The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014495	Escherichia coli strain SaT040 chromosome, complete genome	5061821	930808	1092488	5061821	integrase,lysis,head,protease,plate,capsid,transposase,tail,tRNA,portal,terminase,holin	Escherichia_phage(18.69%)	171	961101:961116	1085364:1085378
WP_001576601.1|930808_932047_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.2	1.7e-124
WP_001206970.1|932456_932666_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	67.9	2.2e-16
WP_072256914.1|932677_933586_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_001576603.1|933578_933806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770153.1|933811_934111_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001576604.1|934107_935856_+	phage/plasmid primase P4 family domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	40.3	3.0e-90
WP_024187906.1|936206_936458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001576606.1|936454_936880_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_024167808.1|936896_937145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053662.1|937179_937686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000733253.1|937972_939142_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	76.3	1.8e-163
WP_001576607.1|939196_939757_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	84.4	9.8e-88
WP_000270251.1|939758_940973_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	87.3	2.2e-209
WP_001576608.1|940965_941268_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	60.4	1.0e-27
WP_001576609.1|941267_941708_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	75.3	2.7e-64
WP_072256913.1|941691_941877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|941996_942353_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001576610.1|942336_943998_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	82.5	8.0e-279
WP_024187907.1|944003_944288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000520781.1|945214_945535_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|945565_947842_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001576618.1|948637_949231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576620.1|949232_949847_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	41.1	1.3e-24
WP_001576621.1|949848_950376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576623.1|950616_950895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106376849.1|950891_951236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576626.1|951508_951700_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_073970534.1|952838_953807_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.7e-180
WP_001040187.1|954905_955124_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|955408_956113_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|956154_957876_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|957876_959643_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|959765_960731_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
961101:961116	attL	ACGCCATTCGTGATGT	NA	NA	NA	NA
WP_000228473.1|961274_961769_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
961101:961116	attL	ACGCCATTCGTGATGT	NA	NA	NA	NA
WP_000077041.1|961903_966010_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|966168_966780_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|966790_968134_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|968224_969517_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850306.1|969755_972200_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|972210_972828_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|972829_973693_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|973728_974355_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|974668_975817_+	MFS transporter	NA	NA	NA	NA	NA
WP_000067979.1|975913_976711_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023390.1|976742_977738_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_000072552.1|977831_978143_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_001576635.1|978247_978604_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	98.3	2.0e-62
WP_164907187.1|978614_978785_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	1.3e-24
WP_000217677.1|978781_979282_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001576637.1|979345_979570_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	5.2e-32
WP_001576638.1|979569_979872_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	96.0	1.6e-44
WP_001576640.1|979871_980096_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	97.3	1.5e-34
WP_001576641.1|980092_980368_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	1.9e-44
WP_001576643.1|980357_982637_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
981115:981130	attR	ACGCCATTCGTGATGT	NA	NA	NA	NA
WP_001576644.1|983050_984193_+	hypothetical protein	NA	NA	NA	NA	NA
981115:981130	attR	ACGCCATTCGTGATGT	NA	NA	NA	NA
WP_125093550.1|984224_984701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001576647.1|984818_985550_+	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_001576649.1|985952_986372_+	hypothetical protein	NA	Q6K1E9	Salmonella_virus	76.3	5.7e-56
WP_001576650.1|986697_987732_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	98.8	7.9e-200
WP_000156861.1|987731_989504_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085955.1|989677_990532_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MH0	Enterobacteria_phage	98.2	5.2e-133
WP_001576652.1|990590_991664_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	98.9	2.2e-200
WP_001576654.1|991667_992411_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	1.6e-125
WP_000988633.1|992510_993020_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|993019_993223_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|993226_993508_+|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001576656.1|993507_994005_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_001576658.1|994019_994445_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	96.5	1.0e-57
WP_001576659.1|994432_994858_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	93.6	1.5e-64
WP_000917151.1|994965_995433_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_001001786.1|995425_995878_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_001576664.1|995944_996580_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	1.2e-113
WP_000127163.1|996576_996924_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121498.1|996928_997837_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	1.7e-161
WP_001576666.1|997829_998360_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	2.3e-102
WP_001576670.1|1000993_1001572_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.4	3.1e-68
WP_001576671.1|1002021_1002399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576672.1|1002841_1003318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001576673.1|1003629_1004820_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	3.1e-224
