The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014488	Escherichia coli strain G749 chromosome, complete genome	4897758	892051	987163	4897758	tail,tRNA,lysis,terminase,protease,portal,integrase,plate,capsid,holin,head	Escherichia_phage(33.93%)	85	891986:892001	969094:969109
891986:892001	attL	GCAAATAAGCTCTTGT	NA	NA	NA	NA
WP_000520781.1|892051_892372_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|892402_894679_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|895362_895581_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|895865_896570_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|896611_898333_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|898333_900100_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|900222_901188_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000077041.1|902359_906466_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|906624_907236_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|907246_908590_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|908680_909973_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850306.1|910211_912656_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|912666_913284_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|913285_914149_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|914184_914811_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|915124_916273_+	MFS transporter	NA	NA	NA	NA	NA
WP_000067979.1|916369_917167_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023390.1|917198_918194_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_001389238.1|918287_918587_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_001389237.1|918695_919052_+	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001475191.1|919229_919730_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	6.5e-91
WP_000557703.1|919793_920018_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_061157860.1|920017_920320_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	98.0	5.5e-45
WP_001113263.1|920319_920544_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_000027664.1|920540_920816_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_061157861.1|920805_923088_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.5	0.0e+00
WP_061157862.1|923204_925037_+	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.3	1.5e-89
WP_000038182.1|925376_926411_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
WP_000156872.1|926410_928183_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085953.1|928356_929211_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_061157863.1|929269_930343_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.4	5.7e-201
WP_061157864.1|930346_931090_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	97.6	1.9e-126
WP_000988633.1|931189_931699_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|931698_931902_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|931905_932187_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|932186_932684_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_061157865.1|932698_933124_+	hypothetical protein	NA	M1SV74	Escherichia_phage	90.1	1.8e-57
WP_061157866.1|933111_933537_+|lysis	LysB family phage lysis regulatory protein	lysis	M1SNP0	Escherichia_phage	97.9	1.6e-66
WP_001440152.1|933508_933682_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_001406878.1|933644_934112_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	6.7e-82
WP_001001780.1|934104_934557_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_061157867.1|934623_935259_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.5e-113
WP_000127163.1|935255_935603_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121475.1|935607_936516_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	100.0	3.4e-162
WP_001285323.1|936508_937039_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
WP_061157868.1|937049_939668_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	72.4	2.5e-282
WP_061157869.1|939667_940246_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	66.0	4.7e-69
WP_061157870.1|940940_941651_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_061157871.1|941689_942334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061157872.1|942701_943892_+|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	99.5	1.1e-224
WP_001251412.1|943904_944423_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	3.2e-93
WP_001031303.1|944479_944755_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|944787_944907_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_061157873.1|944899_947347_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.2	0.0e+00
WP_000978896.1|947361_947841_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_000882966.1|947840_949004_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	1.8e-205
WP_000468308.1|949085_949304_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|949622_951905_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|951959_952817_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|953222_954983_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|955112_955805_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|956003_957092_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|957162_958446_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001385260.1|958615_959380_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|959552_960236_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|960346_962020_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|962179_962464_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705731.1|962669_964934_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|964970_966719_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000570547.1|966715_967702_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056492.1|967738_968971_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350057.1|969022_969205_+	protein YcaR	NA	NA	NA	NA	NA
969094:969109	attR	ACAAGAGCTTATTTGC	NA	NA	NA	NA
WP_000011610.1|969201_969948_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436917.1|970101_970995_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|970971_971751_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001295930.1|971886_972672_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288856.1|972668_973991_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295931.1|973971_974676_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572654.1|974675_979136_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925990.1|979396_981244_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|981424_981973_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109456.1|981999_982647_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|982696_983887_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977908.1|984071_985160_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	2.8e-99
WP_000117888.1|985762_987163_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
>prophage 2
NZ_CP014488	Escherichia coli strain G749 chromosome, complete genome	4897758	1807342	1895588	4897758	tail,tRNA,transposase,terminase,plate,portal,integrase,capsid,holin	Escherichia_phage(22.73%)	104	1853041:1853100	1895650:1895774
WP_114137791.1|1807342_1808691_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	6.7e-74
