The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP005188	Sphingobium sp. MI1205 chromosome 1, complete sequence	3351250	300898	340587	3351250	terminase,head,plate,integrase,tail,protease,portal,capsid	Burkholderia_phage(24.14%)	54	302715:302752	340620:340657
WP_062113260.1|300898_302341_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_037462865.1|302403_302631_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
302715:302752	attL	GTGTAAACGAGACGCTCTACCAACTGAGCTAATCGCCC	NA	NA	NA	NA
WP_145902189.1|302905_303652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062113268.1|304634_304958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113271.1|305035_305935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145902190.1|305947_306682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083535791.1|306747_307797_-|portal	phage portal protein	portal	E5E3X1	Burkholderia_phage	57.6	4.4e-105
WP_062113280.1|307793_309647_-	oxidoreductase	NA	A4JWU9	Burkholderia_virus	52.5	1.5e-172
WP_083535945.1|309811_310615_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	46.4	8.1e-51
WP_062113285.1|310671_311754_+|capsid	phage major capsid protein, P2 family	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	49.9	3.6e-86
WP_062113288.1|311793_312603_+|terminase	terminase	terminase	A4PE31	Ralstonia_virus	42.3	1.7e-32
WP_062113291.1|312723_312984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113294.1|312980_313463_+|head	head completion/stabilization protein	head	K4NZV5	Burkholderia_phage	45.1	1.5e-23
WP_062113298.1|313462_313687_+|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	44.1	3.1e-08
WP_062113301.1|313690_314023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113305.1|314026_314479_+	hypothetical protein	NA	A0A1B1IWJ5	uncultured_Mediterranean_phage	54.4	3.4e-38
WP_062113308.1|314475_314871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062120146.1|314815_315001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113311.1|315003_315522_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	43.7	3.3e-21
WP_062113314.1|315518_316190_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	30.0	8.0e-12
WP_145902191.1|316196_316742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062120149.1|316968_317862_+|plate	baseplate assembly protein	plate	V5YTH6	Pseudomonas_phage	55.9	2.1e-76
WP_062113322.1|317858_318410_+|tail	phage tail protein I	tail	R4JET8	Burkholderia_phage	48.6	1.0e-44
WP_062113325.1|318421_320407_+	hypothetical protein	NA	V9IQX0	Stenotrophomonas_phage	44.6	9.0e-43
WP_062113328.1|320410_320800_+	hypothetical protein	NA	A0A291LAV4	Bordetella_phage	40.5	1.0e-14
WP_062113331.1|320809_321055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113334.1|321225_322044_+	DNA adenine methylase	NA	A0A291AUP9	Sinorhizobium_phage	58.7	1.1e-87
WP_062113336.1|322107_322881_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_062120152.1|323051_323588_+|plate	phage baseplate assembly protein V	plate	A0A2H4JFJ8	uncultured_Caudovirales_phage	43.4	1.1e-35
WP_062113339.1|323587_323938_+	oxidoreductase	NA	V9IQW0	Stenotrophomonas_phage	50.9	2.8e-24
WP_062113343.1|323953_325129_+|tail	phage tail protein	tail	F1BUU3	Erwinia_phage	58.5	5.4e-120
WP_062113346.1|325167_325680_+|tail	phage major tail tube protein	tail	E5E3Q2	Burkholderia_phage	51.5	1.4e-45
WP_062113349.1|325740_326049_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	58.3	3.1e-19
WP_062113351.1|326057_326189_+|tail	GpE family phage tail protein	tail	E5E3Q0	Burkholderia_phage	56.4	3.1e-05
WP_062113355.1|326188_328666_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	43.4	1.8e-85
WP_062113357.1|328678_329092_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	52.0	3.4e-29
WP_083535792.1|329088_330099_+	late control protein	NA	R4JDM6	Burkholderia_phage	45.9	6.5e-74
WP_145902192.1|330203_330842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083535793.1|330890_331313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062113362.1|331312_331987_-	helix-turn-helix transcriptional regulator	NA	A0A0R6PFB5	Moraxella_phage	28.0	1.4e-11
WP_063619022.1|332072_332402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113363.1|332401_332644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113365.1|332709_333042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113367.1|333038_333557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113370.1|333553_334042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113372.1|334102_334339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113377.1|334435_337147_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	43.5	2.9e-209
WP_083535946.1|337203_337554_+	DUF2312 domain-containing protein	NA	Q8W6H2	Sinorhizobium_phage	49.3	3.5e-11