WP_001251408.1|1004832_1005351_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1005407_1005683_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|1005715_1005835_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000978911.1|1008288_1008768_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_001576679.1|1008767_1009931_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.4	5.9e-204
WP_000468308.1|1010012_1010231_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|1010550_1012833_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|1012887_1013745_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|1014150_1015911_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|1016040_1016733_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|1016931_1018020_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|1018090_1019374_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001385260.1|1019543_1020308_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|1020480_1021164_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|1021274_1022948_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|1023107_1023392_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705731.1|1023597_1025862_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551259.1|1025898_1027647_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000570547.1|1027643_1028630_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056492.1|1028666_1029899_+	YcaQ family DNA glycosylase	NA	NA	NA	NA	NA
WP_000350057.1|1029950_1030133_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011610.1|1030129_1030876_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436917.1|1031029_1031923_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899600.1|1031899_1032679_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001295930.1|1032814_1033600_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288856.1|1033596_1034919_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295931.1|1034899_1035604_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572654.1|1035603_1040064_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925990.1|1040324_1042172_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|1042352_1042901_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109456.1|1042927_1043575_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462681.1|1043624_1044815_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977908.1|1044999_1046088_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	2.8e-99
WP_000117888.1|1046690_1048091_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	6.9e-82
WP_001295933.1|1048259_1049462_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193867.1|1049727_1052340_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	5.3e-19
WP_001576683.1|1052723_1053296_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.6	7.9e-85
WP_024188925.1|1053367_1053871_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	48.6	1.0e-35
WP_024187909.1|1053899_1054355_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	6.8e-31
WP_001576687.1|1054361_1054976_-|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	61.5	2.3e-61
WP_072275200.1|1054975_1056907_-|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.8	4.1e-40
WP_000138756.1|1056909_1057488_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001576690.1|1057480_1058584_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	6.4e-107
WP_000859111.1|1058574_1058922_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148267.1|1058976_1059573_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.7	1.4e-36
WP_000808006.1|1059569_1060724_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	3.2e-85
WP_000478224.1|1060711_1060924_-|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|1060923_1061808_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_059320006.1|1061807_1065020_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.0	1.2e-81
WP_001202894.1|1065095_1065254_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|1065177_1065513_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001513983.1|1065610_1065892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162832341.1|1065894_1066419_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000729834.1|1066415_1067843_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000666499.1|1067832_1068084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|1068083_1068548_-	Gp37 family protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|1068547_1068994_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|1068995_1069334_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|1069343_1070297_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|1070311_1071427_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001576693.1|1071641_1072100_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.2	3.4e-30
WP_000117560.1|1072102_1072924_-|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	1.2e-97
WP_001576694.1|1072904_1074401_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.6	2.6e-167
WP_000533684.1|1075919_1076462_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
WP_000227704.1|1076464_1076776_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_000175097.1|1076775_1077102_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_001299256.1|1077098_1077710_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	34.2	6.9e-10
WP_001104438.1|1077738_1078476_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
WP_000793145.1|1078478_1078829_-|holin	putative holin	holin	A4JWP3	Burkholderia_virus	53.9	9.0e-23
WP_000194949.1|1078959_1079703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573938.1|1079678_1080080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069609.1|1080081_1080297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573937.1|1080488_1081253_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	4.0e-100
WP_032143164.1|1081369_1081708_-	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	34.4	3.7e-05
WP_000123378.1|1081808_1081997_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047758.1|1082049_1082358_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
WP_000533819.1|1082368_1083280_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	55.3	2.0e-74
WP_001529009.1|1083283_1085053_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.7	1.6e-229
WP_000960680.1|1085063_1086230_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_001576698.1|1086232_1086502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001576700.1|1086529_1087060_+	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|1087348_1087621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|1087630_1087927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763553.1|1087941_1088157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001576702.1|1088153_1088837_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.5	3.8e-33
