The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011539	Klebsiella aerogenes strain G7 chromosome, complete genome	5452368	167684	273903	5452368	holin,plate,tail,terminase,integrase,capsid,transposase	Burkholderia_virus(31.37%)	107	171891:171908	270674:270691
WP_000427614.1|167684_168689_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_015365582.1|168992_169592_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_015365583.1|169673_170891_-	alanine transaminase AlaA	NA	NA	NA	NA	NA
WP_015365584.1|171774_172701_+	transcriptional regulator LrhA	NA	NA	NA	NA	NA
171891:171908	attL	GTCCGCCGTCAGTCAGCA	NA	NA	NA	NA
WP_002913181.1|173353_173800_+	NADH-quinone oxidoreductase subunit NuoA	NA	NA	NA	NA	NA
WP_002913178.1|173815_174490_+	NADH-quinone oxidoreductase subunit NuoB	NA	NA	NA	NA	NA
WP_015365585.1|174578_176387_+	NADH-quinone oxidoreductase subunit C/D	NA	NA	NA	NA	NA
WP_015365586.1|176389_176890_+	NADH-quinone oxidoreductase subunit NuoE	NA	NA	NA	NA	NA
WP_015365587.1|176886_178224_+	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_015706161.1|178256_180983_+	NADH-quinone oxidoreductase subunit NuoG	NA	NA	NA	NA	NA
WP_015365589.1|180979_181957_+	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_015365590.1|181971_182514_+	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_015365591.1|182525_183080_+	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_004865088.1|183076_183379_+	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_032706101.1|183375_185217_+	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_015365593.1|185386_186916_+	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_015365594.1|186922_188380_+	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_015365595.1|188436_189357_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_015365596.1|189413_189875_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_015365597.1|190048_191344_+	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_015365598.1|191420_193091_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_015365599.1|193087_193846_+	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_015365600.1|193860_194718_+	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_015365601.1|194717_195683_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_032706100.1|195679_197041_+	o-succinylbenzoate--CoA ligase	NA	NA	NA	NA	NA
WP_015365603.1|197037_198555_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_015365604.1|198566_198998_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_015365605.1|199013_199994_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_015365606.1|200127_200805_+	transcriptional regulator TctD	NA	NA	NA	NA	NA
WP_015365607.1|200791_202201_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_015365608.1|202197_202623_-	nucleoside triphosphatase NudI	NA	NA	NA	NA	NA
WP_015365610.1|203049_203592_+	membrane protein	NA	NA	NA	NA	NA
WP_015365611.1|203686_204886_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_015365612.1|204887_206075_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_015365613.1|206071_207331_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_015365614.1|207320_208943_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_015365615.1|209213_210560_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_015365616.1|210569_211637_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	50.9	1.7e-08
WP_015365617.1|211730_211985_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_015365618.1|211984_213115_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.4	5.1e-176
WP_015365619.1|213215_215501_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
WP_015365620.1|215847_216576_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_061329527.1|216722_219356_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.3	3.7e-92
WP_015365622.1|219487_222340_+	two-component system sensor histidine kinase RcsC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.8	2.0e-35
WP_015365624.1|222452_223103_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_032706094.1|223119_225780_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_015365628.1|226552_227680_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	60.5	1.4e-120
WP_015365629.1|227783_228836_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_015365630.1|228908_229979_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	52.2	8.3e-19
WP_015365631.1|229978_230638_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_015365632.1|230706_232350_+	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.8	5.4e-09
WP_015365633.1|232514_233951_+	magnesium transporter	NA	NA	NA	NA	NA
WP_032706092.1|233913_235122_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	45.7	5.2e-70
WP_015365635.1|235399_237034_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_000904922.1|237338_237911_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_024187567.1|237982_238486_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	51.2	2.7e-36
WP_172903745.1|238514_238970_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	49.4	1.5e-30
WP_000072166.1|238976_239591_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_081113187.1|239590_241222_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.8	3.4e-40
WP_000138756.1|241224_241803_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001529034.1|241795_242899_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.0	1.4e-106
WP_000859116.1|242889_243237_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
WP_000148265.1|243291_243888_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
WP_015365640.1|243884_245039_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.3	5.5e-85
WP_000478224.1|245026_245239_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458386.1|245238_246123_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_015365641.1|246122_249074_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.6	5.4e-84