WP_062113381.1|337550_337754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145902193.1|337750_338218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145902194.1|338214_338658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113390.1|338654_339344_+	hypothetical protein	NA	A0A1P8VV97	Erythrobacter_phage	52.3	2.4e-51
WP_158511138.1|339340_339640_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062113394.1|339525_340587_+|integrase	site-specific integrase	integrase	A0A076G7B8	Sinorhizobium_phage	35.1	2.8e-43
340620:340657	attR	GTGTAAACGAGACGCTCTACCAACTGAGCTAATCGCCC	NA	NA	NA	NA
>prophage 2
NZ_CP005188	Sphingobium sp. MI1205 chromosome 1, complete sequence	3351250	409178	457401	3351250	transposase	Enterobacteria_phage(33.33%)	44	NA	NA
WP_161626247.1|409178_410651_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_004211466.1|410647_411511_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	34.4	2.5e-34
WP_044661445.1|413827_415060_-	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_083535948.1|415131_415917_-	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_044661447.1|416684_417725_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_062113516.1|417859_419344_-	hypothetical protein	NA	A0A1S6UB21	Serratia_phage	47.7	4.2e-61
WP_020819327.1|419514_419763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083535799.1|419876_420224_+	thermonuclease family protein	NA	NA	NA	NA	NA
WP_083535800.1|420393_420633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083535801.1|420637_421372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043155119.1|421968_423309_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_158511139.1|423843_424407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044661452.1|424411_424804_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_044661453.1|424832_425450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044661454.1|425573_425762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062113527.1|426041_426497_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_044661455.1|426480_426750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083535803.1|426881_427394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044663008.1|427572_428913_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_157009805.1|429038_429206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052628189.1|429287_429857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052628190.1|429926_431180_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_044661457.1|431176_432178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145902201.1|432187_432595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044661459.1|433252_436411_-	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_044661460.1|436413_439101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044661461.1|439437_439974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044661462.1|439970_440330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044661463.1|440471_440969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083535804.1|440965_441541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052628192.1|442067_442499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044663011.1|442694_444656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113540.1|444805_445543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062113542.1|445668_446502_+	EcsC family protein	NA	NA	NA	NA	NA
WP_044661468.1|447319_448852_+	cell division protein Fic	NA	NA	NA	NA	NA
WP_044663013.1|449184_449616_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_044661469.1|449612_450098_+	RES domain-containing protein	NA	NA	NA	NA	NA
WP_044661470.1|450467_451550_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_158511140.1|452725_453061_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_062113545.1|453104_453713_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_145902195.1|453643_454401_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	42.6	2.0e-14
WP_062113549.1|454507_454711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044661470.1|454850_455933_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044661472.1|456042_457401_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP005188	Sphingobium sp. MI1205 chromosome 1, complete sequence	3351250	958398	965813	3351250	tRNA	Synechococcus_phage(33.33%)	10	NA	NA
WP_037461593.1|958398_959052_+	fructose-6-phosphate aldolase	NA	M1PR54	Cyanophage	49.3	2.8e-49
WP_062114622.1|959193_959544_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_062120346.1|959804_960524_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	33.6	9.8e-16
WP_062114625.1|960530_961277_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_062114627.1|961403_962312_-|tRNA	methionyl-tRNA formyltransferase	tRNA	M4QRX9	Synechococcus_phage	28.4	5.8e-05
