The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014538	Acinetobacter baumannii strain XH860 chromosome, complete genome	3846621	1138307	1153104	3846621		Acinetobacter_phage(100.0%)	10	NA	NA
WP_001187844.1|1138307_1138856_-	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
WP_000893683.1|1139118_1140618_+	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
WP_001076817.1|1140619_1142995_+	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
WP_001164226.1|1143001_1143985_+	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
WP_000066126.1|1143995_1144691_-	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_000608304.1|1144700_1145507_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
WP_001982145.1|1145516_1146566_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000281127.1|1146921_1149654_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	99.9	0.0e+00
WP_000960548.1|1149733_1152433_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
WP_000566784.1|1152528_1153104_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
>prophage 2
NZ_CP014538	Acinetobacter baumannii strain XH860 chromosome, complete genome	3846621	1493225	1508215	3846621	integrase	Acinetobacter_phage(96.0%)	26	1487334:1487348	1507390:1507404
1487334:1487348	attL	TGATGAGCTTTAATA	NA	NA	NA	NA
WP_000773619.1|1493225_1494488_+|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	100.0	3.8e-249
WP_000910238.1|1494493_1494763_-	hypothetical protein	NA	A0A0N7IRE8	Acinetobacter_phage	100.0	3.5e-43
WP_000005652.1|1494763_1495021_-	hypothetical protein	NA	A0A0P0J0B1	Acinetobacter_phage	96.5	3.2e-46
WP_000048742.1|1495024_1495309_-	hypothetical protein	NA	A0A0P0HSI5	Acinetobacter_phage	94.7	1.3e-43
WP_000566309.1|1495301_1495712_-	hypothetical protein	NA	A0A0P0I8H3	Acinetobacter_phage	100.0	7.6e-13
WP_000654847.1|1495715_1495961_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
WP_000698522.1|1495962_1496964_-	hypothetical protein	NA	A0A0P0IKV7	Acinetobacter_phage	97.3	6.5e-183
WP_001207471.1|1496960_1498082_-	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	100.0	5.2e-213
WP_000064462.1|1498093_1498417_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	96.3	9.7e-56
WP_001101036.1|1498419_1498860_-	hypothetical protein	NA	A0A0N7IRE9	Acinetobacter_phage	95.9	3.1e-73
WP_001129670.1|1499066_1499570_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	82.6	1.2e-65
WP_000048049.1|1499572_1500574_-	hypothetical protein	NA	A0A0P0IRH5	Acinetobacter_phage	100.0	4.2e-182
WP_000370485.1|1500624_1500840_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_001093662.1|1500854_1501619_-	LexA family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	98.8	1.6e-144
WP_000996060.1|1501727_1501979_+	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	95.2	2.4e-38
WP_000049332.1|1501989_1502310_+	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	88.7	3.2e-43
WP_001095606.1|1502365_1502656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001033653.1|1502652_1503699_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	1.7e-109
WP_001110396.1|1503695_1504646_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	64.2	2.9e-100
WP_038338684.1|1504638_1505388_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	99.2	6.2e-138
WP_000647820.1|1505384_1505807_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	100.0	2.9e-76
WP_002018225.1|1505856_1506219_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
WP_001288422.1|1506211_1506436_+	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
WP_000100185.1|1506435_1506831_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	100.0	1.6e-68
WP_000783470.1|1506827_1507328_+	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	100.0	3.1e-93
WP_000171353.1|1507435_1508215_+	hypothetical protein	NA	A0A0P0J0C5	Acinetobacter_phage	32.3	1.7e-29
1507390:1507404	attR	TATTAAAGCTCATCA	NA	NA	NA	NA
>prophage 3
NZ_CP014538	Acinetobacter baumannii strain XH860 chromosome, complete genome	3846621	1568196	1576077	3846621	transposase	Acinetobacter_phage(100.0%)	12	NA	NA
WP_001104855.1|1568196_1568424_+	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	96.0	5.6e-34
WP_038338795.1|1568501_1568891_+	hypothetical protein	NA	A0A0P0IYC0	Acinetobacter_phage	95.3	1.8e-64
WP_000720514.1|1569090_1569432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735265.1|1569435_1569762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001226299.1|1569818_1570310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000124482.1|1570329_1570590_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000096283.1|1570755_1571655_+	alpha/beta hydrolase	NA	A0A0P0J0J7	Acinetobacter_phage	85.4	4.2e-149
WP_031974499.1|1571993_1572539_+	N-acetylmuramidase	NA	J7I0Y1	Acinetobacter_phage	99.4	5.2e-102
WP_000999701.1|1572727_1573408_+	hypothetical protein	NA	A0A0P0IKS6	Acinetobacter_phage	100.0	4.6e-116
WP_001109862.1|1573418_1574066_+	hypothetical protein	NA	J7I4R4	Acinetobacter_phage	100.0	3.6e-118