WP_085959828.1|249149_249308_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_015365642.1|249231_249567_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_041165544.1|249664_249946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162832341.1|249948_250473_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_015365644.1|250469_251897_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.5	1.2e-214
WP_000666499.1|251886_252138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|252137_252602_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_015365645.1|252601_253048_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|253049_253388_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_015365646.1|253397_254351_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.5	6.8e-65
WP_015365647.1|254365_255481_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	1.6e-97
WP_000135514.1|255695_256154_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117556.1|256156_256978_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
WP_015365649.1|256958_258455_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	60.0	2.7e-169
WP_000122980.1|258454_259771_-|terminase	terminase	terminase	A0A2P9JZI8	Alteromonadaceae_phage	63.5	1.3e-146
WP_000533685.1|259767_260316_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	47.3	1.3e-36
WP_000227702.1|260318_260630_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	3.0e-30
WP_015365650.1|260629_260956_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	45.8	2.6e-16
WP_015365651.1|260952_261603_-	lipoprotein	NA	Q5ZQY9	Pseudomonas_phage	33.2	1.2e-09
WP_015365652.1|261586_262327_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	50.6	9.4e-62
WP_015365653.1|262329_262680_-|holin	putative holin	holin	A4JWP3	Burkholderia_virus	52.2	5.8e-22
WP_041165545.1|262810_263239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365654.1|263327_263876_-	hypothetical protein	NA	Q6QID0	Burkholderia_phage	61.4	1.3e-52
WP_015365655.1|264306_265071_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	63.5	1.4e-97
WP_032146109.1|265191_265530_-	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	34.4	4.8e-05
WP_000123378.1|265630_265819_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_015365656.1|265871_266180_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	4.6e-23
WP_015365657.1|266190_267102_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.7	1.8e-75
WP_015365658.1|267105_268875_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.7	5.6e-230
WP_015365659.1|268885_270052_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_000843445.1|270054_270324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140138.1|270351_270882_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	67.3	3.1e-59
270674:270691	attR	GTCCGCCGTCAGTCAGCA	NA	NA	NA	NA
WP_000632576.1|271170_271443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197788.1|271452_271749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|271763_271979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132035.1|271975_272659_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	36.7	2.9e-25
WP_015365661.1|272655_272886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|272875_273082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365662.1|273083_273533_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	43.6	5.2e-23
WP_001281696.1|273504_273903_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
>prophage 2
NZ_CP011539	Klebsiella aerogenes strain G7 chromosome, complete genome	5452368	463139	515760	5452368	holin,tail,head,terminase,integrase	Salmonella_phage(20.63%)	71	464299:464312	488569:488582
WP_015365829.1|463139_465242_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.8	2.0e-64
464299:464312	attL	AAGATGTCACGACG	NA	NA	NA	NA
WP_061329532.1|465280_466705_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_061329534.1|466886_468065_+|integrase	site-specific integrase	integrase	K7P703	Enterobacteria_phage	93.1	5.4e-221
WP_045346713.1|468045_468237_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	93.7	5.4e-30
WP_061329536.1|468343_468685_-	hypothetical protein	NA	I3PV00	Vibrio_phage	52.9	4.3e-22
WP_061329642.1|468687_468909_-	TraR/DksA family transcriptional regulator	NA	Q9ZXI6	Pseudomonas_virus	46.8	6.7e-08
WP_045363820.1|469126_469318_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	64.4	6.0e-13
WP_045363823.1|469314_470181_-	MmcB family DNA repair protein	NA	A9YWY3	Burkholderia_phage	40.7	7.3e-58
WP_045363826.1|470177_470396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061329538.1|470392_471049_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.4	1.3e-112
WP_061329539.1|471045_471474_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	82.4	4.4e-64
WP_061329541.1|471470_472151_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	4.3e-122
WP_061329543.1|472147_473065_-	recombinase RecT	NA	M9NZA6	Enterobacteria_phage	87.9	2.4e-155
WP_061329545.1|473086_473365_-	host nuclease inhibitor GamL	NA	M9NZI3	Enterobacteria_phage	78.5	1.4e-34
WP_001752704.1|473443_473650_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	100.0	3.6e-32
WP_032105103.1|473646_473805_-	hypothetical protein	NA	G8C7T3	Escherichia_phage	90.4	5.4e-20
WP_032105105.1|473801_474050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032936032.1|474210_474474_-	hypothetical protein	NA	S4TNW9	Salmonella_phage	43.4	1.8e-07
WP_048248330.1|475357_475732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032104889.1|475745_476438_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.4	1.2e-58
WP_001514164.1|476565_476817_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	54.7	9.0e-17
WP_032104888.1|476846_477392_+	toxin YdaT domain-containing protein	NA	G8C7U3	Escherichia_phage	82.3	3.6e-79