WP_062114630.1|962365_962962_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_062114633.1|962993_963524_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.5	9.4e-24
WP_037461627.1|963604_964306_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	36.2	4.6e-34
WP_062114636.1|964308_965004_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_062120349.1|965024_965813_-	phosphate ABC transporter ATP-binding protein	NA	M1IC18	Acanthocystis_turfacea_Chlorella_virus	26.0	2.8e-08
>prophage 4
NZ_CP005188	Sphingobium sp. MI1205 chromosome 1, complete sequence	3351250	2311539	2353409	3351250	head,tail,tRNA,protease,portal,capsid	uncultured_Mediterranean_phage(10.53%)	48	NA	NA
WP_062117387.1|2311539_2312817_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.3	1.3e-95
WP_062117392.1|2312912_2313677_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	37.8	1.1e-36
WP_062117396.1|2313696_2314740_+	potassium channel family protein	NA	NA	NA	NA	NA
WP_062120781.1|2314809_2316177_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_062117400.1|2316221_2317070_-	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_062120785.1|2317069_2317270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062117402.1|2317409_2318813_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	29.1	4.4e-28
WP_062117404.1|2318868_2319276_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_062117407.1|2319235_2320144_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	42.5	1.3e-09
WP_062117409.1|2320140_2321085_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_062120788.1|2321118_2321322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062117412.1|2321462_2321717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062117414.1|2321759_2323088_+	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_062117415.1|2323088_2323907_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_062117417.1|2324017_2324977_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	38.7	9.3e-38
WP_062117419.1|2324983_2325214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062117421.1|2325359_2325893_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_062117424.1|2325935_2327642_-	long-chain fatty acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	24.1	2.5e-25
WP_062117438.1|2327768_2328452_-	DUF1013 domain-containing protein	NA	NA	NA	NA	NA
WP_062117441.1|2328566_2329595_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_062117444.1|2329594_2330455_-	UDP-2,3-diacylglucosamine diphosphatase	NA	A0A218MKA7	uncultured_virus	49.0	1.2e-65
WP_062117447.1|2330555_2331560_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_062117449.1|2331661_2331859_+	DUF1192 domain-containing protein	NA	NA	NA	NA	NA
WP_062117452.1|2332015_2334334_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.7	7.2e-177
WP_062117454.1|2334685_2335315_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_062117458.1|2335375_2336110_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_062120791.1|2336228_2336774_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_062117461.1|2336796_2337348_-	superoxide dismutase family protein	NA	B6S2G0	Adoxophyes_orana_nucleopolyhedrovirus	35.7	3.4e-08
WP_062117464.1|2337680_2338769_-	OmpA family protein	NA	NA	NA	NA	NA
WP_062117467.1|2338946_2339450_-	DUF2793 domain-containing protein	NA	A0A1V0DY81	Dinoroseobacter_phage	39.1	1.8e-16
WP_062117470.1|2339480_2341676_-	hypothetical protein	NA	M4QNR6	Tetraselmis_viridis_virus	29.4	7.3e-54
WP_145902264.1|2341663_2342074_-	peptidoglycan endopeptidase	NA	NA	NA	NA	NA
WP_062117476.1|2342082_2342898_-	DUF2163 domain-containing protein	NA	Q5DN21	Alphaproteobacteria_virus	41.4	1.3e-11
WP_062117479.1|2342894_2345225_-	DUF2460 domain-containing protein	NA	A0A2H4P7I1	Pseudomonas_phage	30.5	7.6e-33
WP_062117482.1|2345221_2345773_-	hypothetical protein	NA	D6PEW0	uncultured_phage	37.4	8.9e-09
WP_037467282.1|2345809_2346004_-|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_062117484.1|2346000_2346312_-	gene transfer agent family protein	NA	NA	NA	NA	NA
WP_062117488.1|2346308_2346716_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_062117490.1|2346771_2347089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062117492.1|2347217_2347616_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_083535884.1|2347612_2347837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083535885.1|2347803_2348340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062117499.1|2348436_2349552_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	41.8	5.0e-75
WP_145902331.1|2349687_2350074_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	36.0	1.2e-12
WP_062117503.1|2350097_2350418_-	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	46.1	1.2e-08
