.1|1117435_1119874_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	63.6	1.7e-91
WP_022742661.1|1119873_1120455_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.5	3.3e-94
WP_061362608.1|1120930_1121899_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	1.0e-193
WP_000334547.1|1122546_1123173_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_010989011.1|1123241_1123541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525490.1|1123525_1124212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1124482_1124674_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193784.1|1125100_1127713_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_022742665.1|1127920_1128931_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|1129096_1129639_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|1129635_1130745_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|1130843_1132952_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|1132964_1134872_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
1133076:1133095	attR	AACGGCGCCGGGAAATCCAC	NA	NA	NA	NA
WP_000333152.1|1134886_1136140_+	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000433414.1|1136144_1137785_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|1137781_1138345_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|1138600_1138768_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|1138867_1139386_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|1139454_1141215_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|1141400_1141853_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|1141924_1142977_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|1143333_1143843_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|1144059_1144665_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|1144651_1146805_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|1146823_1147270_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|1147393_1149448_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|1149483_1149942_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847719.1|1150036_1150699_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|1150872_1151286_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|1151330_1151648_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|1151705_1152917_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859419.1|1153131_1153680_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|1153705_1154485_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000072884.1|1154533_1154815_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|1154811_1155141_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374050.1|1155227_1155887_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000938191.1|1156507_1157188_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
>prophage 4
NZ_CP014358	Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 chromosome, complete genome	4933574	1898580	1997772	4933574	tail,tRNA,lysis,transposase,head,protease,integrase,terminase	Edwardsiella_phage(15.25%)	120	1953674:1953688	1995612:1995626
WP_001221014.1|1898580_1899276_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128807.1|1899333_1901244_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_000029550.1|1901374_1901719_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457328.1|1901724_1901904_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000978464.1|1901984_1903349_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	1.9e-44
WP_000381544.1|1903352_1903931_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624277.1|1904194_1905559_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001192525.1|1905696_1907298_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000421815.1|1907319_1908879_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
WP_000150521.1|1909351_1910320_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406918.1|1910372_1911173_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001518647.1|1911185_1912037_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156280.1|1912094_1912553_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001518359.1|1912962_1913529_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_022742705.1|1913525_1914335_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_000730322.1|1914400_1916146_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|1916365_1916575_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001537930.1|1916587_1916731_-	YobF family protein	NA	NA	NA	NA	NA
WP_001000660.1|1917379_1917667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714547.1|1917737_1917881_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001236777.1|1918038_1918278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262195.1|1918489_1919281_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_000416128.1|1919456_1920830_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984498.1|1920877_1921759_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|1921952_1924001_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|1924020_1924707_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_000145727.1|1924804_1925389_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|1925430_1926714_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001535256.1|1926682_1929316_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001542138.1|1929393_1930833_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|1930950_1931187_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457836.1|1931297_1931489_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986176.1|1931507_1932158_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_001134856.1|1932381_1932546_-	membrane protein	NA	NA	NA	NA	NA
WP_000182072.1|1932830_1933553_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_022742706.1|1934236_1934632_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.0	6.0e-15
WP_000030934.1|1934961_1935438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354408.1|1935825_1936245_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001752421.1|1936614_1936884_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_001617922.1|1937049_1937190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000684835.1|1938653_1939022_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
WP_001233446.1|1940325_1941240_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|1941372_1941531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|1941540_1942155_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000457876.1|1943302_1943428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989029.1|1943997_1944198_+	PhoPQ-activated virulence protein PagK	NA	NA	NA	NA	NA