WP_032104885.1|477614_478700_+	replication protein	NA	E5AGE9	Erwinia_phage	45.4	2.6e-84
WP_032104884.1|478696_480070_+	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	64.0	2.4e-167
WP_032104894.1|480074_480374_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	53.7	4.4e-18
WP_017693170.1|480615_480912_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	63.0	7.1e-29
WP_048248323.1|480908_481364_+	ead/Ea22-like family protein	NA	Q716F4	Shigella_phage	36.7	3.4e-06
WP_063438729.1|481536_482250_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	45.8	2.8e-23
WP_032105130.1|482753_483209_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	1.9e-33
WP_039671104.1|483201_483372_+	NinE family protein	NA	G8C7V4	Escherichia_phage	85.7	1.2e-20
WP_039671103.1|483364_484006_+	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	94.4	1.2e-105
WP_032105042.1|484115_484799_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.7	3.2e-56
WP_032105041.1|484798_485275_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	51.9	5.1e-37
WP_001514183.1|485870_486272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001514184.1|486268_486544_+|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_048248649.1|486546_487089_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	75.8	1.4e-75
WP_032105113.1|487085_487364_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	52.2	7.1e-15
WP_032105097.1|487833_488358_+	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	77.6	4.6e-71
WP_017383056.1|488511_488730_+	hypothetical protein	NA	NA	NA	NA	NA
488569:488582	attR	AAGATGTCACGACG	NA	NA	NA	NA
WP_017383055.1|488733_488883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032104708.1|488896_489535_+	hypothetical protein	NA	I6S676	Salmonella_phage	92.9	8.2e-115
WP_032104706.1|489567_490023_+	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	84.0	2.9e-66
WP_032104704.1|490019_491267_+|terminase	terminase	terminase	I6RSK1	Salmonella_phage	97.3	6.8e-214
WP_061329547.1|491282_492638_+	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	87.1	3.3e-230
WP_032104701.1|492597_493524_+|head	SPP1 gp7 family phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	92.9	3.1e-163
WP_061329644.1|493590_494850_+	hypothetical protein	NA	Q5G8Y2	Enterobacteria_phage	89.3	1.6e-215
WP_048248640.1|494862_495312_+	hypothetical protein	NA	H6WRT3	Salmonella_phage	85.9	1.2e-64
WP_048248638.1|495329_496406_+	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	91.3	5.0e-189
WP_061329549.1|496415_496709_+	hypothetical protein	NA	A0A1V0E5P8	Salmonella_phage	88.7	1.7e-43
WP_061329551.1|496771_497176_+	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	77.6	1.8e-54
WP_032104756.1|497345_497696_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	9.9e-38
WP_032104757.1|497698_498067_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	73.8	8.8e-45
WP_061329556.1|498063_498453_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	53.1	4.8e-33
WP_032708481.1|498521_499274_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.6	3.6e-45
WP_061329646.1|499329_500025_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	56.2	3.4e-66
WP_081113192.1|500030_500384_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_064484068.1|500507_500675_+	Arc family DNA-binding protein	NA	G9L6D7	Escherichia_phage	69.8	7.3e-15
WP_081113189.1|500748_501330_+	Bro-N domain-containing protein	NA	A0A0P0J0J1	Acinetobacter_phage	48.0	2.0e-27
WP_061329560.1|501394_502099_+	Rha family transcriptional regulator	NA	A0A0P0ZDC0	Stx2-converting_phage	33.2	7.6e-29
WP_061329562.1|502208_502613_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	44.2	2.6e-18
WP_061329564.1|502672_505006_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	47.4	1.1e-113
WP_061329566.1|505005_505503_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	91.5	9.3e-90
WP_045363946.1|505502_505973_+	hypothetical protein	NA	F1C5F1	Cronobacter_phage	89.7	2.5e-76
WP_061329569.1|505935_506352_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	86.8	7.6e-69
WP_061329571.1|506338_508816_+|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	91.5	0.0e+00
WP_061811563.1|508873_511006_+	hypothetical protein	NA	R9TMK5	Aeromonas_phage	40.2	1.7e-100
WP_047076814.1|511009_511267_+	hypothetical protein	NA	L0ARW5	Klebsiella_phage	51.8	1.9e-17
WP_061329574.1|511998_512289_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	41.2	1.5e-10
WP_061329576.1|512288_513554_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	81.8	4.9e-204
WP_061329578.1|513546_514218_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.1e-80
WP_015365831.1|514593_515760_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	81.6	4.3e-186
>prophage 3
NZ_CP011539	Klebsiella aerogenes strain G7 chromosome, complete genome	5452368	708285	742440	5452368	holin,tail,head,terminase,integrase	uncultured_Caudovirales_phage(36.67%)	43	700073:700088	718396:718411
700073:700088	attL	AAGGCCATGGCCGGGC	NA	NA	NA	NA
WP_015365913.1|708285_709302_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	64.2	3.7e-125
WP_015365914.1|709285_709531_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	41.4	2.8e-07
WP_015365915.1|709740_709926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015365916.1|709927_710488_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	58.4	1.2e-48
WP_015365917.1|710487_712644_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.2	2.4e-97
WP_041165546.1|712688_713012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041165547.1|713501_713888_-	helix-turn-helix domain-containing protein	NA	A5VW98	Enterobacteria_phage	59.4	1.5e-15
WP_041165548.1|713968_714163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365920.1|714225_714672_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	51.4	1.7e-26
WP_015365921.1|714755_714914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061329584.1|714916_716287_+	hypothetical protein	NA	A0A067ZIA1	Vibrio_phage	52.3	3.6e-27