WP_062117507.1|2350439_2351567_-|portal	phage portal protein	portal	W8ECU7	Geobacillus_phage	35.4	2.5e-50
WP_062117509.1|2351676_2352015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062117512.1|2352074_2353409_-	DNA-packaging protein	NA	A0A1V0DY66	Dinoroseobacter_phage	40.4	1.1e-73
>prophage 5
NZ_CP005188	Sphingobium sp. MI1205 chromosome 1, complete sequence	3351250	2489771	2495281	3351250		uncultured_Mediterranean_phage(66.67%)	8	NA	NA
WP_062120829.1|2489771_2490767_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	40.3	8.5e-50
WP_083535892.1|2490811_2491864_+	cell wall hydrolase	NA	A0A0S1WEP8	Vibrio_phage	30.2	2.2e-08
WP_062117899.1|2492205_2492334_+	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_062117901.1|2492392_2493178_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	42.2	6.9e-47
WP_062117904.1|2493174_2493606_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_062117907.1|2493637_2493880_-	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	66.7	6.9e-06
WP_062117909.1|2493908_2494502_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	43.9	6.8e-39
WP_062117912.1|2494498_2495281_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.8	7.4e-33
>prophage 6
NZ_CP005188	Sphingobium sp. MI1205 chromosome 1, complete sequence	3351250	2537563	2577218	3351250	integrase	Yellowstone_lake_phycodnavirus(14.29%)	39	2567070:2567086	2579249:2579265
WP_062118011.1|2537563_2538601_+|integrase	site-specific integrase	integrase	D6PF86	uncultured_phage	28.1	2.3e-26
WP_145902338.1|2538699_2538981_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_062118016.1|2539000_2539282_-	Killer protein	NA	A0A222YWE2	Escherichia_phage	38.0	1.2e-06
WP_062118019.1|2539554_2539926_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_062118022.1|2540089_2541208_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	24.6	1.2e-07
WP_062118025.1|2542683_2542911_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_062118028.1|2542914_2543295_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	46.5	8.0e-09
WP_062118031.1|2543664_2544063_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_062118033.1|2544062_2544746_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_083535896.1|2544796_2545666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062118038.1|2545717_2547268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062118040.1|2547362_2548130_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_062118043.1|2548123_2549203_+	CDP-glucose 4,6-dehydratase	NA	A0A0P0YM09	Yellowstone_lake_phycodnavirus	23.5	1.8e-05
WP_062118046.1|2549193_2550567_+	lipopolysaccharide biosynthesis protein RfbH	NA	A0A0P0YLZ6	Yellowstone_lake_phycodnavirus	34.2	1.3e-48
WP_145902269.1|2550611_2551724_+	N-acetylneuraminic acid synthase	NA	NA	NA	NA	NA
WP_062120858.1|2551791_2553630_+	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	34.9	6.9e-90
WP_062118051.1|2553626_2554313_+	HAD hydrolase-like protein	NA	NA	NA	NA	NA
WP_158511178.1|2554327_2555299_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_062118055.1|2555291_2556239_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_062118058.1|2556242_2556683_+	GtrA family protein	NA	NA	NA	NA	NA
WP_062118062.1|2556672_2557743_+	FkbM family methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	32.6	3.1e-05
WP_158511179.1|2557777_2558671_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_062120861.1|2559060_2561025_-	relaxase/mobilization nuclease and DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_062118068.1|2561276_2561648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145902339.1|2561870_2562446_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	48.6	1.2e-11
WP_062118074.1|2562466_2563048_-	S26 family signal peptidase	NA	NA	NA	NA	NA
WP_062118077.1|2563044_2563275_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062118080.1|2563429_2563729_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_062118083.1|2564482_2566246_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_062118086.1|2566339_2566768_-	DUF2958 domain-containing protein	NA	NA	NA	NA	NA
WP_062118088.1|2566764_2567028_-	hypothetical protein	NA	A0A1V0EEV1	Caulobacter_phage	55.9	5.0e-10
2567070:2567086	attL	AGGCGGGGGTGGGCGGC	NA	NA	NA	NA
WP_062118092.1|2567139_2567364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020818728.1|2567354_2568218_-	DUF1738 domain-containing protein	NA	A0A1B1IWW8	uncultured_Mediterranean_phage	35.0	2.3e-35
WP_020818727.1|2568387_2570550_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_020818726.1|2570546_2572334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020818725.1|2572330_2573680_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_020818724.1|2574073_2575066_-|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	28.3	2.3e-23