WP_000631813.1|1088833_1089064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|1089053_1089260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001576703.1|1089261_1089711_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	1.4e-23
WP_001576704.1|1089682_1090081_+	hypothetical protein	NA	Q6QIE8	Burkholderia_phage	55.9	1.0e-30
WP_000460689.1|1090195_1090828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001571575.1|1090831_1090993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023363144.1|1091696_1092488_-	aliphatic sulfonate ABC transporter permease SsuC	NA	G3M9Y4	Bacillus_virus	24.5	1.4e-15
>prophage 2
NZ_CP014495	Escherichia coli strain SaT040 chromosome, complete genome	5061821	1260379	1328009	5061821	integrase,lysis,head,capsid,tail,tRNA,portal,terminase,holin	Enterobacteria_phage(40.85%)	90	1257413:1257428	1330630:1330645
1257413:1257428	attL	CAGCCAATGCATTATT	NA	NA	NA	NA
WP_001576717.1|1260379_1261498_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	7.7e-84
WP_000003742.1|1261466_1261736_-	excisionase	NA	NA	NA	NA	NA
WP_001576719.1|1261797_1264239_-	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_001070255.1|1264332_1264524_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854564.1|1264520_1264709_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171946.1|1265277_1265496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|1265655_1265811_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000362155.1|1266076_1266496_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|1266596_1266878_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693837.1|1266861_1267287_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262379.1|1267358_1268423_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	7.9e-62
WP_001151225.1|1268463_1268886_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	3.3e-64
WP_000403785.1|1268943_1269300_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|1269393_1269576_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753059.1|1269568_1269745_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	9.7e-26
WP_000813254.1|1270666_1270822_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001429486.1|1271280_1271559_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	4.3e-12
WP_001265034.1|1271560_1272610_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	2.9e-109
WP_000904092.1|1272622_1272979_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	61.8	1.8e-34
WP_000762890.1|1272993_1273815_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	6.1e-78
WP_000562553.1|1274707_1274839_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000871291.1|1275119_1275455_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000874243.1|1275715_1275904_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_001327246.1|1275900_1276062_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	2.0e-14
WP_000372595.1|1276211_1276427_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193296.1|1276431_1276776_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	92.9	7.0e-36
WP_000370546.1|1276741_1277014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992105.1|1277119_1277653_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_001327248.1|1277649_1278117_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	89.7	5.0e-69
WP_001139682.1|1278104_1278257_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001059340.1|1278459_1278984_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	93.6	2.9e-86
WP_001537735.1|1279286_1279697_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_000105081.1|1279754_1279988_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	4.3e-21
WP_001576724.1|1280381_1280891_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	3.6e-12
WP_001576726.1|1280862_1282791_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	3.6e-262
WP_000258993.1|1282774_1282981_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|1282977_1284570_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001576727.1|1284559_1286065_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256835.1|1286101_1286449_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	2.9e-21
WP_000522583.1|1286506_1287535_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	8.6e-114
WP_000201498.1|1287586_1287970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204571.1|1287962_1288316_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_000974995.1|1288331_1288865_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	64.1	1.2e-55
WP_000683079.1|1288861_1289257_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235037.1|1289264_1290011_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_001299690.1|1290029_1290461_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533402.1|1290487_1290901_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082402.1|1290881_1293443_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.0	0.0e+00
WP_000847298.1|1293439_1293769_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001327694.1|1293768_1294467_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_001576728.1|1294472_1295216_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	8.3e-143
WP_072258937.1|1295161_1295794_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	92.3	1.7e-96
WP_000514735.1|1296137_1299830_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.8	0.0e+00
WP_001228261.1|1299897_1300497_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	92.5	4.4e-102
WP_000216560.1|1300648_1302712_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	3.7e-148
WP_001204582.1|1302708_1302987_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_000355700.1|1302996_1303290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586406.1|1303329_1303428_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_000742376.1|1303482_1304139_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937496.1|1304207_1304474_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_000799406.1|1304705_1305569_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1305552_1306689_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|1306938_1308165_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|1308213_1309335_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|1309410_1310871_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1310870_1311542_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423736.1|1311710_1313081_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	7.9e-107