WP_000151893.1|1574072_1574666_+	hypothetical protein	NA	A0A0P0HSM0	Acinetobacter_phage	100.0	5.1e-103
WP_085942227.1|1574911_1576077_-|transposase	IS3-like element ISAba22 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	100.0	7.1e-165
>prophage 4
NZ_CP014538	Acinetobacter baumannii strain XH860 chromosome, complete genome	3846621	2455366	2482924	3846621	plate,transposase	Pandoravirus(25.0%)	24	NA	NA
WP_085940413.1|2455366_2456456_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000342966.1|2456631_2456919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001007559.1|2457345_2458005_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_085916980.1|2458322_2458778_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000204295.1|2458857_2460015_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000813815.1|2460148_2461327_-	cyanate transporter	NA	NA	NA	NA	NA
WP_000646729.1|2461326_2461809_-	nucleoside deaminase	NA	S4VYT2	Pandoravirus	40.6	8.3e-19
WP_085916981.1|2461824_2462472_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000460184.1|2462644_2463496_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000972583.1|2463498_2464452_-	M15 family metallopeptidase	NA	A0A0H4TGB9	Bacillus_phage	33.3	2.8e-10
WP_000046451.1|2464459_2465062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000083625.1|2465074_2465881_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000471445.1|2465898_2467263_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000020713.1|2467279_2468374_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_002001416.1|2468397_2471079_-	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.8	1.3e-81
WP_001043692.1|2471307_2472240_-|transposase	IS5-like element ISAba13 family transposase	transposase	Q1MVF0	Enterobacteria_phage	39.6	9.7e-56
WP_000168112.1|2472346_2472610_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001072410.1|2472626_2473394_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000557241.1|2473396_2474356_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_000556914.1|2474393_2478218_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000591882.1|2478248_2479661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001190395.1|2479657_2480656_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000568832.1|2480619_2482431_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001047031.1|2482447_2482924_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP014538	Acinetobacter baumannii strain XH860 chromosome, complete genome	3846621	2642617	2726659	3846621	tail,capsid,head,transposase,integrase,protease,portal,terminase	Acinetobacter_phage(31.91%)	93	2710531:2710550	2732676:2732695
WP_001067855.1|2642617_2643322_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018326.1|2643451_2644267_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_000902128.1|2644420_2644600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|2644691_2645396_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000904905.1|2645407_2646067_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.4e-37
WP_001067855.1|2649090_2649795_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|2649865_2650726_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_029642339.1|2650908_2651448_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.8	1.2e-85
WP_001067855.1|2651477_2652182_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000205077.1|2652957_2654988_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_001986427.1|2655253_2656612_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	81.0	2.0e-54
WP_000013374.1|2656670_2657933_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.6	2.9e-18
WP_001084867.1|2658082_2659117_+	dihydroorotase	NA	NA	NA	NA	NA
WP_001982681.1|2659101_2659764_+	ribonuclease T	NA	L0N5X9	Acaryochloris_phage	35.4	2.0e-07
WP_000364465.1|2660041_2662156_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000077974.1|2662214_2663459_-	NADH:flavin oxidoreductase/NADH oxidase family protein	NA	NA	NA	NA	NA
WP_000550783.1|2663644_2665234_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	3.2e-19
WP_000008530.1|2665211_2666222_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000536107.1|2666221_2667274_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_085916950.1|2667303_2669016_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000277826.1|2669154_2672370_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	37.7	2.8e-25
WP_000084042.1|2672602_2673982_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.6	7.9e-38
WP_001289239.1|2674116_2675760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001292948.1|2675759_2676503_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_001048900.1|2676525_2677389_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000919363.1|2677392_2678100_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_000959396.1|2678180_2678582_-	YraN family protein	NA	NA	NA	NA	NA
WP_001275986.1|2678775_2679612_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.9	4.0e-45