WP_020818723.1|2575062_2576004_-|integrase	tyrosine-type recombinase/integrase	integrase	U3PCM7	Lactobacillus_phage	30.6	1.4e-06
WP_020818722.1|2576000_2577218_-|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	27.4	4.7e-10
2579249:2579265	attR	AGGCGGGGGTGGGCGGC	NA	NA	NA	NA
>prophage 7
NZ_CP005188	Sphingobium sp. MI1205 chromosome 1, complete sequence	3351250	2616818	2623063	3351250	transposase	Stx2-converting_phage(33.33%)	6	NA	NA
WP_083535902.1|2616818_2618414_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.7	2.2e-100
WP_051093233.1|2618481_2618781_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	57.0	1.3e-22
WP_083535903.1|2618834_2619227_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	43.8	7.0e-08
WP_062118189.1|2619861_2621028_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A0E3G3R2	Synechococcus_phage	31.2	1.5e-45
WP_062118192.1|2621024_2621954_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1D8KU05	Synechococcus_phage	37.8	6.5e-52
WP_062120887.1|2622004_2623063_-	GDP-mannose 4,6-dehydratase	NA	M1HKY0	Acanthocystis_turfacea_Chlorella_virus	62.7	1.1e-124
>prophage 8
NZ_CP005188	Sphingobium sp. MI1205 chromosome 1, complete sequence	3351250	2987062	3006391	3351250	head,terminase,tail,protease,portal,capsid	Rhodobacter_phage(16.67%)	23	NA	NA
WP_063619043.1|2987062_2987623_-	hypothetical protein	NA	D6QWP0	uncultured_phage	45.0	2.1e-29
WP_158511188.1|2987622_2987934_-	hypothetical protein	NA	I3UM16	Rhodobacter_phage	52.3	7.5e-13
WP_062119157.1|2988003_2988258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062119160.1|2988254_2989226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062119163.1|2989222_2989879_-	DUF2793 domain-containing protein	NA	A0A172PZV5	Pseudomonas_phage	36.4	2.7e-12
WP_062119166.1|2989889_2993147_-	hypothetical protein	NA	Q5DN19	Alphaproteobacteria_virus	24.7	7.3e-66
WP_062119170.1|2993136_2993562_-	hypothetical protein	NA	F4YXU4	Roseobacter_phage	40.9	5.6e-11
WP_062119172.1|2993554_2994421_-	DUF2163 domain-containing protein	NA	NA	NA	NA	NA
WP_062119177.1|2994417_2995017_-	hypothetical protein	NA	Q5DN22	Alphaproteobacteria_virus	31.4	3.3e-17
WP_062119179.1|2995016_2997152_-	hypothetical protein	NA	A0A0K1Y6G1	Rhodobacter_phage	40.5	3.7e-34
WP_158511189.1|2997179_2997329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062119182.1|2997463_2997850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062119185.1|2997849_2998299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062119188.1|2998300_2998699_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_062119192.1|2998702_2999113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145902345.1|2999112_2999409_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_062119199.1|2999456_3000011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062119202.1|3000015_3000717_-	hypothetical protein	NA	M1I6Y3	Paramecium_bursaria_Chlorella_virus	33.9	7.3e-24
WP_062119205.1|3000791_3002009_-|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	50.2	2.2e-108
WP_063619044.1|3002032_3002701_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	40.4	7.5e-26
WP_063619071.1|3002697_3003927_-|portal	phage portal protein	portal	B0VK31	Azospirillum_phage	41.5	1.4e-70
WP_062119221.1|3004002_3005742_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	33.9	1.2e-75
WP_062119224.1|3005743_3006391_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
>prophage 9
NZ_CP005188	Sphingobium sp. MI1205 chromosome 1, complete sequence	3351250	3214363	3275754	3351250	integrase,transposase	Trichoplusia_ni_ascovirus(25.0%)	59	3271785:3271805	3283962:3283982
WP_062119711.1|3214363_3215593_+|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	45.5	2.5e-96
WP_062119714.1|3215654_3215888_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062119717.1|3215884_3216115_-	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_062119721.1|3216116_3217304_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_062119724.1|3217300_3218137_-	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_062119727.1|3218133_3218955_-	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_062119730.1|3218958_3220284_-	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_062119733.1|3220449_3221205_-	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_062119735.1|3221204_3223661_-	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_062119738.1|3223654_3223927_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_062119740.1|3223923_3224265_-	TrbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_083535929.1|3224267_3225254_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_062119745.1|3225250_3225652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062119748.1|3225654_3227697_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_062120877.1|3228865_3229435_-	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_083535902.1|3229455_3231051_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.7	2.2e-100