WP_000568520.1|1808800_1809811_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1809819_1810431_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|1810569_1810635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024911.1|1810705_1811308_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1811309_1811831_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|1811865_1812606_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|1812634_1813087_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|1813079_1814852_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|1815161_1815728_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|1815724_1816543_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|1816595_1816991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|1817031_1817775_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_001576787.1|1817771_1818743_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|1818778_1821208_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|1821232_1822333_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|1822720_1823467_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|1823480_1824047_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|1824262_1825996_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|1826048_1826441_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|1826440_1828519_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|1828511_1829660_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_001576788.1|1829848_1830493_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1830503_1830893_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|1830907_1831957_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|1831959_1832820_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|1833110_1834772_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1834916_1835420_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|1835440_1837405_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|1837409_1838336_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|1838332_1839220_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1839346_1839925_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1839927_1840278_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|1841057_1841486_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|1841492_1842917_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|1842891_1843692_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000987895.1|1843858_1844848_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|1844859_1846374_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|1846443_1847433_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|1848229_1848733_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|1848810_1849062_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1849176_1849263_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|1849526_1849850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|1850021_1850519_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1850556_1850796_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|1850986_1852198_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|1852248_1852914_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1853041:1853100	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|1853385_1853805_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531766.1|1853971_1855015_-	hypothetical protein	NA	R9TNM7	Vibrio_phage	28.5	2.0e-33
WP_001531767.1|1855018_1855243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531768.1|1855404_1855794_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|1855829_1857470_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|1857578_1857860_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|1857872_1858385_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000626358.1|1859900_1860290_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_001531771.1|1860289_1861474_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|1861466_1862093_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|1862095_1863016_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|1863012_1863354_-|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|1863356_1864259_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|1864239_1864776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|1864772_1865453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|1865484_1865865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|1865861_1866281_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|1866315_1867350_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|1867408_1867738_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|1867737_1869045_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|1869044_1870619_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|1870615_1870849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|1870848_1872711_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|1872697_1873264_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|1873632_1873878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|1873937_1874132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|1874139_1874619_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|1874618_1874891_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|1874890_1875274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|1875386_1876058_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|1876057_1876351_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|1876347_1876944_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|1877021_1877201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|1877352_1877994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|1878237_1878471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|1878869_1879358_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|1879367_1879973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|1880435_1881134_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|1882321_1883245_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|1883419_1884208_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000466605.1|1884480_1884702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000661082.1|1884889_1885114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|1885110_1885422_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|1885418_1885655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|1885656_1886067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|1886105_1887521_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|1887510_1888266_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|1888262_1888487_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|1888526_1889003_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|1889061_1889292_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|1889390_1889804_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|1890814_1891135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|1891165_1893382_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|1893378_1893948_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|1893947_1894130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|1894339_1894603_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|1894571_1895588_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
1895650:1895774	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 3
NZ_CP014488	Escherichia coli strain G749 chromosome, complete genome	4897758	1913832	1991406	4897758	tail,transposase,terminase,protease,portal,integrase,capsid,holin,head	Escherichia_phage(37.25%)	94	1957870:1957884	1996669:1996683
WP_001347174.1|1913832_1914357_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_000879824.1|1914513_1915311_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|1915320_1915872_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|1916040_1916373_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|1916716_1917031_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994425.1|1917245_1918904_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|1918896_1919892_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282677.1|1919884_1920571_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213308.1|1920570_1921944_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001619549.1|1921962_1922406_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620069.1|1922402_1923530_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|1923634_1924099_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|1924103_1925108_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282103.1|1925104_1925518_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001313947.1|1925520_1925886_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253318.1|1925885_1926623_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|1926632_1926902_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983988.1|1926910_1927696_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103992.1|1927985_1928609_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|1928652_1928895_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|1929003