WP_000140381.1|2679705_2680092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887365.1|2680094_2680985_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_000950251.1|2681092_2681695_+	amino acid transporter	NA	NA	NA	NA	NA
WP_000896577.1|2681753_2682395_-	cation transporter	NA	NA	NA	NA	NA
WP_000058923.1|2682460_2682862_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000129799.1|2682916_2683168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005670.1|2683377_2684610_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_001187364.1|2684606_2685815_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_000775459.1|2685846_2687169_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_001150150.1|2687236_2687866_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_000893185.1|2687930_2688491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000003720.1|2688487_2688772_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_000115731.1|2689208_2690573_+|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	42.7	2.9e-85
WP_001186629.1|2690556_2690751_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	54.1	2.7e-13
WP_002018743.1|2690845_2691016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265243.1|2690984_2691353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000095892.1|2691352_2691862_-	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	57.4	3.8e-46
WP_000774828.1|2691845_2692112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001104854.1|2692186_2692411_-	hypothetical protein	NA	A0A0P0I8G9	Acinetobacter_phage	95.9	1.6e-33
WP_002018761.1|2692412_2694449_-	hypothetical protein	NA	A0A0P0IRG3	Acinetobacter_phage	95.0	0.0e+00
WP_000078482.1|2694502_2697337_-	hypothetical protein	NA	A0A1B1P9G8	Acinetobacter_phage	36.1	4.9e-167
WP_001026372.1|2697287_2697683_-	hypothetical protein	NA	A0A1B1P9H4	Acinetobacter_phage	52.8	1.6e-28
WP_000587324.1|2697679_2698189_-	DUF1833 family protein	NA	NA	NA	NA	NA
WP_000882463.1|2698191_2698653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001031955.1|2702324_2702657_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	43.1	1.1e-14
WP_000498808.1|2702733_2702949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001074127.1|2702984_2703500_-|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_001062223.1|2703501_2703978_-	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	66.2	6.4e-56
WP_000598741.1|2704049_2704424_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	44.5	1.7e-19
WP_000235306.1|2704423_2704909_-	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	45.3	6.4e-27
WP_001139340.1|2704912_2705269_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	50.0	1.9e-20
WP_000631202.1|2705270_2705558_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	46.5	2.5e-18
WP_000666093.1|2705554_2705731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000137059.1|2705778_2706951_-|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	47.2	9.2e-88
WP_000375469.1|2706943_2707606_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	62.3	6.2e-73
WP_000108390.1|2707598_2708825_-|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.9	3.9e-182
WP_000125540.1|2708821_2710516_-|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	82.6	2.2e-271
2710531:2710550	attL	AAAAAACCGCCCGAAGGCGG	NA	NA	NA	NA
WP_001191044.1|2710687_2710879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001219090.1|2710898_2711381_-|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	48.4	5.9e-25
WP_000202128.1|2711527_2711752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776297.1|2711796_2712096_-	HNH endonuclease	NA	A0A0R6PH58	Moraxella_phage	61.2	1.1e-21
WP_001079329.1|2712025_2712319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000063945.1|2712324_2712507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433065.1|2712496_2713027_-	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	44.0	4.4e-37
WP_000856318.1|2713042_2713441_-	hypothetical protein	NA	T1S9H7	Salmonella_phage	38.0	4.8e-12
WP_000238616.1|2713516_2713735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000780217.1|2714444_2714720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060708.1|2715099_2715597_-	hypothetical protein	NA	A0A0P0IY98	Acinetobacter_phage	34.2	1.4e-16
WP_001003589.1|2715596_2715767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000360556.1|2715763_2716144_-	hypothetical protein	NA	A0A0D4DBZ8	Acinetobacter_phage	44.4	3.0e-16
WP_001288609.1|2716145_2716430_-	hypothetical protein	NA	A0A1B1P9J7	Acinetobacter_phage	63.8	3.5e-33
WP_002018656.1|2716422_2716785_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	98.3	4.3e-68
WP_000801891.1|2716834_2717179_-	hypothetical protein	NA	A0A068CDI0	Acinetobacter_phage	75.2	8.0e-40
WP_000180364.1|2717450_2718863_-	replicative DNA helicase	NA	I2GUI4	Acinetobacter_phage	41.6	6.5e-80
WP_000543838.1|2718859_2719930_-	DUF1376 domain-containing protein	NA	A9YWY6	Burkholderia_phage	44.5	5.4e-34