WP_051093233.1|3231118_3231418_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	57.0	1.3e-22
WP_024018734.1|3231471_3231834_-|transposase	transposase	transposase	A0A1B0YZU7	Pseudomonas_phage	43.8	5.0e-08
WP_158511197.1|3233118_3235377_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_062119757.1|3235686_3236457_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_158511198.1|3236491_3236881_-	EthD domain-containing protein	NA	NA	NA	NA	NA
WP_062119763.1|3236950_3237721_-	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.1	1.0e-18
WP_062119767.1|3237756_3238926_-	amidohydrolase	NA	NA	NA	NA	NA
WP_083535931.1|3239118_3239568_+	EthD domain-containing protein	NA	NA	NA	NA	NA
WP_062119774.1|3239686_3240463_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062119777.1|3240476_3241466_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_062119780.1|3241640_3242891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158511199.1|3243019_3243997_+	flavin reductase family protein	NA	Q9KX93	Enterobacteria_phage	45.1	2.9e-10
WP_145902298.1|3244157_3245888_+	FAD-monooxygenase	NA	NA	NA	NA	NA
WP_062119786.1|3245884_3246328_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_062119788.1|3246331_3248362_+	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_062119792.1|3248411_3249239_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062119795.1|3249331_3250183_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_062119798.1|3250283_3251327_+	NAD(P)-dependent alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_062119801.1|3251411_3251810_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_062119804.1|3251806_3252550_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	1.0e-15
WP_158511200.1|3252640_3252814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145902299.1|3252785_3253370_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062119814.1|3253521_3254262_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.7	1.2e-13
WP_062119816.1|3254269_3255421_-	CoA transferase	NA	NA	NA	NA	NA
WP_062119825.1|3255562_3256720_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_145902346.1|3256716_3258843_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_062119831.1|3258856_3260062_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_083535979.1|3260139_3262548_+	transketolase	NA	NA	NA	NA	NA
WP_062121094.1|3262550_3263834_+	pyruvate dehydrogenase complex dihydrolipoamide acetyltransferase	NA	NA	NA	NA	NA
WP_062119833.1|3263982_3264663_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062119837.1|3264924_3265665_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_062119840.1|3265766_3266984_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_145902347.1|3267175_3267715_+	biphenyl 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_083535936.1|3267877_3268618_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062119845.1|3268685_3269291_+	autoinducer synthase	NA	NA	NA	NA	NA
WP_062119848.1|3269287_3270151_+	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_062119851.1|3270152_3270338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158511201.1|3270399_3270885_+	DUF2285 domain-containing protein	NA	NA	NA	NA	NA
WP_062119854.1|3270924_3271158_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
3271785:3271805	attL	TCTCGCCGCCCACCCCCGCCT	NA	NA	NA	NA
WP_083535938.1|3271853_3272567_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	32.8	1.8e-30
WP_020818724.1|3272609_3273602_-|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	28.3	2.3e-23
WP_020818723.1|3273598_3274540_-|integrase	tyrosine-type recombinase/integrase	integrase	U3PCM7	Lactobacillus_phage	30.6	1.4e-06
WP_020818722.1|3274536_3275754_-|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	27.4	4.7e-10
3283962:3283982	attR	TCTCGCCGCCCACCCCCGCCT	NA	NA	NA	NA
>prophage 1
NZ_CP005190	Sphingobium sp. MI1205 plasmid pMI1, complete sequence	292135	140373	181043	292135	transposase	Escherichia_phage(50.0%)	45	NA	NA
WP_031291306.1|140373_141186_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_007687848.1|141271_141487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020820199.1|141725_142688_-	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_007687852.1|142909_143899_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007687859.1|144225_145284_+	maleylacetate reductase	NA	NA	NA	NA	NA
WP_007687861.1|145395_146154_-	esterase	NA	NA	NA	NA	NA