_1929231_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491527.1|1929526_1930342_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001531784.1|1930338_1932033_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|1932203_1932386_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|1932464_1933382_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|1933554_1934475_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|1934463_1934934_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157265.1|1934914_1936333_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001296176.1|1936399_1937095_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001330593.1|1937134_1937500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824383.1|1938065_1939181_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_000218217.1|1939773_1940625_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826711.1|1940732_1942091_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001347103.1|1942090_1942762_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|1942894_1943308_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740067.1|1943416_1944421_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240063.1|1944421_1945057_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_099156434.1|1945140_1946489_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001007778.1|1946749_1947400_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_061158032.1|1948479_1948767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061157892.1|1948809_1949850_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	78.1	5.0e-146
WP_001544317.1|1949862_1950132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061157893.1|1950131_1952489_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	50.8	1.1e-119
WP_001228228.1|1952553_1953153_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	93.0	1.2e-102
WP_061157894.1|1953223_1956721_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.1	0.0e+00
WP_021538849.1|1956781_1957429_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	9.5e-111
WP_061157895.1|1957326_1958070_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	9.5e-147
1957870:1957884	attL	GACCAGCGCCACAAT	NA	NA	NA	NA
WP_061157896.1|1958075_1958774_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.4	2.6e-130
WP_021543564.1|1958773_1959115_-	hypothetical protein	NA	A0A0P0ZDL9	Stx2-converting_phage	66.4	4.6e-40
WP_061157897.1|1959107_1962347_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	97.1	0.0e+00
WP_071590020.1|1962393_1962654_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_001312914.1|1962695_1963082_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.8e-64
WP_000097533.1|1963081_1963786_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_001209399.1|1963845_1964190_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_001312916.1|1964186_1964636_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	7.9e-64
WP_001147820.1|1964632_1964971_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_040090484.1|1964979_1965285_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	99.0	2.7e-39
WP_061157898.1|1965241_1965484_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	1.9e-24
WP_029400196.1|1965535_1966741_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	3.5e-223
WP_001193631.1|1966755_1967406_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466247.1|1967383_1968625_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_000478567.1|1968624_1968807_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_047088822.1|1968818_1970576_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_029400381.1|1970575_1971058_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	1.9e-84
WP_001140099.1|1971205_1971556_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_000671993.1|1971563_1971764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114684.1|1972008_1972494_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001228685.1|1972734_1972920_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_000992100.1|1973136_1973670_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_021546095.1|1973733_1974084_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.2e-37
WP_000839572.1|1974088_1974304_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_021575731.1|1975116_1975806_-	antitermination protein Q	NA	I6PDF8	Cronobacter_phage	50.2	4.5e-58
WP_029402772.1|1975802_1976168_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.1e-39
WP_061157899.1|1976168_1977224_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	1.3e-88
WP_024168546.1|1977225_1977504_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	2.5e-12
WP_050542959.1|1977732_1978029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013644.1|1978268_1978481_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	60.0	4.3e-12
WP_061157900.1|1978760_1979231_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.2	2.1e-35
WP_001224672.1|1979396_1979579_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_029402725.1|1980194_1980617_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	7.4e-64
WP_001262367.1|1980657_1981728_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	3.8e-64
WP_000693883.1|1981799_1982225_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|1982208_1982451_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001397087.1|1982842_1983181_+	peptidase S24-like family protein	NA	H9C160	Pectobacterium_phage	30.7	2.5e-06
WP_000379575.1|1983473_1983629_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171946.1|1983788_1984007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331716.1|1984010_1984175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|1984574_1984763_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|1984759_1984951_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_061157901.1|1985044_1987486_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.8	1.0e-112
WP_000096344.1|1987544_1987748_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533615.1|1987747_1988773_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001311896.1|1989008_1989806_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060157.1|1990143_1991406_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
1996669:1996683	attR	GACCAGCGCCACAAT	NA	NA	NA	NA
>prophage 4
NZ_CP014488	Escherichia coli strain G749 chromosome, complete genome	4897758	2208585	2218030	4897758		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|2208585_2209722_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|2209718_2211722_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|2211846_2212308_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2212348_2212819_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2212865_2213585_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2213581_2215267_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|2215488_2216220_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|2216279_2216387_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|2216367_2217099_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|2217103_2218030_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 5
NZ_CP014488	Escherichia coli strain G749 chromosome, complete genome	4897758	2425782	2500667	4897758	tRNA,lysis,terminase,portal,integrase,capsid,holin,head	Enterobacteria_phage(53.97%)	91	2455630:2455650	2507507:2507527
WP_001283598.1|2425782_2426595_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|2426594_2427608_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699128.1|2427673_2428810_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.3	8.5e-22
WP_000615816.1|2428908_2429904_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127789.1|2429900_2431079_-	arabinose transporter	NA	NA	NA	NA	NA