WP_000275418.1|1944294_1945176_-|tail	tail assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|1945648_1945837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|1945901_1946069_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|1946325_1946859_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|1946912_1947143_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|1947332_1947827_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_001520095.1|1947886_1948741_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.6e-73
WP_022742707.1|1949648_1950791_+	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_022742708.1|1951053_1951953_+	SMEK domain-containing protein	NA	NA	NA	NA	NA
WP_022742709.1|1952448_1953105_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024150649.1|1953105_1953801_-	hypothetical protein	NA	NA	NA	NA	NA
1953674:1953688	attL	GCATTAATGCCAACT	NA	NA	NA	NA
WP_022742711.1|1954183_1954759_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	2.9e-95
WP_022742712.1|1954758_1956210_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	71.2	2.9e-43
WP_022742713.1|1956199_1956802_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
WP_022742714.1|1956803_1958045_-	hypothetical protein	NA	A0A077KGW9	Edwardsiella_phage	49.6	4.5e-101
WP_001191865.1|1958041_1958398_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	49.1	1.6e-19
WP_022742715.1|1958410_1959088_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	35.5	4.6e-31
WP_000122818.1|1959068_1959938_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	9.1e-32
WP_000890115.1|1959934_1960237_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_022742716.1|1960236_1960947_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
WP_022742717.1|1960943_1963115_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_000228831.1|1963098_1963281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101348.1|1963322_1963727_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	44.8	1.8e-19
WP_000016414.1|1963726_1964173_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_001748488.1|1964173_1965658_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.0	4.0e-96
WP_000094504.1|1965638_1966184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748490.1|1966168_1966534_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
WP_022742718.1|1966530_1967115_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	3.2e-17
WP_023139348.1|1967108_1967564_-	DUF4054 domain-containing protein	NA	Q2NPC6	Xanthomonas_phage	46.0	1.2e-19
WP_001748493.1|1967570_1967918_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	40.2	3.0e-10
WP_001031915.1|1967921_1968950_-	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_001525451.1|1968949_1969432_-	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	48.8	1.1e-26
WP_023139349.1|1969433_1970780_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	3.2e-68
WP_000552017.1|1970776_1971466_-|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	49.6	4.5e-58
WP_023139350.1|1971506_1973027_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	7.5e-106
WP_022742723.1|1973026_1974448_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.0	1.8e-186
WP_022742724.1|1974413_1975166_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	75.6	5.3e-12
WP_001113128.1|1975236_1975419_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_085983312.1|1975644_1976085_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	84.3	3.5e-56
WP_001208103.1|1976105_1976594_-	lysozyme	NA	M9P0E5	Enterobacteria_phage	68.1	2.1e-57
WP_001526513.1|1976571_1976874_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000502119.1|1977040_1977499_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_022742726.1|1977776_1978322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139352.1|1978312_1978519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139353.1|1978996_1979926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023139354.1|1980474_1980816_-	antitermination protein from phage origin	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	1.1e-54
WP_023139355.1|1981155_1981467_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	84.8	6.1e-39
WP_021000145.1|1981463_1981658_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	6.1e-13
WP_022742730.1|1981654_1982254_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.9	5.0e-98
WP_024150651.1|1982317_1982623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024150652.1|1982815_1982968_-	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_023139357.1|1983174_1983447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022742732.1|1983443_1983839_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	6.4e-17
WP_157872077.1|1983851_1984394_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_022742734.1|1984305_1985313_-	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	67.5	1.8e-124
WP_001534383.1|1985356_1985851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033911.1|1985837_1986092_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001574209.1|1986190_1986589_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_024135672.1|1987019_1987199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103933.1|1987459_1987735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|1987738_1987945_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_000799627.1|1988020_1988356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022742735.1|1988496_1991187_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	75.6	2.2e-116
WP_001534364.1|1991179_1992010_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001033921.1|1992045_1992366_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_023139358.1|1992358_1992691_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	72.7	8.5e-15
WP_023139359.1|1993301_1993481_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	60.3	7.3e-13
WP_077907869.1|1993771_1994008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001575998.1|1994068_1994347_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_022742740.1|1994321_1995401_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.8	1.3e-101
WP_000722368.1|1995783_1996137_-	YebY family protein	NA	NA	NA	NA	NA
1995612:1995626	attR	AGTTGGCATTAATGC	NA	NA	NA	NA
WP_000979702.1|1996153_1997029_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|1997029_1997404_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|1997541_1997772_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 5
NZ_CP014358	Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 chromosome, complete genome	4933574	2073222	2151881	4933574	tail,portal,plate,transposase,head,protease,integrase,capsid,terminase,holin	Salmonella_phage(81.16%)	103	2079759:2079774	2153503:2153518
WP_000502119.1|2073222_2073681_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	33.9	5.1e-10
WP_000659236.1|2073861_2075067_-	lysine-N-methylase	NA	NA	NA	NA	NA
WP_000146802.1|2076888_2078292_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000287764.1|2078306_2078714_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000204899.1|2078713_2079082_+	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000795487.1|2079153_2080638_+	alpha-amylase	NA	NA	NA	NA	NA