WP_001005282.1|2719929_2720226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000418954.1|2720587_2721244_+	helix-turn-helix domain-containing protein	NA	A0A0R6PJ00	Moraxella_phage	36.9	1.2e-31
WP_001071955.1|2721484_2722207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001260743.1|2722219_2722636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000073107.1|2722858_2723293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001010136.1|2723289_2723838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000886225.1|2723849_2724239_+	hypothetical protein	NA	J7HXR6	Acinetobacter_phage	96.1	1.2e-68
WP_001293231.1|2724235_2724586_+	hypothetical protein	NA	J7I0Y4	Acinetobacter_phage	100.0	3.4e-62
WP_000826302.1|2724588_2724867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046989.1|2725285_2726659_+|integrase	integrase family protein	integrase	A0A0R6PGY7	Moraxella_phage	41.5	1.9e-76
2732676:2732695	attR	AAAAAACCGCCCGAAGGCGG	NA	NA	NA	NA
>prophage 6
NZ_CP014538	Acinetobacter baumannii strain XH860 chromosome, complete genome	3846621	2732110	2760784	3846621	terminase,capsid	Acinetobacter_phage(93.55%)	38	NA	NA
WP_001019739.1|2732110_2732656_-	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
WP_000433907.1|2732697_2733087_-	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_000598554.1|2733154_2736580_-	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
WP_000835160.1|2736572_2736935_-	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_000368388.1|2736931_2737438_-	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000277448.1|2737437_2737836_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000721057.1|2737928_2738516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000046573.1|2738606_2742917_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
WP_001275792.1|2743044_2743308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721572.1|2743309_2743990_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_000274931.1|2744094_2744553_-	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000335868.1|2744561_2744861_-	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_001185585.1|2745363_2745879_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000094278.1|2745948_2746866_-	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_000002408.1|2746918_2748097_-	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
WP_000064593.1|2748096_2748450_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000749909.1|2748546_2749068_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_001277696.1|2749176_2749395_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_001984404.1|2749396_2749840_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	94.6	2.0e-75
WP_000539749.1|2749796_2750165_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
WP_000248411.1|2750136_2750547_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
WP_000235282.1|2750598_2750892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000540685.1|2750899_2751097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000524257.1|2751165_2751534_-	hypothetical protein	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
WP_000008459.1|2751534_2751915_-	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
WP_000524488.1|2751918_2752254_-	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
WP_000852265.1|2752298_2753249_-	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
WP_000056390.1|2753262_2754054_-	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
WP_000589038.1|2754140_2754455_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
WP_001291451.1|2754506_2754659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004550.1|2754674_2754905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000146970.1|2754901_2756008_-|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
WP_000301495.1|2756017_2757358_-	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
WP_001132930.1|2757397_2758690_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
WP_000729387.1|2758649_2759165_-	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_000435230.1|2759223_2759865_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
WP_000378523.1|2759833_2760268_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
WP_001136773.1|2760328_2760784_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
>prophage 7
NZ_CP014538	Acinetobacter baumannii strain XH860 chromosome, complete genome	3846621	2764742	2777090	3846621		Acinetobacter_phage(95.65%)	24	NA	NA
WP_001277128.1|2764742_2765219_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
WP_000100162.1|2765215_2765617_-	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
WP_000462878.1|2765616_2766009_-	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
WP_000647826.1|2766001_2766340_-	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
WP_001003671.1|2766336_2767137_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
WP_000064627.1|2767139_2768021_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