WP_000817178.1|2431343_2432564_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683761.1|2432722_2434729_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|2434849_2435128_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|2435161_2435710_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447366.1|2435709_2436519_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043795.1|2436518_2437343_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001296258.1|2437346_2438432_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001296259.1|2438466_2439399_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2439564_2440116_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001527383.1|2440175_2441000_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000054000.1|2441001_2441529_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000819141.1|2441525_2442005_-	fimbrial protein	NA	NA	NA	NA	NA
WP_061157931.1|2442001_2442493_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000499462.1|2442509_2443262_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001296260.1|2443281_2445930_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000032632.1|2446010_2446577_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001195810.1|2447135_2447621_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425017.1|2447823_2449968_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|2449967_2451278_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2451458_2451743_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296262.1|2452114_2453455_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|2453516_2454272_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|2454565_2455498_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
2455630:2455650	attL	ATTCCTGCAGGGGACACCATT	NA	NA	NA	NA
WP_000958671.1|2455809_2456967_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_061157932.1|2458234_2461180_-	peptidase S74	NA	A5VW57	Enterobacteria_phage	99.4	0.0e+00
WP_000532176.1|2461315_2461567_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	91.6	6.6e-36
WP_000136767.1|2461582_2462551_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	48.6	8.5e-71
WP_085956046.1|2462728_2463097_+	hypothetical protein	NA	I6S5X4	Salmonella_phage	100.0	3.4e-65
WP_061157933.1|2463121_2464960_-	hypothetical protein	NA	A0A192Y934	Salmonella_phage	72.9	1.9e-241
WP_061157934.1|2464959_2466402_-	phage DNA ejection protein	NA	A0A2H4FND5	Salmonella_phage	62.5	7.8e-137
WP_061157935.1|2466411_2467107_-	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.9	2.0e-90
WP_000627636.1|2467109_2467565_-	DUF2824 family protein	NA	A0A2D1GLX4	Escherichia_phage	99.3	2.3e-87
WP_021520320.1|2467564_2468266_-	hypothetical protein	NA	A0A2D1GLK3	Escherichia_phage	99.6	1.9e-120
WP_061157936.1|2468265_2469684_-	hypothetical protein	NA	A0A088CQ70	Enterobacteria_phage	99.4	1.2e-275
WP_024245630.1|2469692_2470175_-	packaged DNA stabilization protein p27	NA	Q716G8	Shigella_phage	98.8	9.3e-87
WP_000375639.1|2470149_2470335_-	hypothetical protein	NA	Q716G9	Shigella_phage	98.4	4.6e-26
WP_060504035.1|2470377_2471649_-|head	head protein	head	Q716H0	Shigella_phage	99.8	3.0e-241
WP_033803105.1|2471660_2472545_-|capsid	phage capsid scaffolding protein	capsid	Q716H1	Shigella_phage	99.7	4.0e-144
WP_061157937.1|2472558_2474685_-|portal	portal protein	portal	Q9AYZ9	Salmonella_phage	99.6	0.0e+00
WP_061157938.1|2474687_2476100_-|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	99.6	1.7e-277
WP_021566250.1|2476096_2476537_-	hypothetical protein	NA	C7U0W1	Enterobacteria_phage	100.0	3.5e-80
WP_000807788.1|2476539_2476782_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000999686.1|2476885_2477266_-	hypothetical protein	NA	Q716B1	Shigella_phage	98.4	2.5e-66
WP_001028465.1|2477555_2478077_-	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_061157939.1|2478278_2478716_-|lysis	lysis protein	lysis	K7P7F7	Enterobacteria_phage	96.6	2.7e-69
WP_061157940.1|2478712_2479189_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	6.4e-88
WP_000783734.1|2479172_2479496_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001385993.1|2479979_2480468_-	phage antitermination Q family protein	NA	M1FPN0	Enterobacteria_phage	99.4	3.5e-89
WP_000994516.1|2480464_2480653_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_061157941.1|2480649_2481012_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PKF0	Enterobacteria_phage	96.7	2.5e-60
WP_061157942.1|2481012_2481537_-	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	42.9	1.6e-31
WP_040080406.1|2481533_2481824_-	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	99.0	4.5e-52
WP_061157943.1|2481823_2482546_-	DNA-binding protein	NA	K7P6K2	Enterobacteria_phage	99.2	2.7e-130
WP_000566866.1|2482538_2482709_-	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
WP_001254222.1|2482705_2482888_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_061157944.1|2482884_2483295_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	9.4e-72
WP_114137792.1|2483266_2483623_-	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	95.6	2.3e-58
WP_000049638.1|2483634_2483835_-	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
WP_061157945.1|2483831_2484158_-	hypothetical protein	NA	Q716D0	Shigella_phage	98.1	6.1e-58
WP_061157946.1|2484230_2485607_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	1.4e-252
WP_061157947.1|2485603_2486491_-	replication protein	NA	A5VW95	Enterobacteria_phage	99.0	1.2e-143
WP_001244625.1|2486553_2486826_-	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	7.9e-43
WP_000251072.1|2486848_2487142_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001194218.1|2487261_2487477_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_061157948.1|2487580_2488213_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.0	3.0e-117
WP_061157949.1|2488209_2488614_+	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	98.5	7.3e-69
WP_072146718.1|2488968_2489331_+	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	3.0e-53
WP_061157950.1|2489340_2489973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042017511.1|2490019_2490310_+	hypothetical protein	NA	K7PH98	Enterobacteria_phage	75.8	2.3e-32
WP_000604105.1|2490938_2491247_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	99.0	2.5e-53
WP_000065842.1|2491243_2492146_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	87.5	9.7e-146
WP_000041326.1|2492129_2492612_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.9	3.5e-78
WP_000753561.1|2492623_2492938_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	98.1	1.3e-49
WP_000773125.1|2492954_2493236_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	98.9	1.9e-44
WP_001214452.1|2493232_2493397_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_061157951.1|2493393_2493942_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	58.2	2.6e-45
WP_001673392.1|2493938_2494172_+	hypothetical protein	NA	E9NIE8	Enterobacter_phage	41.0	5.1e-06
WP_061157952.1|2494799_2495399_+	DUF551 domain-containing protein	NA	I6R0M4	Salmonella_phage	88.7	8.6e-82
WP_061157953.1|2495398_2495683_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	97.8	6.1e-46
WP_000002106.1|2495675_2495960_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|2496032_2496200_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|2496257_2496458_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000926944.1|2496706_2497882_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	63.0	2.8e-145
WP_000287253.1|2497861_2498812_-	sce7725 family protein	NA	NA	NA	NA	NA
WP_000019149.1|2498833_2499715_-	sce7726 family protein	NA	NA	NA	NA	NA
WP_000783295.1|2500394_2500667_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	50.0	3.2e-20
2507507:2507527	attR	ATTCCTGCAGGGGACACCATT	NA	NA	NA	NA
>prophage 6
NZ_CP014488	Escherichia coli strain G749 chromosome, complete genome	4897758	2723162	2857010	4897758	tail,tRNA,transposase,lysis,terminase,protease,portal,integrase,plate,capsid	Enterobacteria_phage(20.65%)	146	2785996:2786012	2837903:2837919
WP_000083664.1|2723162_2723900_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2724031_2725366_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001296304.1|2725398_2726280_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2726382_2726970_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2727025_2727409_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|2727713_2728403_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_061157956.1|2728450_2729488_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2729694_2730114_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001296305.1|2730182_2730881_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082935.1|2730912_2733573_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_001312028.1|2733686_2735042_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001467872.1|2735087_2735411_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000852119.1|2735407_2736706_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.5	2.4e-44