2079759:2079774	attL	TGAAAATATCGATTTT	NA	NA	NA	NA
WP_000754695.1|2080677_2081103_-	lipoprotein	NA	NA	NA	NA	NA
WP_001535233.1|2081288_2082494_+	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_000790504.1|2082490_2082724_+	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000639596.1|2082988_2083375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000719036.1|2083494_2083809_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001276834.1|2084025_2085708_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067735.1|2085700_2086696_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000064163.1|2086688_2087396_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213257.1|2087395_2088766_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000046981.1|2088787_2089231_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000631669.1|2089227_2090445_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000132169.1|2090549_2091017_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000502811.1|2091021_2092026_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282115.1|2092022_2092436_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_000978276.1|2092435_2092813_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253410.1|2092812_2093550_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187355.1|2093559_2093829_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000616953.1|2093837_2094632_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103974.1|2094913_2095537_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524019.1|2095575_2095824_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844798.1|2095898_2096126_+	YodD family peroxide/acid resistance protein	NA	NA	NA	NA	NA
WP_000948794.1|2096435_2097251_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001119821.1|2097229_2098942_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	37.4	1.2e-19
WP_001178599.1|2099106_2099352_-	YodC family protein	NA	NA	NA	NA	NA
WP_000929134.1|2099368_2100280_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212264.1|2100455_2101376_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785978.1|2101364_2101835_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	1.2e-30
WP_001157322.1|2101815_2103246_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_000377041.1|2103319_2104015_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|2104106_2104406_-	membrane protein	NA	NA	NA	NA	NA
WP_001080680.1|2105055_2106252_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_024131109.1|2106512_2106701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2106711_2106924_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457662.1|2107378_2108647_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000394196.1|2108649_2109069_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000500831.1|2109195_2109357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093793.1|2110550_2110763_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	100.0	2.7e-30
WP_000842532.1|2110759_2111173_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	100.0	2.9e-73
WP_122815478.1|2111220_2111334_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	100.0	4.3e-11
WP_000836773.1|2111408_2111642_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	100.0	1.2e-36
WP_022742744.1|2111755_2112361_-|tail	tail fiber assembly protein	tail	A0A192Y8L2	Salmonella_phage	100.0	2.7e-107
WP_020899405.1|2112330_2113893_-	hypothetical protein	NA	A0A192Y7M1	Salmonella_phage	100.0	1.0e-288
WP_001207832.1|2113879_2114467_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000785578.1|2114469_2115549_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_000605051.1|2115541_2115955_-	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_001273648.1|2115959_2116493_-|plate	phage baseplate assembly protein	plate	A0A192Y8K5	Salmonella_phage	100.0	8.4e-97
WP_001066630.1|2116492_2117551_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_000863827.1|2117547_2118888_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	100.0	5.2e-252
WP_000785390.1|2118921_2120850_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	100.0	0.0e+00
WP_022742746.1|2120934_2121228_-	hypothetical protein	NA	A0A192Y6C5	Salmonella_phage	100.0	2.6e-47
WP_000515952.1|2121257_2121614_-|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_001007996.1|2121613_2123110_-|tail	tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	100.0	2.1e-278
WP_000497740.1|2123099_2123264_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	100.0	1.3e-24
WP_000779216.1|2123267_2123828_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	100.0	8.0e-106
WP_001135699.1|2123824_2124337_-	hypothetical protein	NA	A0A192Y6D2	Salmonella_phage	100.0	3.5e-92
WP_000702410.1|2124308_2124713_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	100.0	3.2e-72
WP_000927378.1|2124709_2125033_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000601352.1|2125035_2125236_-	hypothetical protein	NA	A0A192Y7K5	Salmonella_phage	100.0	1.8e-28
WP_000257526.1|2125286_2126492_-|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	100.0	7.0e-224
WP_001193639.1|2126506_2127157_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_020899404.1|2127134_2128376_-|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	2.9e-241
WP_000605609.1|2128375_2128558_-	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000088175.1|2128569_2130303_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.3	0.0e+00
WP_000929171.1|2130299_2130794_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	100.0	1.7e-88
WP_001135098.1|2130919_2131270_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.8	9.8e-62
WP_001379492.1|2131320_2131653_-	hypothetical protein	NA	A0A192Y5Y1	Salmonella_phage	100.0	2.8e-58
WP_001530346.1|2132115_2132508_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	100.0	2.8e-65
WP_001624504.1|2132504_2133119_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	100.0	5.7e-113
WP_000422366.1|2133118_2133400_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	45.2	9.7e-20
WP_001283169.1|2133386_2133773_-	membrane protein	NA	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_001624505.1|2133918_2134176_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	100.0	3.1e-41
WP_020899401.1|2134326_2135079_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	100.0	1.8e-145
WP_020899400.1|2135092_2136082_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	99.1	4.0e-193
WP_020899399.1|2136089_2136950_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.7	8.4e-163
WP_001241579.1|2136966_2137356_-	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	100.0	3.7e-70