WP_071458104.1|716295_717690_+	AAA family ATPase	NA	Q76H51	Enterobacteria_phage	46.7	2.4e-103
WP_015365924.1|717728_718397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365925.1|718401_718635_+	hypothetical protein	NA	NA	NA	NA	NA
718396:718411	attR	AAGGCCATGGCCGGGC	NA	NA	NA	NA
WP_015365926.1|718631_718784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365927.1|718780_719371_+	adenine DNA methyltransferase	NA	A0A0F6TJC3	Escherichia_coli_O157_typing_phage	85.0	7.9e-96
WP_015365928.1|719373_719604_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	37.3	3.8e-06
WP_015365929.1|719600_720218_+	HNH endonuclease	NA	A0A2H4JEM6	uncultured_Caudovirales_phage	24.9	2.3e-05
WP_015365930.1|720230_720569_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.9	2.3e-47
WP_041165550.1|720751_720943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365932.1|721011_721608_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	70.7	2.3e-79
WP_041165551.1|721619_721922_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	56.8	3.6e-28
WP_015365933.1|722077_722374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365934.1|722401_722845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365935.1|722856_723081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365936.1|723084_724707_+|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	57.2	4.3e-168
WP_015365937.1|724706_724940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015365938.1|724926_725775_+	hypothetical protein	NA	A0A2H4JEQ5	uncultured_Caudovirales_phage	41.7	1.7e-43
WP_032708647.1|725993_726905_+	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	38.3	2.9e-44
WP_015365940.1|726964_727528_+	hypothetical protein	NA	A0A2H4JID6	uncultured_Caudovirales_phage	51.3	5.3e-49
WP_015365941.1|727529_729524_+	hypothetical protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	48.0	5.8e-183
WP_041165607.1|729526_729976_+	GNAT family N-acetyltransferase	NA	A0A2H4J9Z5	uncultured_Caudovirales_phage	43.0	1.2e-22
WP_015365943.1|729978_730467_+	hypothetical protein	NA	A0A2H4J679	uncultured_Caudovirales_phage	43.0	1.3e-08
WP_015365944.1|730472_733184_+	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	57.5	1.4e-275
WP_041165552.1|733183_736087_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	71.4	0.0e+00
WP_041165553.1|736091_736526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015365947.1|736679_737027_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	46.9	6.0e-19
WP_015365948.1|737023_738634_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	69.3	6.7e-222
WP_015365949.1|738651_740994_+	hypothetical protein	NA	R9TMK5	Aeromonas_phage	36.8	2.9e-85
WP_015365950.1|740997_741255_+	hypothetical protein	NA	L0ARW5	Klebsiella_phage	49.4	1.2e-16
WP_015365951.1|741339_741564_+|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	70.1	2.0e-20
WP_015365952.1|741547_742084_+	lysozyme	NA	K7PM52	Enterobacteria_phage	68.8	6.1e-71
WP_015365953.1|742080_742440_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	44.0	6.4e-16
>prophage 4
NZ_CP011539	Klebsiella aerogenes strain G7 chromosome, complete genome	5452368	790931	830952	5452368	holin,plate,head,terminase,integrase	Aeromonas_phage(19.51%)	59	791413:791427	831951:831965
WP_015366006.1|790931_791591_-	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	30.1	7.6e-15
791413:791427	attL	TCGGCCACCATCTCT	NA	NA	NA	NA
WP_015366007.1|791670_791901_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	57.4	3.5e-15
WP_015366008.1|792035_792410_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_015366009.1|792413_793283_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_015366010.1|793296_793638_+	YebY family protein	NA	NA	NA	NA	NA
WP_032708609.1|794029_795109_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.1	1.3e-96
WP_071609883.1|795083_795356_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	40.9	1.5e-12
WP_125961766.1|795422_795815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032716233.1|795844_796348_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	44.8	3.6e-25
WP_032716232.1|796344_798681_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	61.9	1.5e-97
WP_032716231.1|798692_798989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071609884.1|799018_799324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032708600.1|799395_799602_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	56.2	1.2e-14
WP_032708599.1|800043_800451_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	43.5	2.0e-21
WP_032708597.1|800528_800756_+	transcriptional regulator	NA	A5VW97	Enterobacteria_phage	47.5	4.8e-09
WP_032716230.1|800739_801165_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_061329588.1|802044_802794_+	ATP-binding protein	NA	H6WRX8	Salmonella_phage	75.9	6.1e-109
WP_061329590.1|802819_803608_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	2.2e-61
WP_032716227.1|804251_804548_+	antitoxin PHD	NA	NA	NA	NA	NA
WP_071647704.1|804544_804862_+	hypothetical protein	NA	Q5G8V1	Enterobacteria_phage	73.3	2.1e-18
WP_080473220.1|805334_805769_+	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	37.8	4.1e-09
WP_032716226.1|805761_806034_+	hypothetical protein	NA	A0A2H4FNB3	Salmonella_phage	66.7	5.0e-21
WP_032716225.1|806106_806376_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	79.1	6.6e-34
WP_032716223.1|806457_806787_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	64.9	3.0e-28
WP_032708588.1|806940_807177_+	DinI-like family protein	NA	H6WRY5	Salmonella_phage	67.1	2.1e-23
WP_032708586.1|807268_807451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032716222.1|807521_808115_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	51.8	2.5e-49
WP_032716221.1|808111_808405_+	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	78.5	2.2e-38
WP_032716220.1|808401_808974_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.9	5.0e-55