WP_000602535.1|2768013_2768238_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
WP_001180660.1|2768309_2768582_-	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.0	7.2e-36
WP_000048916.1|2768643_2768964_-	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_000703023.1|2768974_2769163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052252.1|2769267_2770020_+	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
WP_000370485.1|2770034_2770250_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000048052.1|2770301_2771309_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_001129676.1|2771310_2771814_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000845537.1|2771952_2772156_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_000051960.1|2772162_2772405_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_001101038.1|2772598_2773042_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000656405.1|2773041_2773332_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
WP_000064463.1|2773324_2773648_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
WP_001207474.1|2773659_2774781_+	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
WP_000698529.1|2774777_2775710_+	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
WP_000654846.1|2775711_2775963_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
WP_000147323.1|2775963_2776371_+	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000004579.1|2776367_2777090_+	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
>prophage 8
NZ_CP014538	Acinetobacter baumannii strain XH860 chromosome, complete genome	3846621	3534910	3616965	3846621	tRNA,transposase,integrase	uncultured_Caudovirales_phage(22.22%)	80	3571836:3571895	3616255:3617120
WP_000216739.1|3534910_3535843_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000907680.1|3535892_3537089_-	putative lipid II flippase FtsW	NA	NA	NA	NA	NA
WP_000908243.1|3537113_3538460_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_000942498.1|3538620_3538872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001278225.1|3538892_3540746_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_001991212.1|3540742_3541006_-	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_000608730.1|3541149_3542070_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	6.7e-33
WP_000011159.1|3542216_3543032_+	DsbC family protein	NA	NA	NA	NA	NA
WP_000805827.1|3543276_3544578_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000063593.1|3544633_3545773_+	threonine synthase	NA	NA	NA	NA	NA
WP_003384760.1|3545879_3546926_-	D-alanyl-D-alanine endopeptidase PBP7/8	NA	NA	NA	NA	NA
WP_000633799.1|3547138_3547774_+	response regulator	NA	NA	NA	NA	NA
WP_002001070.1|3547829_3549353_+	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	26.3	2.3e-06
WP_000840549.1|3549377_3550799_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_000942504.1|3550802_3551987_-	peptidase S41	NA	A0A0R6PIZ1	Moraxella_phage	23.0	8.3e-12
WP_000128749.1|3552002_3553550_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_000881094.1|3553675_3554746_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000586912.1|3554745_3555846_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000673449.1|3555989_3557438_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	5.5e-50
WP_001151592.1|3557430_3557838_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_001988710.1|3557876_3558515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354154.1|3558645_3558864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493866.1|3558923_3559583_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.6	1.5e-34
WP_001083669.1|3559625_3560918_-	DNA adenine methylase	NA	A0A0P0BWH0	Ostreococcus_mediterraneus_virus	32.6	2.5e-38
WP_001292506.1|3560914_3562000_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	36.6	5.1e-48
WP_000543541.1|3562015_3562474_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_000738520.1|3562631_3564029_-	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	5.4e-34
WP_000780326.1|3564086_3564425_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_000894500.1|3564704_3564932_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_000010465.1|3564997_3565855_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001144971.1|3565937_3567725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001082319.1|3568107_3568911_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3568910_3569747_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000743213.1|3569866_3570091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001120888.1|3570301_3571795_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
3571836:3571895	attL	CACAGCGCCGCGGCAGGGATCCGCCGTGCTGGTTGTCGGAAAAGGAGCCGCTAGTGGGAA	NA	NA	NA	NA
WP_000512977.1|3572032_3572437_+	hypothetical protein	NA	NA	NA	NA	NA
3571836:3571895	attL	CACAGCGCCGCGGCAGGGATCCGCCGTGCTGGTTGTCGGAAAAGGAGCCGCTAGTGGGAA	NA	NA	NA	NA