WP_001235102.1|2742492_2745066_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040156.1|2745195_2745927_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079111.1|2745923_2746904_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2747038_2747776_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2748045_2748387_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2748490_2748538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200140.1|2748636_2749797_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225212.1|2749839_2750961_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|2750971_2752042_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|2752251_2752617_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|2752763_2753282_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969008.1|2753271_2754498_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589791.1|2754513_2754996_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2755072_2755420_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264790.1|2755461_2756229_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2756259_2756808_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2756826_2757075_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2757211_2758573_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189256.1|2758664_2759531_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2759551_2760838_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2760891_2761485_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2761607_2762486_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880939.1|2762571_2764233_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2764381_2764723_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2764784_2765075_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2765064_2765541_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2765672_2766155_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_012602456.1|2766960_2768175_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_001288444.1|2768209_2769643_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
WP_000355482.1|2770049_2770823_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_016243792.1|2770892_2771477_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	6.0e-104
WP_071888735.1|2771476_2774875_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_061157957.1|2774939_2775539_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	97.0	3.7e-109
WP_021538849.1|2779166_2779814_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	9.5e-111
WP_032153133.1|2779711_2780455_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.1	4.7e-146
WP_023307632.1|2780460_2781159_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	8.6e-134
WP_000447253.1|2781168_2781498_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001161009.1|2784533_2784863_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|2784871_2785258_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211129.1|2785318_2786062_-|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.6	1.0e-132
2785996:2786012	attL	TGCCGGTATACATCCAG	NA	NA	NA	NA
WP_001079398.1|2786072_2786474_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677102.1|2786470_2787049_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|2787060_2787336_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|2787328_2787652_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_016243797.1|2787738_2789766_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.8	0.0e+00
WP_033560368.1|2789710_2791219_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	1.7e-288
WP_001072975.1|2791218_2791431_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_023307630.1|2791427_2793530_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.9	0.0e+00
WP_000373425.1|2793529_2794024_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001139675.1|2794699_2794852_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_016243800.1|2794839_2795307_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.7	6.5e-77
WP_001135250.1|2795303_2795801_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|2795800_2796016_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_016243801.1|2796083_2797136_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	6.1e-208
WP_000917724.1|2797286_2797490_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000868396.1|2797754_2798681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001131905.1|2798667_2799216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205460.1|2799228_2799570_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	90.3	4.2e-57
WP_061157959.1|2799587_2800577_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	3.1e-193
WP_001061444.1|2800584_2801394_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|2801413_2801803_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210170.1|2801799_2802126_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000066917.1|2802122_2802776_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_077125183.1|2802775_2803270_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	1.6e-86
WP_000104943.1|2803266_2804208_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_071589348.1|2804197_2804377_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.7e-15
WP_001560799.1|2804552_2805104_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.9	5.8e-101
WP_000649477.1|2805147_2805348_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2805438_2806113_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000917896.1|2806285_2806582_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000135691.1|2807182_2807545_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_061157961.1|2807610_2808435_+	YfdQ family protein	NA	U5P439	Shigella_phage	99.3	3.9e-149
WP_000008234.1|2808562_2809087_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001075212.1|2809195_2810062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|2810103_2810310_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_061157962.1|2810270_2811443_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.3	3.9e-147
WP_001145022.1|2811456_2811840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059251285.1|2811829_2812645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993107.1|2813786_2814764_+	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000271888.1|2814783_2816049_+	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000772888.1|2816074_2817523_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000625041.1|2817536_2818817_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.3	3.8e-34
WP_021522614.1|2819788_2820421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001281696.1|2820535_2820934_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
WP_000988473.1|2820905_2821358_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.6e-24
WP_000123379.1|2821347_2821563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631814.1|2821552_2821783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131939.1|2821779_2822463_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.9	4.5e-34
WP_000197789.1|2822459_2822765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001774057.1|2822774_2823047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001774058.1|2823334_2823865_-	hypothetical protein	NA	L7P7T1	Pseudomonas_phage	66.7	6.9e-59
WP_000843445.1|2823892_2824162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960680.1|2824164_2825331_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_001774059.1|2825341_2827111_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.3	4.8e-229
WP_000533819.1|2827114_2828026_-	hypothetical protein	NA	A4JWN3	Burkholderia_virus	55.3	2.0e-74
WP_000047758.1|2828036_2828345_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
WP_000123378.1|2828397_2828586_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000579778.1|2828686_2829025_+	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	34.4	4.8e-05