WP_032708581.1|809259_809607_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	74.8	1.0e-39
WP_032716218.1|809610_810021_+	structural protein	NA	A0A0A0RQM4	Escherichia_phage	60.3	1.1e-40
WP_032716259.1|810024_810555_+	DUF2514 domain-containing protein	NA	A0A291AXG6	Shigella_phage	29.7	3.6e-07
WP_032716217.1|810547_810796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080957999.1|810924_811140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080473229.1|811138_811369_+	hypothetical protein	NA	A0A076G6T1	Escherichia_phage	58.8	2.2e-06
WP_061329592.1|811397_812444_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	49.6	4.4e-65
WP_081113190.1|812397_813912_+|terminase	phage terminase large subunit	terminase	Q7Y5U7	Haemophilus_phage	50.5	8.7e-131
WP_032716213.1|813913_815446_+	DUF1073 domain-containing protein	NA	H9C0V0	Aeromonas_phage	45.1	6.0e-103
WP_086538059.1|815375_816191_+|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	42.1	9.3e-55
WP_032716212.1|816203_817565_+	DUF2213 domain-containing protein	NA	A0A219YBB9	Aeromonas_phage	39.8	2.1e-67
WP_032708571.1|817568_818060_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.6	2.1e-33
WP_032716211.1|818052_819096_+	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	46.4	1.4e-79
WP_125961763.1|819097_819610_+	hypothetical protein	NA	H9C0V9	Aeromonas_phage	38.9	8.3e-09
WP_047055412.1|819612_820053_+	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	44.1	5.4e-17
WP_032716207.1|820058_820628_+	hypothetical protein	NA	H9C0W2	Aeromonas_phage	32.9	7.0e-17
WP_032708564.1|820624_820993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032708562.1|820974_821529_+	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	30.6	1.6e-13
WP_032716206.1|821529_823011_+	DUF3383 domain-containing protein	NA	K4PB47	Acinetobacter_phage	31.6	1.3e-54
WP_032716205.1|823011_823455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032708559.1|823462_823939_+	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	30.1	3.2e-07
WP_032708558.1|823980_824160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032716204.1|824140_826039_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	58.2	7.5e-39
WP_032716203.1|826041_826881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032708555.1|826882_827188_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	47.5	8.7e-22
WP_032716202.1|827184_828066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032716201.1|828043_828631_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	27.5	8.9e-07
WP_032716200.1|828633_829290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032708550.1|829355_829712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032716198.1|829719_830952_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	52.7	1.4e-110
831951:831965	attR	TCGGCCACCATCTCT	NA	NA	NA	NA
>prophage 5
NZ_CP011539	Klebsiella aerogenes strain G7 chromosome, complete genome	5452368	1161315	1195138	5452368	plate,lysis	Salmonella_phage(56.1%)	49	NA	NA
WP_032710309.1|1161315_1161717_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	39.3	1.9e-13
WP_032710308.1|1161824_1162076_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	56.6	5.6e-19
WP_032710307.1|1162075_1162489_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	70.5	7.6e-45
WP_032710303.1|1162754_1163789_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	50.4	7.7e-30
WP_050483364.1|1163802_1164075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_126000396.1|1164101_1164497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032710299.1|1164716_1165505_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	2.6e-62
WP_050483363.1|1165501_1166062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050483361.1|1166339_1166771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032710297.1|1166770_1167196_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	81.5	4.2e-59
WP_032710400.1|1168360_1168630_+	hypothetical protein	NA	S4TNF2	Salmonella_phage	80.2	1.0e-34
WP_032710294.1|1168711_1169041_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	64.9	5.1e-28
WP_032710292.1|1169194_1169428_+	DinI family protein	NA	H6WRY5	Salmonella_phage	70.1	3.4e-26
WP_162868533.1|1169577_1169745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032710291.1|1169881_1170184_+	DUF968 domain-containing protein	NA	A0A2I7QXN1	Vibrio_phage	57.6	3.1e-24
WP_032710288.1|1170180_1170825_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	74.0	4.3e-87
WP_032710286.1|1170821_1171430_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	52.0	1.3e-53
WP_049046135.1|1171756_1172059_+	hypothetical protein	NA	O64361	Escherichia_phage	75.2	4.0e-35
WP_032710285.1|1172058_1172556_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	82.4	1.1e-77
WP_032710284.1|1172552_1173014_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	59.1	1.8e-39
WP_032710283.1|1173084_1173285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045368486.1|1173310_1173967_+	hypothetical protein	NA	I6S676	Salmonella_phage	90.2	4.8e-110
WP_032710281.1|1173998_1174472_+	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	67.1	4.7e-51
WP_032710280.1|1174670_1176284_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	82.9	1.1e-275
WP_032710279.1|1176286_1177738_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	69.6	4.8e-195
WP_032710277.1|1177793_1178342_+	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	56.1	1.1e-48
WP_032710276.1|1178603_1179803_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	55.6	1.8e-107
WP_032710274.1|1179814_1180309_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	65.8	4.5e-52
WP_032710272.1|1180320_1181262_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.1e-139
WP_032710270.1|1181307_1181568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032710268.1|1181536_1181953_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	64.4	5.5e-43