WP_000066908.1|2137352_2138246_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_001684745.1|2138245_2138728_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000061500.1|2138729_2139548_-	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_000620702.1|2139544_2139769_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_001087402.1|2139765_2140923_-	peptidase	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000509731.1|2140919_2141474_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|2141502_2141727_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020636.1|2141824_2142520_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001067432.1|2142725_2143064_+	hypothetical protein	NA	A0A1C9IHZ4	Salmonella_phage	100.0	7.0e-57
WP_023891434.1|2143026_2143251_-	hypothetical protein	NA	A0A1C9IHY8	Salmonella_phage	100.0	1.6e-33
WP_000997191.1|2143790_2144162_+	hypothetical protein	NA	A0A192Y6G0	Salmonella_phage	100.0	2.5e-63
WP_000080416.1|2144219_2145047_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	100.0	2.6e-153
WP_000008351.1|2145183_2145723_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000215886.1|2145793_2146327_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	100.0	2.5e-101
WP_000224241.1|2146328_2146586_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_020899398.1|2146596_2147178_+	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	100.0	4.7e-109
WP_001061334.1|2147181_2147751_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000414876.1|2147775_2148018_+	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_000532847.1|2148019_2149009_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000598920.1|2149300_2150098_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001738920.1|2150469_2150760_+	DUF4102 domain-containing protein	NA	H2BDA3	Pseudomonas_phage	49.1	3.0e-08
WP_001219015.1|2151407_2151881_+	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
2153503:2153518	attR	TGAAAATATCGATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP014358	Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 chromosome, complete genome	4933574	2238585	2249091	4933574		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2238585_2239899_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|2239925_2241005_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|2241009_2241783_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|2241779_2242772_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|2242777_2243329_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|2243329_2244208_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|2244255_2245155_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|2245154_2246240_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|2246616_2247510_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111841.1|2247687_2249091_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
>prophage 7
NZ_CP014358	Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 chromosome, complete genome	4933574	2317399	2326570	4933574	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|2317399_2319433_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2319673_2320132_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197952.1|2320303_2320834_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2320890_2321358_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2321404_2322124_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2322120_2323806_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|2324028_2324760_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2324819_2324927_+	protein YohO	NA	NA	NA	NA	NA
WP_000824855.1|2324907_2325639_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2325622_2326570_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 8
NZ_CP014358	Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 chromosome, complete genome	4933574	2345808	2412203	4933574	tail,lysis,holin	Salmonella_phage(30.0%)	59	NA	NA
WP_000989296.1|2345808_2346504_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|2346657_2347542_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|2347718_2348438_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|2348434_2348680_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136409.1|2348884_2350126_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|2350119_2351355_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|2351429_2352440_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|2352455_2353976_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|2354109_2355108_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628631.1|2355606_2356629_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|2356778_2357921_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|2357935_2358604_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|2358933_2359791_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|2359779_2360169_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000443208.1|2360173_2361541_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022915.1|2361757_2362645_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|2362677_2364000_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488255.1|2364043_2366035_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|2366380_2367850_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548308.1|2368039_2368903_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137961.1|2369023_2370073_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873909.1|2370151_2371009_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	2.2e-22
WP_000854414.1|2371073_2372762_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|2372778_2373717_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|2373716_2374847_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|2375215_2376397_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213882.1|2376461_2377127_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|2377128_2377251_-	membrane protein	NA	NA	NA	NA	NA
WP_010989043.1|2377638_2377893_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|2378216_2378789_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169350.1|2379001_2379988_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|2380017_2380737_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|2381150_2381723_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957746.1|2382048_2383605_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561748.1|2383711_2385517_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|2385526_2386621_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137764.1|2386620_2387646_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203622.1|2387647_2389237_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.5	8.5e-20