WP_001295971.1|1313084_1313726_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001295972.1|1313761_1314868_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1314921_1315383_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|1315392_1316046_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1316217_1317468_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1317581_1318724_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1318713_1318950_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1319089_1319329_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1319312_1319639_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1319638_1319860_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|1319958_1320240_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|1320250_1320442_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1320414_1320597_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1320593_1321274_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1321270_1322056_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1322061_1322358_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_023148105.1|1322433_1322724_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_024187901.1|1323542_1324556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000858972.1|1324661_1325351_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	4.7e-92
WP_001576731.1|1325455_1325686_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	66.7	2.1e-20
WP_001182889.1|1325755_1326295_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.7	4.0e-62
WP_077459380.1|1326291_1327311_+	replication protein	NA	M1FN81	Enterobacteria_phage	68.0	1.8e-111
WP_001576733.1|1327307_1328009_+	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.4	5.1e-126
1330630:1330645	attR	AATAATGCATTGGCTG	NA	NA	NA	NA
>prophage 3
NZ_CP014495	Escherichia coli strain SaT040 chromosome, complete genome	5061821	1333695	1362615	5061821	lysis,head,capsid,tail,portal,terminase	Enterobacteria_phage(65.71%)	37	NA	NA
WP_001053004.1|1333695_1334151_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_000224907.1|1334150_1334321_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774475.1|1334313_1334604_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_001099697.1|1334600_1334963_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971095.1|1334959_1335100_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001204794.1|1335185_1335569_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000737271.1|1335757_1336840_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1337429_1337645_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000193273.1|1337649_1337964_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_001168526.1|1337960_1338200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101164.1|1338334_1338868_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.8e-98
WP_001228695.1|1339084_1339267_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1339357_1339651_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1340131_1340458_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1340664_1340847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453576.1|1341410_1341956_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001027282.1|1341930_1343856_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|1343852_1344059_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001337540.1|1344055_1345657_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
WP_000123325.1|1345637_1346969_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	96.8	3.0e-228
WP_001576736.1|1346978_1347362_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	89.7	7.7e-44
WP_000118193.1|1347365_1348391_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_000158881.1|1348432_1348828_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.6e-55
WP_001576737.1|1348839_1349193_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	96.6	1.9e-60
WP_024188916.1|1349203_1349782_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	95.3	6.8e-76
WP_001576738.1|1349778_1350174_+|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	1.3e-70
WP_001524522.1|1350181_1350922_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	1.1e-131
WP_000479173.1|1350937_1351360_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	2.2e-68
WP_000459452.1|1351341_1351776_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_001576740.1|1351768_1354336_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.9	0.0e+00
WP_000847330.1|1354332_1354662_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	1.6e-58
WP_001576742.1|1354661_1355360_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_000194779.1|1355365_1356109_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_071589399.1|1356045_1356678_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.2e-96
WP_001576743.1|1356738_1360221_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_001524535.1|1360279_1362340_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_000654168.1|1362336_1362615_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
>prophage 4
NZ_CP014495	Escherichia coli strain SaT040 chromosome, complete genome	5061821	2007374	2095620	5061821	integrase,plate,capsid,transposase,tail,tRNA,portal,terminase,holin	Escherichia_phage(22.73%)	103	2053072:2053131	2095682:2095806
WP_099156434.1|2007374_2008723_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000568520.1|2008832_2009843_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2009851_2010463_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|2010601_2010667_-	stress response small protein YobI	NA	NA	NA	NA	NA
WP_001024911.1|2010737_2011340_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2011341_2011863_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|2011897_2012638_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|2012666_2013119_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|2013111_2014884_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|2015193_2015760_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|2015756_2016575_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2016627_2017023_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|2017063_2017807_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_001576787.1|2017803_2018775_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|2018810_2021240_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214293.1|2021264_2022365_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|2022752_2023499_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|2023512_2024079_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|2024294_2026028_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|2026080_2026473_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|2026472_2028551_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|2028543_2029692_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_001576788.1|2029880_2030525_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|2030535_2030925_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2030939_2031989_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|2031991_2032852_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|2033142_2034804_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|2034948_2035452_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_077874371.1|2035472_2037437_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|2037