WP_032710266.1|1181952_1182459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032710265.1|1182458_1182863_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	72.3	9.7e-45
WP_032710264.1|1182855_1183407_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	48.6	6.5e-44
WP_032710263.1|1183408_1184560_+	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	82.5	1.0e-179
WP_032710262.1|1184571_1185012_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	83.6	2.7e-64
WP_032710261.1|1185015_1185501_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	64.1	7.8e-49
WP_032710259.1|1185536_1185689_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_032710257.1|1185678_1187595_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	64.4	3.1e-226
WP_032710255.1|1187594_1188182_+	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	77.7	1.1e-73
WP_032710253.1|1188181_1188484_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	67.0	4.0e-35
WP_032710252.1|1188486_1189548_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	75.5	2.6e-142
WP_086557771.1|1189583_1189892_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	85.7	7.6e-34
WP_032710251.1|1189982_1191209_+	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	62.2	9.3e-99
WP_032710249.1|1191279_1191933_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	56.3	2.2e-70
WP_032710248.1|1191934_1192288_+	bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_032710247.1|1192287_1193487_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	70.5	4.4e-154
WP_032710246.1|1193483_1194257_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	55.6	9.7e-78
WP_032710244.1|1194256_1195138_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	60.2	3.6e-28
>prophage 6
NZ_CP011539	Klebsiella aerogenes strain G7 chromosome, complete genome	5452368	2243391	2295490	5452368	holin,tail,head,bacteriocin,terminase,integrase,protease,capsid,portal	Enterobacteria_phage(41.03%)	54	2242626:2242641	2292072:2292087
2242626:2242641	attL	GGGATGTGCCGGAGGA	NA	NA	NA	NA
WP_015367360.1|2243391_2244192_-|bacteriocin	lipid II-degrading bacteriocin	bacteriocin	NA	NA	NA	NA
WP_015367361.1|2244361_2245492_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	30.5	7.2e-29
WP_148660024.1|2245500_2246100_-	hypothetical protein	NA	A0A1X7QGJ8	Escherichia_phage	38.3	2.1e-32
WP_015367364.1|2246609_2255936_-	carbohydrate binding domain-containing protein	NA	Q6UAW1	Klebsiella_phage	36.6	4.1e-21
WP_041165565.1|2256002_2256602_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	78.0	1.2e-78
WP_041165566.1|2256649_2257072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015367366.1|2257112_2257823_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	92.8	3.7e-140
WP_015367367.1|2257824_2258580_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	85.3	8.7e-132
WP_015367368.1|2258576_2258924_-|tail	phage tail protein	tail	K7PJT2	Enterobacteria_phage	63.5	3.2e-36
WP_015367369.1|2258974_2262121_-|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	71.6	0.0e+00
WP_071824267.1|2262104_2262419_-|tail	phage tail assembly protein T	tail	E4WL32	Enterobacteria_phage	78.8	7.0e-43
WP_015367371.1|2262439_2262868_-|tail	phage minor tail protein G	tail	M9NZD7	Enterobacteria_phage	60.0	1.7e-36
WP_041165567.1|2262878_2263622_-|tail	phage tail protein	tail	K7PKX6	Enterobacterial_phage	85.4	1.6e-114
WP_015367373.1|2263628_2264027_-|tail	phage tail protein	tail	K7P7G5	Enterobacteria_phage	76.5	5.4e-56
WP_080624897.1|2264023_2264608_-|tail	phage tail protein	tail	M9NZH5	Enterobacteria_phage	77.8	2.5e-78
WP_041165568.1|2264616_2264970_-|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	65.8	3.0e-42
WP_015367375.1|2264980_2265400_-	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	52.2	1.8e-22
WP_015367376.1|2265450_2266476_-|capsid	major capsid protein	capsid	K7P6G7	Enterobacteria_phage	92.7	3.4e-179
WP_015367377.1|2266543_2266876_-|head	head decoration protein	head	E4WL24	Enterobacteria_phage	79.1	6.7e-44
WP_015367378.1|2266885_2268217_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	73.8	2.4e-172
WP_015367379.1|2268197_2269790_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	86.6	8.2e-273
WP_015367380.1|2269786_2269993_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	88.1	6.7e-26
WP_041165569.1|2269992_2271915_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	89.5	0.0e+00
WP_015367382.1|2271889_2272435_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	86.7	5.2e-86
WP_015367383.1|2272728_2273148_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	56.4	7.7e-37
WP_015367384.1|2273147_2273474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134874998.1|2273645_2273873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173390334.1|2274552_2275029_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_015367388.1|2275061_2275595_-	lysozyme	NA	G9L6J6	Escherichia_phage	83.3	7.4e-85
WP_032706073.1|2275596_2275845_-|holin	class II holin family protein	holin	A0A127KNH9	Pseudomonas_phage	35.1	4.9e-07
WP_041165571.1|2275949_2276357_-	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	81.1	2.6e-53
WP_012542177.1|2276404_2276581_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PD93	Moraxella_phage	56.4	1.4e-08
WP_041165614.1|2276948_2277551_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	71.6	2.8e-80
WP_015367392.1|2277564_2278596_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.9	5.2e-95
WP_015367393.1|2278595_2278799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015367394.1|2278795_2279188_-|protease	SOS-response repressor and protease LexA	protease	K7PHB4	Enterobacterial_phage	43.3	8.3e-17
WP_015367395.1|2279530_2279764_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	74.0	2.3e-27