WP_001094639.1|2389240_2389585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|2389975_2391166_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234836.1|2391193_2391889_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|2392040_2393801_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|2393925_2394210_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033440.1|2394318_2394939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|2394966_2395974_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|2396153_2396381_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|2396412_2398173_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|2398453_2398957_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|2398984_2399275_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|2399622_2401452_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|2401505_2401949_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|2402326_2402854_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|2402856_2404098_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|2404690_2405020_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|2405316_2406648_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|2406676_2407045_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|2407059_2408049_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001113462.1|2410911_2411115_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|2411411_2412203_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 9
NZ_CP014358	Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 chromosome, complete genome	4933574	2751788	2857330	4933574	tail,portal,tRNA,lysis,transposase,head,integrase,capsid,terminase,holin	Salmonella_phage(35.0%)	109	2776333:2776349	2865234:2865250
WP_000940032.1|2751788_2752520_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_000553467.1|2752638_2753442_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_000174944.1|2753586_2754465_+	alpha/beta hydrolase	NA	A0A1C9C5K3	Heterosigma_akashiwo_virus	24.7	3.5e-15
WP_000985204.1|2754646_2755690_+	anaerobic sulfite reductase subunit A	NA	NA	NA	NA	NA
WP_000017587.1|2755693_2756512_+	anaerobic sulfite reductase subunit B	NA	NA	NA	NA	NA
WP_000020685.1|2756522_2757536_+	sulfite reductase subunit C	NA	NA	NA	NA	NA
WP_000111027.1|2757536_2758523_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_000805728.1|2758513_2759152_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_000982961.1|2759277_2760555_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_001173729.1|2760549_2761689_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_000919178.1|2761884_2763138_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	1.3e-100
WP_000883146.1|2763462_2764653_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_001187150.1|2764834_2766379_+	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000100008.1|2766739_2768071_+	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_001100652.1|2768153_2770298_+	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_000856793.1|2770353_2771814_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	1.7e-46
WP_000717694.1|2771862_2772201_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000625591.1|2772277_2773615_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	29.2	1.8e-10
WP_001054236.1|2773611_2774376_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001670672.1|2774377_2775808_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	2.0e-15
2776333:2776349	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000970045.1|2776457_2780345_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.6	1.4e-127
WP_001747289.1|2780366_2780600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734248.1|2780600_2782145_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_001134566.1|2782195_2782747_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000253558.1|2782771_2783407_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_000361663.1|2783410_2784772_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_001048530.1|2784782_2785676_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000995703.1|2785791_2786640_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000684022.1|2786678_2787596_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001276365.1|2787617_2788814_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_001022463.1|2788929_2789856_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001196290.1|2789893_2790154_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_000986043.1|2790265_2790646_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000818972.1|2790645_2791377_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399380.1|2791388_2792117_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000102232.1|2792128_2793034_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068341.1|2793030_2793711_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000002559.1|2793984_2794959_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790154.1|2794975_2796775_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_010989047.1|2797179_2798673_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_001542312.1|2799133_2799271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015589559.1|2799983_2800148_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_015701342.1|2800727_2800793_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_001738443.1|2800855_2801068_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_010989049.1|2801174_2801402_+	PagK-like protein	NA	NA	NA	NA	NA
WP_000143154.1|2801498_2802077_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_000593433.1|2802066_2802891_-|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_022742779.1|2802887_2805260_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	65.4	2.0e-89
WP_000178853.1|2805313_2805556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514917.1|2805594_2808957_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246126.1|2809018_2809666_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000662739.1|2809563_2810301_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_001152689.1|2810307_2811006_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000447369.1|2811015_2811345_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_022742781.1|2811347_2814443_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.1e-276
WP_010989052.1|2814414_2814753_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2814749_2815145_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971953.1|2815195_2815942_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_022742782.1|2815949_2816351_-	hypothetical protein	NA	Q9G0F3	Phage_Gifsy-1	99.0	4.0e-51
WP_000677089.1|2816347_2816926_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|2816912_2817290_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201485.1|2817300_2817666_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_022742784.1|2817723_2818752_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.3e-114
WP_000011260.1|2818806_2819154_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189498.1|2819166_2820663_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