441_2038368_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|2038364_2039252_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|2039378_2039957_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|2039959_2040310_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|2041089_2041518_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|2041524_2042949_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|2042923_2043724_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|2043890_2044877_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|2044891_2046406_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_001576790.1|2046474_2047464_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|2048260_2048764_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|2048841_2049093_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|2049207_2049294_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|2049557_2049881_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|2050052_2050550_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|2050587_2050827_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|2051017_2052229_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|2052279_2052945_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
2053072:2053131	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|2053416_2053836_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531766.1|2054002_2055046_-	hypothetical protein	NA	R9TNM7	Vibrio_phage	28.5	2.0e-33
WP_001531767.1|2055049_2055274_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_001531768.1|2055435_2055825_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_000444667.1|2057608_2057890_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|2057902_2058415_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000117510.1|2058432_2059935_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|2059931_2060321_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_001531771.1|2060320_2061505_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|2061497_2062124_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_001576796.1|2062126_2063047_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.8	8.3e-68
WP_000901289.1|2063043_2063385_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|2063387_2064290_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|2064270_2064807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2064803_2065484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|2065515_2065896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|2065892_2066312_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|2066346_2067381_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|2067439_2067769_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|2067768_2069076_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|2069075_2070650_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|2070646_2070880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|2070879_2072742_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|2072728_2073295_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|2073663_2073909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|2073968_2074163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|2074170_2074650_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|2074649_2074922_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|2074921_2075305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|2075417_2076089_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|2076088_2076382_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|2076378_2076975_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|2077052_2077232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2077383_2078025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|2078268_2078502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2078900_2079389_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|2079398_2080004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|2080466_2081165_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|2082353_2083277_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|2083451_2084240_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|2084921_2085146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2085142_2085454_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|2085450_2085687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|2085688_2086099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|2086137_2087553_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|2087542_2088298_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|2088294_2088519_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|2088558_2089035_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|2089093_2089324_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|2089422_2089836_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|2090846_2091167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|2091197_2093414_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|2093410_2093980_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|2093979_2094162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|2094371_2094635_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|2094603_2095620_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
2095682:2095806	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 5
NZ_CP014495	Escherichia coli strain SaT040 chromosome, complete genome	5061821	2217575	2288784	5061821	lysis,integrase,head,protease,transposase,tail,portal,terminase,holin	Enterobacteria_phage(55.07%)	95	2233277:2233292	2293822:2293837
WP_001296203.1|2217575_2218772_+|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
WP_000235219.1|2218967_2219174_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000813432.1|2219267_2219870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001327829.1|2220343_2220559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970353.1|2220895_2221588_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_000255956.1|2221587_2222610_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001296206.1|2224134_2225280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163787.1|2225810_2226068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000016207.1|2226121_2226889_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_000217077.1|2226885_2227944_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000778018.1|2227962_2228952_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001576800.1|2228962_2231128_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001069649.1|2231556_2231991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531797.1|2232208_2234593_+	dynamin family protein	NA	NA	NA	NA	NA
2233277:2233292	attL	GTTGATGAAGCCTGGG	NA	NA	NA	NA