WP_001573937.1|2829141_2829906_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	4.0e-100
WP_001069609.1|2830097_2830313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972292.1|2830311_2830716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194949.1|2830691_2831435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793145.1|2831565_2831916_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.9	9.0e-23
WP_001104438.1|2831918_2832656_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
WP_000270138.1|2832642_2833296_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	31.9	4.3e-10
WP_000175097.1|2833292_2833619_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_000227704.1|2833618_2833930_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_000533684.1|2833932_2834475_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
WP_000137893.1|2834471_2835995_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.8e-184
WP_021512536.1|2835994_2837491_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	6.1e-169
WP_000117556.1|2837471_2838293_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
2837903:2837919	attR	CTGGATGTATACCGGCA	NA	NA	NA	NA
WP_000135514.1|2838295_2838754_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|2838968_2840084_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|2840098_2841052_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|2841061_2841400_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|2841401_2841848_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|2841847_2842312_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|2842308_2842563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|2842552_2843980_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000034294.1|2843979_2844501_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110114.1|2844503_2844785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|2844882_2845218_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|2845141_2845300_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001529030.1|2845375_2848588_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	5.8e-84
WP_000458387.1|2848587_2849472_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|2849468_2849684_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_001529032.1|2849671_2850844_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	7.3e-85
WP_000148265.1|2850840_2851437_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
WP_000859116.1|2851491_2851839_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
WP_001529034.1|2851829_2852933_+	hypothetical protein	NA	Q6QI99	Burkholderia_phage	55.0	1.4e-106
WP_000138756.1|2852925_2853504_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001529037.1|2855433_2856048_+|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	1.7e-61
WP_024189672.1|2856536_2857010_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	45.4	2.1e-30
>prophage 7
NZ_CP014488	Escherichia coli strain G749 chromosome, complete genome	4897758	2920051	2927191	4897758		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|2920051_2922613_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|2922718_2923375_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001272542.1|2923425_2924223_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_000847996.1|2924388_2925297_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|2925293_2926556_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|2926552_2927191_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 8
NZ_CP014488	Escherichia coli strain G749 chromosome, complete genome	4897758	3993828	4002142	4897758		Sodalis_phage(33.33%)	8	NA	NA
WP_045133129.1|3993828_3994290_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_000909175.1|3994283_3994961_+	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	9.2e-56
WP_021527466.1|3994960_3996280_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	43.2	1.2e-35
WP_016231879.1|3996276_3998997_+	lytic transglycosylase domain-containing protein	NA	A5VW64	Enterobacteria_phage	60.9	7.5e-149
WP_000594596.1|3999147_3999846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000072645.1|4000818_4001301_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	43.9	1.5e-28
WP_000204054.1|4001304_4001682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000230718.1|4001698_4002142_-	hypothetical protein	NA	A0A1W6JPI4	Morganella_phage	66.4	4.8e-45
>prophage 1
NZ_CP014489	Escherichia coli strain G749 plasmid pG749_1, complete sequence	149732	49288	96381	149732	integrase,transposase,protease	Macacine_betaherpesvirus(27.27%)	28	56018:56032	86770:86784
WP_000082154.1|49288_50260_+|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
WP_000092896.1|50520_50733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817028.1|52366_53338_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_001238646.1|53337_54504_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
56018:56032	attL	AATACCGGTCAGAAC	NA	NA	NA	NA
WP_000973517.1|56025_58227_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|58308_59586_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015721.1|59582_61325_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000011907.1|61324_62272_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000602863.1|62272_63997_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000095526.1|64132_65326_+	MFS transporter	NA	NA	NA	NA	NA
WP_001318207.1|65705_66086_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000968139.1|67328_68186_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000983710.1|69037_69865_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_001514243.1|69864_70779_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000361611.1|73760_74738_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001514245.1|75022_75763_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001332052.1|75883_76072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|76445_77354_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|77416_78526_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|78958_79912_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|81184_81343_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085949156.1|81526_82739_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_000928804.1|84193_85381_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733252.1|85377_87318_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	3.0e-35
86770:86784	attR	GTTCTGACCGGTATT	NA	NA	NA	NA
WP_001312828.1|87321_88692_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|89488_90430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|92690_93884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085974881.1|95107_96381_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.1e-174
>prophage 2
NZ_CP014489	Escherichia coli strain G749 plasmid pG749_1, complete sequence	149732	123832	135421	149732	integrase,transposase	Salmonella_phage(33.33%)	14	119591:119606	143562:143577
119591:119606	attL	GTGACGGATCTGGTGC	NA	NA	NA	NA
WP_072224148.1|123832_124408_-	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	1.4e-28
WP_162778789.1|124476_124680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000969996.1|124725_125007_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000079941.1|125003_125273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138014.1|125916_128883_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|128886_129447_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323888.1|129435_129603_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_000454193.1|129622_129973_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|130175_131189_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001317507.1|131344_131818_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_001067855.1|131969_132674_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_061158039.1|133258_134119_+	class A beta-lactamase TEM-156	NA	Q1MVP3	Enterobacteria_phage	99.7	1.3e-160
WP_001387387.1|134268_134670_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|134716_135421_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
143562:143577	attR	GCACCAGATCCGTCAC	NA	NA	NA	NA
>prophage 1