WP_000088605.1|3572414_3573038_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089073.1|3573119_3574337_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_001144964.1|3574419_3576216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087486612.1|3576573_3577664_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001046004.1|3577769_3578591_+	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_001992510.1|3579255_3579810_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000262332.1|3579817_3580150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947913.1|3580251_3581341_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001277980.1|3581345_3582812_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.6	2.3e-213
WP_000034564.1|3582824_3583676_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
WP_001095006.1|3583743_3584043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529372.1|3584115_3584487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002017214.1|3584861_3586292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000081835.1|3586284_3587400_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000417085.1|3587429_3588350_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000573060.1|3588354_3590265_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000736396.1|3590265_3590976_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
WP_071543477.1|3591180_3591474_+	hypothetical protein	NA	NA	NA	NA	NA
3591233:3591429	attR	CACAGCGCCGCGGCAGGGATCCGCCGTGCTGGTTGTCGGAAAAGGAGCCGCTAGTGGGAAAGAGGAGGGTAAATTTTCAGCGTTGCTGGCTCCCCGTCAGCCGGATTGGGTTGCATCGCAGGGGTGTCGAAAGAGTCAACTGCGGTCCAAAGCTGTTGGACTTGGGTGAAAAGGGCGTTTATTCTTCCTATACGTTG	NA	NA	NA	NA
WP_000251875.1|3591367_3591670_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
3591233:3591429	attR	CACAGCGCCGCGGCAGGGATCCGCCGTGCTGGTTGTCGGAAAAGGAGCCGCTAGTGGGAAAGAGGAGGGTAAATTTTCAGCGTTGCTGGCTCCCCGTCAGCCGGATTGGGTTGCATCGCAGGGGTGTCGAAAGAGTCAACTGCGGTCCAAAGCTGTTGGACTTGGGTGAAAAGGGCGTTTATTCTTCCTATACGTTG	NA	NA	NA	NA
WP_001043260.1|3591756_3592572_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940413.1|3592664_3593754_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000573066.1|3594176_3596087_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000736393.1|3596087_3596798_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	5.3e-06
WP_000168733.1|3597109_3597379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000798673.1|3597432_3597789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001006517.1|3597834_3598152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886984.1|3598358_3599291_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	28.8	1.7e-23
WP_001085038.1|3599391_3599619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000192314.1|3599619_3601122_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_000157684.1|3601206_3602370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370460.1|3602390_3602972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144964.1|3603258_3605055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087486612.1|3605412_3606503_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001046004.1|3606608_3607430_+	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_001992510.1|3608094_3608649_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_000262332.1|3608656_3608989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947913.1|3609090_3610180_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001277980.1|3610184_3611651_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	79.6	2.3e-213
WP_000034564.1|3611663_3612515_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	45.9	8.2e-70
WP_001095006.1|3612582_3612882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000529372.1|3612954_3613326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002020149.1|3613700_3614339_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000573060.1|3614343_3616254_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000736396.1|3616254_3616965_-|transposase	heteromeric transposase endonuclease subunit TnsA	transposase	I6WI48	Vibriophage	29.3	4.1e-06
3616255:3617120	attR	TTAGATATTCCTCGCAAATGCATCATTTTGGTTCACCCATATCACTGTTTCAGCCGTTAAAGGGCAATACAAGTCACAAGCAATCATGCGCTTTGCCACTAATGCCCAAACTTGGTGAATTCCTTTTAAAACATTGGTTTTATCTTTAAAAATATGGGCAGGTAATTGATTAATTGTTGATTGACCTAACTCTTGTAGGGTATCGAGTAATAGTTGTTGATCAACGGCACCTACATGAGAGCGTCTAAATTTTTTTAAGAAATTAATATTTTCCCAATACTGATCATATAATCTTGTTTCACTGATAATTTTGAACTTCCATCCTTTATCAGCAGCAAAACGATGGGCTGCTCTGAATTTTGGTTTTAACTTATCCCAGTCCTCAACAAGCTTTTTCTTAGGCTTAATTTCGATGAGCATTGGTACAGGAAAATCCTCAAAATCATCACAATTCGAGCTTGAAAACTGCACTAAAAAGTCAGGAGTGTAGGTTGATTGGTTACCCAATTCAGTGATGTAGGGGATAACTACAGGTTGACCGATAACATCAATCACATTGTTATTAAATTCTTGCTTAAGTATGAAATCACGCTCAAGGGTCGATTCAAACCAAATGGTTTTCTCACCTCTAAAGGCATAATTTCCCGAAATACTCCCATAAACAGTTTGAGCTTTTCTAACAGGTAAGTATTCGTCACTCAATTTTTTCATAAAAAAGTCACCATTCAGGCACTCGTGCCTATTAATGTAATTTTGCAAGTCACTCTTATCTATTTATGTAAATAATCTAATTTAATTGTGTGAAATTAGAGTGACAACCTATTGATTATCTATAATGCCACTCTATTCTATTGCTGTAAATGACA	NA	NA	NA	NA