WP_000831821.1|2820652_2822233_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2822229_2822433_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623088.1|2822416_2824348_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_001102153.1|2824319_2824865_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000669689.1|2825150_2825552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603581.1|2825808_2826312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050955063.1|2826639_2827086_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	9.3e-57
WP_022742788.1|2827118_2827733_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	93.6	2.2e-109
WP_021000643.1|2827732_2828014_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_001294873.1|2828000_2828390_-	membrane protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_023221874.1|2828479_2828668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024150660.1|2829194_2829620_-	subtilase	NA	NA	NA	NA	NA
WP_022742790.1|2829752_2830478_-	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	66.2	4.0e-81
WP_022742791.1|2830678_2831257_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.1e-49
WP_050196634.1|2831271_2832261_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	3.5e-189
WP_024150661.1|2832268_2833129_-	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	99.3	9.2e-162
WP_000767086.1|2833145_2833535_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_024150662.1|2834423_2834906_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	1.8e-85
WP_022742797.1|2834907_2835867_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.2e-117
WP_000620702.1|2835863_2836088_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_031609052.1|2836084_2837227_-	peptidase	NA	A0A1C9IHV9	Salmonella_phage	98.2	1.0e-208
WP_023139406.1|2837223_2837778_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	1.2e-101
WP_001191666.1|2837806_2838031_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|2838128_2838824_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_000917563.1|2839177_2839336_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	100.0	2.4e-23
WP_022742800.1|2839357_2839708_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_022742801.1|2839834_2842762_+	exodeoxyribonuclease VIII	NA	H6WRX1	Salmonella_phage	98.2	0.0e+00
WP_022742802.1|2842724_2843882_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	4.7e-217
WP_001237031.1|2843924_2844164_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001670787.1|2844204_2844489_+	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_022742803.1|2844466_2845696_-|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	93.9	5.4e-232
WP_000589087.1|2846193_2846673_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812017.1|2846669_2847626_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168374.1|2847625_2848276_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000003307.1|2848307_2848883_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_014344135.1|2848879_2849044_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_022742804.1|2849307_2850930_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000083343.1|2850914_2851652_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2851782_2853117_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001526875.1|2853134_2854034_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188414.1|2854136_2854724_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2854785_2855169_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2855487_2856177_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2856292_2857330_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
2865234:2865250	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 10
NZ_CP014358	Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 chromosome, complete genome	4933574	4494775	4515194	4933574	tail,plate	Burkholderia_phage(47.37%)	25	NA	NA
WP_000587738.1|4494775_4495504_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	5.6e-35
WP_010989092.1|4495700_4495991_-	membrane protein	NA	NA	NA	NA	NA
WP_000084331.1|4496239_4496695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001526208.1|4496691_4497297_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368196.1|4497301_4499047_-|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	3.2e-52
WP_000359500.1|4499049_4499682_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_000951736.1|4499674_4500790_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_001093501.1|4500780_4501140_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_001095011.1|4501303_4502851_-	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_000703632.1|4502850_4503780_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	8.8e-150
WP_000593182.1|4503776_4504139_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|4504466_4505189_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|4505198_4506242_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|4506229_4506439_-	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_001262499.1|4507390_4509745_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|4509841_4509970_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|4509929_4510247_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|4510298_4510823_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_000729852.1|4510822_4512250_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|4512239_4512437_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|4512433_4512889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|4513048_4513363_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|4513375_4513981_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|4513983_4514271_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|4514846_4515194_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 1
NZ_CP014359	Salmonella enterica subsp. enterica serovar Typhimurium strain YU15 plasmid pYU15_94, complete sequence	94075	40862	50158	94075	transposase	Escherichia_phage(28.57%)	11	NA	NA
WP_001541564.1|40862_41279_+	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
WP_001527010.1|41462_41798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001541562.1|41854_42421_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000728917.1|42452_43394_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	2.0e-72
WP_000427676.1|43808_45014_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000064274.1|45013_45988_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.2	5.1e-84
WP_022743179.1|46069_47344_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.9	3.9e-156
WP_000925627.1|47343_47766_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	1.0e-28
WP_000490265.1|48276_48747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000369839.1|48739_49096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|49477_50158_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