NZ_CP014490	Escherichia coli strain G749 plasmid pG749_2, complete sequence	109910	975	109675	109910	terminase,tRNA,tail,integrase,portal	Salmonella_phage(90.0%)	115	NA	NA
WP_077874335.1|975_2091_-	DNA primase	NA	J9Q720	Salmonella_phage	91.6	5.1e-205
WP_049076695.1|2238_3579_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	2.6e-235
WP_061158042.1|3622_4363_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.2	4.9e-127
WP_061158043.1|4543_6238_-	hypothetical protein	NA	X2KLG0	Campylobacter_phage	24.7	4.1e-12
WP_160378290.1|6289_6643_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_000161228.1|6648_7317_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_021512320.1|7465_8239_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	35.4	6.2e-32
WP_061158044.1|8223_8643_-	hypothetical protein	NA	J9Q6E9	Salmonella_phage	60.6	4.8e-39
WP_000901561.1|9008_9260_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	81.9	1.1e-27
WP_000856757.1|9261_9954_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	94.3	6.2e-124
WP_001717323.1|9967_10291_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	89.7	5.9e-45
WP_061158080.1|10494_13161_-|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	50.3	1.8e-67
WP_061158046.1|14616_19344_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.3	0.0e+00
WP_021520111.1|19361_19955_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	1.2e-99
WP_000526939.1|19942_20740_-|tail	tail protein	tail	J9Q7R4	Salmonella_phage	93.6	1.3e-154
WP_000511445.1|20732_21431_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_000442113.1|21513_21849_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_000952686.1|26456_26681_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_000163861.1|26806_27124_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_048958837.1|27179_27926_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	92.7	2.4e-121
WP_061158047.1|28000_28384_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
WP_000523628.1|28385_28859_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001027663.1|28849_29194_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_061158048.1|29273_30107_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.4	2.7e-142
WP_061158049.1|30106_30541_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.2	9.7e-59
WP_061158050.1|30585_31506_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	83.9	1.3e-132
WP_061158051.1|31579_32455_-	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	1.5e-154
WP_061158052.1|32480_33368_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	1.1e-130
WP_000422361.1|33389_34964_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	92.9	2.4e-285
WP_001007299.1|34990_36247_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_048958825.1|36246_36879_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.3	1.2e-89
WP_000176292.1|37077_37344_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000129633.1|37353_38244_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_061158053.1|38240_38906_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000161986.1|38902_39571_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_000382660.1|39570_40251_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	88.1	2.7e-108
WP_061158054.1|40333_41893_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.9	1.3e-278
WP_001291061.1|41895_42174_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	58.2	4.6e-22
WP_061158055.1|42206_42806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061158056.1|43191_43992_-	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	31.3	6.0e-06
WP_023145147.1|44094_44616_+	repressor of phase-1 flagellin	NA	J9Q6L0	Salmonella_phage	79.7	1.2e-66
WP_029305755.1|44911_45562_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	1.1e-98
WP_000255469.1|45610_45814_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	91.0	5.9e-27
WP_000497809.1|45834_46065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001718033.1|46446_46656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052904755.1|46682_47165_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.2	3.9e-61
WP_061158057.1|47515_47926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061158058.1|48007_48403_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	2.0e-31
WP_000749407.1|48529_48841_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_061158059.1|48994_49324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162778790.1|50889_51453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000910476.1|51611_51797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061158081.1|51833_52055_-	hypothetical protein	NA	J9Q750	Salmonella_phage	55.2	4.6e-17
WP_001755492.1|52294_54328_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_071888741.1|54485_55586_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_000506720.1|55623_56013_-	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
WP_000108704.1|56814_57441_-	hypothetical protein	NA	C6ZR26	Salmonella_phage	68.4	1.2e-06
WP_053882156.1|57817_58024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071888742.1|58016_58721_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	43.4	1.2e-45
WP_024184642.1|58720_58906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061158062.1|58910_59324_-	hypothetical protein	NA	A0A1B5FPC7	Escherichia_phage	50.0	1.4e-14
WP_022644967.1|59323_59866_-	hypothetical protein	NA	J9Q748	Salmonella_phage	87.4	1.4e-86
WP_021533175.1|59862_60504_-	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	87.3	2.8e-99
WP_021520153.1|60623_61004_-	hypothetical protein	NA	J9Q801	Salmonella_phage	67.4	1.7e-27
WP_061158063.1|61003_61708_-	hypothetical protein	NA	J9Q6K2	Salmonella_phage	75.5	3.0e-86
WP_061158064.1|61769_63455_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.5	0.0e+00
WP_024171479.1|63558_64173_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.4	3.6e-99
WP_001718087.1|64512_65082_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
WP_000893470.1|65221_65380_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000900261.1|65379_65805_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
WP_001103988.1|65898_66087_-	hypothetical protein	NA	J9Q800	Salmonella_phage	53.2	7.2e-11
WP_001718083.1|66096_66591_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	55.4	5.2e-24
WP_048959262.1|66739_67330_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	82.2	1.8e-92
WP_048959260.1|67911_68142_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	86.8	5.3e-32
WP_052904282.1|68327_68921_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	3.8e-98
WP_061158065.1|69103_69913_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.9	2.4e-66
WP_021520508.1|70073_70631_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.6	3.3e-88
WP_061158066.1|70640_71060_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.2	4.2e-51
WP_061158067.1|71121_71766_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	1.0e-96
WP_162774977.1|71765_72236_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.7	1.8e-79
WP_053900137.1|72238_72652_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	86.1	5.6e-64
WP_053900136.1|72653_73757_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	87.2	6.4e-192
WP_021512292.1|73928_74798_-	hypothetical protein	NA	J9Q742	Salmonella_phage	81.0	2.4e-133
WP_061158068.1|74875_76018_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_000623683.1|76123_78439_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.3	0.0e+00
WP_000037962.1|78512_79082_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_061158069.1|79091_79835_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.6	2.3e-52
WP_052904855.1|79824_81741_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	73.0	5.8e-249
WP_000174803.1|81970_83056_-	exonuclease	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
WP_000364573.1|83310_83955_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
WP_001348683.1|84156_85371_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	8.4e-76
WP_001229345.1|85950_86163_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_021512300.1|86162_86498_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.0	1.5e-38
WP_001265407.1|86713_86989_-	hypothetical protein	NA	J9Q738	Salmonella_phage	75.8	4.0e-34