WP_000203551.1|2234589_2235495_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_000102631.1|2235491_2236562_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_001362823.1|2236697_2237375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000846703.1|2237390_2237801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|2238021_2238840_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|2238839_2239085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|2239178_2239652_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|2239667_2240144_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2240206_2240428_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|2240446_2241091_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_001280918.1|2241106_2241475_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854815.1|2241563_2241938_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000988600.1|2241934_2242129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|2242141_2242255_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001296208.1|2242743_2242926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450409.1|2243026_2243356_-	DUF496 family protein	NA	NA	NA	NA	NA
WP_001200889.1|2243527_2244586_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001105368.1|2244783_2245257_-	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001296209.1|2245375_2246542_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_125093545.1|2247381_2249853_-|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	86.1	7.4e-71
WP_001576805.1|2250184_2250436_+	Arc family DNA-binding protein	NA	B8K1J0	Salmonella_phage	91.6	1.9e-35
WP_000757525.1|2250727_2251093_-	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	99.2	8.1e-67
WP_001576809.1|2251130_2251460_+	hypothetical protein	NA	Q9AYY8	Salmonella_phage	95.4	1.1e-49
WP_001576810.1|2251460_2253629_-	hypothetical protein	NA	Q9AYY9	Salmonella_phage	94.9	0.0e+00
WP_000246980.1|2253628_2254978_-	DNA transfer protein	NA	Q9AYZ0	Salmonella_phage	99.3	4.3e-246
WP_000964872.1|2254988_2255681_-	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.8	5.8e-114
WP_000614036.1|2255683_2256139_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.0	2.6e-86
WP_001576811.1|2256138_2257092_-	hypothetical protein	NA	Q716G6	Shigella_phage	84.5	1.0e-92
WP_001576812.1|2257091_2258510_-	packaged DNA stabilization protein gp10	NA	A0A088CQ70	Enterobacteria_phage	99.6	5.4e-276
WP_001140510.1|2258519_2258981_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001576814.1|2258961_2259150_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	98.4	6.5e-28
WP_001576816.1|2259191_2260445_-	hypothetical protein	NA	A0A088CQ56	Enterobacteria_phage	99.5	3.7e-236
WP_001576818.1|2260463_2261357_-	hypothetical protein	NA	A0A088CPT0	Enterobacteria_phage	97.6	1.5e-127
WP_001576819.1|2261450_2263646_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	97.0	0.0e+00
WP_000200766.1|2263647_2265063_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	1.2e-278
WP_000113732.1|2265059_2265500_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000807785.1|2265502_2265745_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001576820.1|2265992_2266478_-	GIY-YIG nuclease family protein	NA	C6ZR70	Salmonella_phage	99.4	1.9e-87
WP_001139677.1|2266682_2266835_-	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	98.0	8.1e-21
WP_001576821.1|2266822_2267260_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	97.2	5.5e-70
WP_000229392.1|2267256_2267733_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|2267716_2268040_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000027554.1|2268548_2269067_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	5.9e-95
WP_000994516.1|2269063_2269252_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008200.1|2269248_2269611_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000002243.1|2269607_2269898_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001001006.1|2269890_2270103_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	98.6	3.6e-35
WP_000950962.1|2270095_2270272_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	100.0	1.9e-26
WP_001576824.1|2270264_2270633_-	DUF2591 family protein	NA	A5VW89	Enterobacteria_phage	47.5	5.4e-18
WP_001254220.1|2270635_2270812_-	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_001576826.1|2270808_2271219_-	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	96.3	7.4e-69
WP_000344561.1|2271221_2271488_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	64.8	1.0e-26
WP_000049638.1|2271499_2271700_-	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
WP_000796282.1|2271696_2272023_-	hypothetical protein	NA	Q716D0	Shigella_phage	100.0	3.3e-59
WP_001248394.1|2272095_2273472_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.8e-253
WP_001576828.1|2273468_2274356_-	replication protein	NA	A5VW95	Enterobacteria_phage	99.0	6.9e-144
WP_001576829.1|2274418_2274691_-	hypothetical protein	NA	G9L679	Escherichia_phage	98.9	4.6e-43
WP_000251072.1|2274713_2275007_-	lambda phage CII family protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000437875.1|2275125_2275326_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274755.1|2275426_2276140_+	LexA family transcriptional regulator	NA	A4KWS8	Enterobacteria_phage	100.0	2.1e-127
WP_001576830.1|2276258_2277164_+	hypothetical protein	NA	A4KWU2	Enterobacteria_phage	94.1	5.7e-162
WP_072093907.1|2277510_2277969_+	antitermination protein N	NA	J3JZZ6	Escherichia_phage	86.9	2.4e-55
WP_001576832.1|2277980_2278604_+	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	97.1	3.3e-108
WP_001576833.1|2278667_2279138_+	hypothetical protein	NA	G9L670	Escherichia_phage	98.1	1.7e-85
WP_000065374.1|2279288_2279657_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001576834.1|2279691_2280660_+	hypothetical protein	NA	G5DA88	Enterobacteria_phage	99.7	1.7e-55
WP_000638547.1|2280684_2280816_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2280800_2280953_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000050554.1|2281028_2281199_+	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_001576835.1|2281209_2281815_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	9.2e-108
WP_000951323.1|2281814_2282198_+	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
WP_001111302.1|2282221_2282515_+	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	99.0	1.5e-50
WP_001576836.1|2282525_2282690_+	DUF2737 family protein	NA	K7P7M6	Enterobacteria_phage	100.0	5.5e-23
WP_001576837.1|2282686_2283160_+	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	70.8	2.9e-56
WP_001576838.1|2283156_2283825_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	70.7	2.3e-75
WP_001576840.1|2284394_2284679_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	97.9	5.9e-49
WP_001576841.1|2284751_2284919_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001576843.1|2285258_2285450_+	hypothetical protein	NA	A0A0P0ZBL0	Stx2-converting_phage	98.4	9.2e-30
WP_024188919.1|2285430_2286609_-|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	99.2	7.5e-231
WP_001576845.1|2286790_2288215_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001531805.1|2288325_2288784_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