WP_041165572.1|2279957_2280755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015367397.1|2280764_2280959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015367400.1|2282530_2282758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015367401.1|2282754_2283237_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.6	5.7e-68
WP_015367402.1|2283237_2283552_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	64.3	2.5e-08
WP_173390333.1|2283861_2284533_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	70.2	6.5e-62
WP_061329614.1|2285382_2285937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032705623.1|2285939_2286164_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	56.7	7.8e-12
WP_032705621.1|2286265_2286649_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	63.5	5.1e-19
WP_032705620.1|2287359_2287554_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_148660026.1|2288717_2290196_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.3	1.5e-58
WP_071609812.1|2290265_2290499_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_041165621.1|2290482_2291502_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	48.9	6.8e-79
WP_041165574.1|2291830_2292112_+	hypothetical protein	NA	NA	NA	NA	NA
2292072:2292087	attR	GGGATGTGCCGGAGGA	NA	NA	NA	NA
WP_041165575.1|2292121_2292550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015367409.1|2292936_2294565_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_015367411.1|2294830_2295490_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	4.9e-46
>prophage 7
NZ_CP011539	Klebsiella aerogenes strain G7 chromosome, complete genome	5452368	5329666	5405897	5452368	holin,plate,tail,head,lysis,tRNA,terminase,integrase,capsid,portal,transposase	Escherichia_phage(30.43%)	80	5338563:5338578	5391768:5391783
WP_015370148.1|5329666_5330908_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.0	3.7e-103
WP_015370247.1|5331617_5332100_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
WP_026612237.1|5332214_5332691_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_015370249.1|5332680_5332971_+	RnfH family protein	NA	NA	NA	NA	NA
WP_015370250.1|5333034_5333373_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_015370251.1|5333520_5335182_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_015370252.1|5335268_5336147_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_015370253.1|5336270_5336861_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_026612238.1|5336964_5338251_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_015703199.1|5338268_5339060_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
5338563:5338578	attL	CATTTCGCTGCTGAAA	NA	NA	NA	NA
WP_020078159.1|5339226_5340591_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_015370257.1|5340829_5341078_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_015703198.1|5341096_5341645_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_008806092.1|5341676_5342444_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|5342483_5342831_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_071647615.1|5342990_5343209_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	88.9	2.0e-33
WP_015370157.1|5343287_5344451_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	93.5	2.8e-201
WP_015370158.1|5344447_5344933_-|tail	phage tail protein	tail	O80317	Escherichia_phage	94.3	5.0e-80
WP_015370159.1|5344947_5347389_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	88.6	0.0e+00
WP_015370160.1|5347381_5347501_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	97.4	8.8e-15
WP_015370161.1|5347533_5347869_-|tail	phage tail assembly protein	tail	Q37846	Escherichia_phage	86.2	6.1e-45
WP_015370162.1|5347931_5348450_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	9.4e-93
WP_015370163.1|5348465_5349644_-|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	94.9	6.0e-212
WP_015370164.1|5349775_5350393_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	55.2	3.9e-53
WP_015370165.1|5350392_5351868_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	49.0	1.2e-108
WP_015370166.1|5351864_5352473_-|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	93.1	1.6e-107
WP_015370167.1|5352465_5353374_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	96.4	2.6e-154
WP_015370168.1|5353380_5353728_-	GPW/gp25 family protein	NA	A0A218M4K8	Erwinia_phage	92.2	3.1e-52
WP_032710455.1|5353724_5354366_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.9	6.3e-99
WP_015370170.1|5354439_5355798_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_015370171.1|5355849_5356311_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	76.2	1.1e-52
WP_015370172.1|5356303_5356771_-|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	97.4	2.3e-82
WP_001384078.1|5356733_5356907_-	hypothetical protein	NA	O80311	Escherichia_phage	98.2	6.2e-25
WP_015370173.1|5356878_5357292_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	94.2	1.6e-63
WP_015370174.1|5357288_5357786_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	93.3	1.1e-87
WP_015370175.1|5357772_5358069_-|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	95.9	1.1e-45
WP_015370176.1|5358071_5358275_-|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	91.0	8.3e-29
WP_015370177.1|5358274_5358784_-|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	94.7	1.5e-87
WP_015370178.1|5358877_5359627_-|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	90.4	4.9e-111
WP_015370179.1|5359631_5360699_-|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	89.3	1.8e-178
WP_015370180.1|5360775_5361630_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	94.0	1.7e-152
WP_032710453.1|5361795_5363565_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	97.3	0.0e+00
WP_015370183.1|5363567_5364614_+|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	94.0	1.4e-188
WP_015370185.1|5366391_5366880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032710487.1|5367167_5367350_-	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	88.3	3.6e-23