WP_000715581.1|87560_88391_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_021533191.1|88394_88595_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
WP_160378289.1|88687_89716_-	recombinase	NA	J9Q736	Salmonella_phage	94.7	1.1e-188
WP_061158071.1|89763_90030_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	76.1	4.4e-30
WP_001755518.1|90029_90974_-	5'-3' exonuclease SAM fold family protein	NA	J9Q7S6	Salmonella_phage	88.9	1.0e-161
WP_061158072.1|91034_92063_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_024171475.1|92180_92612_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	85.3	4.4e-64
WP_106372450.1|92766_93615_+	DUF4365 domain-containing protein	NA	NA	NA	NA	NA
WP_061158073.1|93793_97312_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	94.5	0.0e+00
WP_061158074.1|97492_98728_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.3	4.0e-198
WP_061158075.1|98823_100932_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	66.6	3.7e-228
WP_029305696.1|101030_101243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282577.1|101494_101881_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_048959201.1|101875_102979_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_061158084.1|103190_103436_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.3e-12
WP_052923433.1|103610_104873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061158076.1|106387_106678_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	77.1	3.4e-36
WP_061158077.1|106823_107039_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.9	5.1e-21
WP_047659377.1|107035_108358_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	91.1	5.8e-240
WP_061158078.1|108354_108612_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	57.8	3.9e-15
WP_061158079.1|108892_109675_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	44.9	5.4e-60
>prophage 1
NZ_CP014491	Escherichia coli strain G749 plasmid pG749_3, complete sequence	62572	2456	60405	62572	tail,portal,head,lysis,terminase,capsid	Escherichia_phage(68.25%)	67	NA	NA
WP_061158086.1|2456_3497_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	9.9e-126
WP_061158097.1|3539_3833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021531776.1|3995_4961_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	72.1	1.9e-131
WP_001533178.1|7042_8209_+	plasmid-partitioning protein SopA	NA	O03951	Escherichia_phage	93.0	5.2e-216
WP_021531776.1|8208_9174_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	72.1	1.9e-131
WP_061158097.1|9336_9630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061158086.1|9672_10713_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	9.9e-126
WP_061158085.1|10722_11004_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	51.1	6.3e-19
WP_061158087.1|11003_13379_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	70.0	1.1e-169
WP_001542091.1|13443_14043_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_061158088.1|14110_17506_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	90.4	0.0e+00
WP_000090891.1|17566_18199_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_071701511.1|18135_18879_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	3.0e-145
WP_001152639.1|18884_19583_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000847401.1|19582_19912_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	92.7	6.0e-53
WP_061158089.1|19908_22470_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.3	0.0e+00
WP_000459467.1|22462_22897_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_001531341.1|22878_23301_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	1.2e-66
WP_061158098.1|23316_24057_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	2.3e-132
WP_000683138.1|24064_24460_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_000752986.1|25045_25399_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	2.6e-62
WP_024261929.1|25410_25806_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	96.2	3.0e-59
WP_000063218.1|25847_26873_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_001513196.1|26928_27261_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_061158090.1|27270_28590_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_061158091.1|28570_30172_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	3.2e-309
WP_000198149.1|30168_30375_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_061158092.1|30371_32297_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453567.1|32271_32817_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	93.4	7.8e-90
WP_061158093.1|33364_33814_-	hypothetical protein	NA	I6RSN8	Salmonella_phage	77.2	1.4e-60
WP_044069062.1|33938_34799_-	hypothetical protein	NA	A0A2I6TCU3	Escherichia_phage	98.5	3.1e-101
WP_001555423.1|35079_35391_-	DUF4406 domain-containing protein	NA	A0A2I6TCY5	Escherichia_phage	100.0	4.2e-56
WP_001683874.1|35432_35870_-|lysis	lysis protein	lysis	B9UDJ2	Salmonella_phage	97.9	4.2e-70
WP_001683873.1|35866_36364_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	95.8	1.9e-87
WP_001542477.1|36363_36636_-	hypothetical protein	NA	A0A1V0E5R8	Salmonella_phage	88.9	5.5e-36
WP_024187298.1|36731_37808_-	site-specific DNA-methyltransferase	NA	A0A2I6TC96	Escherichia_phage	99.7	3.9e-194
WP_001543372.1|38075_38303_-	hypothetical protein	NA	A0A2I6TC98	Escherichia_phage	100.0	2.3e-35
WP_061158099.1|38316_38538_-	hypothetical protein	NA	A0A2I6TCC3	Escherichia_phage	97.3	3.8e-35
WP_001495871.1|38703_39015_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2I6TCA4	Escherichia_phage	100.0	1.4e-51
WP_001683870.1|39014_39302_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	98.9	1.5e-44
WP_029400333.1|39344_39548_-	hypothetical protein	NA	A0A2I6TCA2	Escherichia_phage	98.5	2.0e-27
WP_029400332.1|39630_39873_-	hypothetical protein	NA	A0A2I6TCV0	Escherichia_phage	98.8	3.4e-37
WP_061158094.1|39891_40218_-	hypothetical protein	NA	A0A2I6TCZ1	Escherichia_phage	99.1	1.1e-54
WP_114137793.1|40233_40761_-	hypothetical protein	NA	A0A0F6TJ66	Escherichia_coli_O157_typing_phage	92.8	2.2e-36
WP_049289880.1|40974_41724_-	DUF551 domain-containing protein	NA	A0A2I6TCG8	Escherichia_phage	80.6	2.0e-72
WP_024194525.1|41720_42011_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	94.8	2.0e-44
WP_024167834.1|42010_42430_-	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	98.6	1.3e-71
WP_061158095.1|42429_42987_-	3'-5' exoribonuclease	NA	A0A2I6TCA6	Escherichia_phage	97.8	4.7e-106
WP_153275786.1|43052_43226_-	hypothetical protein	NA	A0A2I6TCC8	Escherichia_phage	100.0	1.0e-27
WP_029400328.1|43489_44200_-	hypothetical protein	NA	A0A2I6TCB3	Escherichia_phage	99.6	7.4e-133
WP_001386907.1|44189_44411_-	hypothetical protein	NA	A0A2I6TCB1	Escherichia_phage	100.0	2.1e-33
WP_001495876.1|44502_45099_+	XRE family transcriptional regulator	NA	A0A2I6TCW0	Escherichia_phage	100.0	2.8e-109
WP_061158096.1|45344_49340_+	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	94.9	0.0e+00
WP_001495878.1|49528_49855_+	hypothetical protein	NA	O64345	Escherichia_phage	63.6	9.5e-35
WP_001555404.1|49857_50253_+	hypothetical protein	NA	A0A2I6TCB8	Escherichia_phage	99.2	1.0e-70
WP_001555403.1|50342_51155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001386895.1|51535_51700_+	host cell division inhibitor Icd-like protein	NA	A0A2I6TCE0	Escherichia_phage	100.0	1.5e-20
WP_001555402.1|51696_51930_+	hypothetical protein	NA	A0A2I6TCC2	Escherichia_phage	92.2	5.0e-30
WP_001555401.1|51926_52709_+	hypothetical protein	NA	A0A2I6TCD0	Escherichia_phage	90.0	1.5e-131
WP_052985248.1|52880_54776_-	protelomerase	NA	A0A2I6TCW8	Escherichia_phage	97.8	0.0e+00
WP_052985248.1|55158_57054_+	protelomerase	NA	A0A2I6TCW8	Escherichia_phage	97.8	0.0e+00
WP_001555401.1|57225_58008_-	hypothetical protein	NA	A0A2I6TCD0	Escherichia_phage	90.0	1.5e-131
WP_001555402.1|58004_58238_-	hypothetical protein	NA	A0A2I6TCC2	Escherichia_phage	92.2	5.0e-30
WP_001386895.1|58234_58399_-	host cell division inhibitor Icd-like protein	NA	A0A2I6TCE0	Escherichia_phage	100.0	1.5e-20
WP_001555403.1|58778_59591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001555404.1|59680_60076_-	hypothetical protein	NA	A0A2I6TCB8	Escherichia_phage	99.2	1.0e-70
WP_001495878.1|60078_60405_-	hypothetical protein	NA	O64345	Escherichia_phage	63.6	9.5e-35