2293822:2293837	attR	GTTGATGAAGCCTGGG	NA	NA	NA	NA
>prophage 6
NZ_CP014495	Escherichia coli strain SaT040 chromosome, complete genome	5061821	2311931	2318234	5061821		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|2311931_2312474_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|2312478_2313357_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|2313414_2314314_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|2314313_2315399_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|2315771_2316665_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|2316839_2318234_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 7
NZ_CP014495	Escherichia coli strain SaT040 chromosome, complete genome	5061821	2412410	2421855	5061821		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|2412410_2413547_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|2413543_2415547_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|2415671_2416133_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2416173_2416644_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2416690_2417410_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2417406_2419092_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|2419313_2420045_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|2420104_2420212_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|2420192_2420924_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|2420928_2421855_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
>prophage 8
NZ_CP014495	Escherichia coli strain SaT040 chromosome, complete genome	5061821	3027084	3034224	5061821		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|3027084_3029646_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|3029751_3030408_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001296319.1|3030458_3031226_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|3031421_3032330_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|3032326_3033589_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|3033585_3034224_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 9
NZ_CP014495	Escherichia coli strain SaT040 chromosome, complete genome	5061821	3280258	3338634	5061821	integrase,lysis,transposase,tRNA,protease	Staphylococcus_phage(25.0%)	48	3300196:3300211	3339033:3339048
WP_001327406.1|3280258_3281017_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_000105562.1|3281220_3282141_-	agmatinase	NA	NA	NA	NA	NA
WP_000758911.1|3282276_3283008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|3283153_3285130_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|3285138_3285270_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001331575.1|3285405_3285621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|3285924_3287079_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|3287514_3288909_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|3288985_3289483_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001327408.1|3289577_3290285_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|3290364_3291096_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593261.1|3291108_3292059_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|3292167_3292731_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|3292730_3293147_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001327409.1|3293320_3294301_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|3294318_3295023_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|3295040_3295607_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|3295603_3295894_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174738.1|3295901_3296495_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239981.1|3296487_3297624_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745192.1|3297692_3298700_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394106.1|3298816_3299863_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|3300038_3300758_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
3300196:3300211	attL	AATGGGTTACCGCCGC	NA	NA	NA	NA
WP_001107565.1|3300941_3301268_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786915.1|3301267_3301987_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001327411.1|3302147_3303200_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091699.1|3303227_3303503_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|3303567_3304647_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001327414.1|3304848_3306105_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839794.1|3306153_3308289_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234491.1|3308687_3309395_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|3309773_3311039_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|3311294_3312338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|3313836_3314388_+	HTH-type transcriptional regulator PapX	NA	NA	NA	NA	NA
WP_000006213.1|3317074_3317308_+	major pilus subunit operon transcriptional regulator PapI	NA	NA	NA	NA	NA
WP_001513409.1|3319175_3319289_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|3321122_3321383_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|3321424_3321985_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|3322024_3322453_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_103103190.1|3323161_3324389_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	1.2e-170
WP_000074472.1|3324502_3325696_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|3325831_3327556_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|3327556_3328504_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|3328503_3330246_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001576313.1|3330242_3331520_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|3331601_3333803_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_011076574.1|3334353_3334497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034083.1|3334746_3338634_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
3339033:3339048	attR	AATGGGTTACCGCCGC	NA	NA	NA	NA
>prophage 10
NZ_CP014495	Escherichia coli strain SaT040 chromosome, complete genome	5061821	4739777	4744690	5061821	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
WP_000692349.1|4739777_4739999_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	2.1e-09
WP_001186788.1|4740085_4740562_-	RadC family protein	NA	NA	NA	NA	NA
WP_000849596.1|4740577_4741063_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	3.4e-12
WP_001234642.1|4741117_4741936_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	1.5e-44
WP_001119719.1|4742035_4742269_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_001539664.1|4742354_4742759_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.1e-69
WP_000612617.1|4742755_4743103_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	7.5e-62
WP_061186101.1|4743151_4744690_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.6	4.5e-292