WP_161940104.1|5367462_5369559_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	88.1	0.0e+00
WP_015370188.1|5369707_5369989_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	91.4	1.4e-42
WP_032710449.1|5369985_5370282_-	DUF3850 domain-containing protein	NA	A0A2D1GP44	Escherichia_phage	45.5	3.0e-11
WP_015370189.1|5370282_5370504_-	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	86.3	5.3e-29
WP_015370190.1|5370503_5370737_-	DUF2732 family protein	NA	Q6K1F6	Salmonella_virus	75.3	1.7e-22
WP_015370191.1|5370800_5371088_-	hypothetical protein	NA	F1BUS4	Erwinia_phage	57.0	1.3e-24
WP_071647612.1|5371168_5371369_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	78.0	1.0e-15
WP_015370192.1|5371376_5371886_-	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	93.5	9.2e-85
WP_014343378.1|5371917_5372049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032710448.1|5372269_5373127_+	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	56.0	5.2e-88
WP_071647611.1|5373135_5373474_+	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	63.4	1.7e-34
WP_015370196.1|5373495_5373996_+	PH domain-containing protein	NA	A0A1D9C9Q4	Salinivibrio_phage	62.7	3.0e-48
WP_032710447.1|5374079_5375111_+|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	87.0	6.1e-176
WP_032706438.1|5375344_5375794_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_015370260.1|5375850_5377221_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_015370261.1|5377226_5377706_-	OmpA family protein	NA	NA	NA	NA	NA
WP_015370262.1|5377718_5378942_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_026612240.1|5378934_5379444_-	YfiR family protein	NA	NA	NA	NA	NA
WP_015370264.1|5379787_5380858_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.7	5.3e-90
WP_015370265.1|5380867_5381989_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_015370266.1|5382056_5382929_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_015370267.1|5382925_5384086_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100279143.1|5384187_5384235_-	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_002914111.1|5384349_5384685_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_015370268.1|5384957_5385695_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_015370269.1|5385826_5386807_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000427614.1|5387499_5388504_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_032706294.1|5388991_5391565_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	2.0e-127
WP_015370272.1|5397598_5398897_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.2	1.5e-43
5391768:5391783	attR	TTTCAGCAGCGAAATG	NA	NA	NA	NA
WP_015370273.1|5398899_5399223_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_015370274.1|5399265_5400621_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_015370275.1|5400717_5403393_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_015703189.1|5403428_5404127_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_015370277.1|5404196_5404622_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	3.5e-13
WP_015703188.1|5404826_5405897_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP011540	Klebsiella aerogenes strain G7 plasmid pGPN1, complete sequence	174066	42678	70603	174066	integrase,transposase	Salmonella_phage(26.67%)	31	49318:49377	74839:74990
WP_000543934.1|42678_43689_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000997323.1|43693_44563_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000139718.1|44559_45042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001166628.1|45031_45487_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|45558_45924_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|45939_46215_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|46242_46668_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|46706_48392_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|48409_48775_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|48771_49008_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000993245.1|49073_49286_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
49318:49377	attL	TGTCATTTTCAGAAGACGACTGCACCAGTTGATTGGGCGTAATGGCTGTTGTGCAGCCAG	NA	NA	NA	NA
WP_001389365.1|49523_50288_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|50645_51146_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|51273_52113_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|52106_52454_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|52617_53409_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_061811564.1|53501_53975_-	trimethoprim-resistant dihydrofolate reductase DfrA	NA	G3MBI7	Bacillus_virus	32.1	1.3e-19
WP_000845048.1|54131_55145_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|55347_55698_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|55823_56384_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001138064.1|56386_59353_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000427614.1|59431_60436_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001217881.1|62839_63397_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_015365452.1|63579_64440_+	class A extended-spectrum beta-lactamase TEM-24	NA	Q1MVP3	Enterobacteria_phage	98.3	1.2e-158
WP_001162012.1|65054_65612_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845054.1|65917_66931_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_032488579.1|67110_67665_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_000679427.1|67833_68181_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|68174_69014_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|69141_69642_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000983249.1|69817_70603_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
74839:74990	attR	CTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACATCCATGCCCAGCCCGTGCGCGAGCTGGATCACCGCCCGCACGATAGTTTGGTCACGGGCATCATCCGGGAGCCTGGCGACAAAGGATTGGTC	NA	NA	NA	NA