WP_007687863.1|146630_146834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062121709.1|146978_147350_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_001389365.1|147321_148086_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_013035740.1|148489_149530_-	2,5-dichlorohydroquinone reductive dechlorinase	NA	NA	NA	NA	NA
WP_007686013.1|149589_150222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007686010.1|150229_150946_-	esterase	NA	NA	NA	NA	NA
WP_013041682.1|150942_151752_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_007686007.1|151776_152742_-	chlorohydroquinone/hydroquinone 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_013041683.1|152873_153785_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007685998.1|153879_156435_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_007685997.1|156626_157151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007685995.1|157367_157820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007685994.1|157848_158541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007685993.1|158706_159303_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	47.8	4.0e-39
WP_007685992.1|159295_160948_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_007685991.1|160947_161925_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_062121710.1|162025_162595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062121711.1|162754_163429_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062121712.1|163684_164626_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001389365.1|164591_165356_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_007687863.1|165849_166053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007687861.1|166529_167288_+	esterase	NA	NA	NA	NA	NA
WP_001389365.1|167831_168596_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_007682395.1|168693_169056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007682394.1|169055_169742_-	EthD domain-containing protein	NA	NA	NA	NA	NA
WP_015460611.1|169763_170516_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	4.3e-14
WP_007682392.1|170555_171926_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001389365.1|171967_172732_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_007682039.1|173805_174567_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.2	8.8e-15
WP_081440685.1|174612_175281_+	EthD domain-containing protein	NA	NA	NA	NA	NA
WP_145907151.1|175225_175519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007682041.1|175701_176376_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	31.9	4.3e-05
WP_007682049.1|176837_177170_-	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_007682056.1|177150_177459_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_029987071.1|177490_178051_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	51.2	3.0e-36
WP_001389365.1|178095_178860_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_062121713.1|179019_179910_-	haloalkane dehalogenase	NA	B9U1C3	Vaccinia_virus	42.3	7.1e-56
WP_007682112.1|179995_180250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|180278_181043_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 1
NZ_CP005191	Sphingobium sp. MI1205 plasmid pMI2, complete sequence	287488	5312	30230	287488	transposase,integrase	Escherichia_phage(33.33%)	28	NA	NA
WP_001389365.1|5312_6077_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_007684554.1|6844_7126_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_021246202.1|7094_7415_+	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_007684557.1|7519_7750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007684562.1|7779_8043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013041473.1|8195_8813_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_007684572.1|8933_10130_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	43.0	1.9e-80
WP_004211466.1|10675_11539_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	33.2	1.4e-29
WP_007683624.1|11989_13087_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_007682488.1|13150_14113_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_007682491.1|14112_14511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007682492.1|14507_14813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007682494.1|14812_15202_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_007682496.1|15198_15447_-	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_013038665.1|15615_17019_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_021246208.1|17011_18850_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_001389365.1|18878_19643_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_031293519.1|20003_21377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020818599.1|21603_22032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020818598.1|22028_22481_-	hypothetical protein	NA	A0A1P8VVG0	Erythrobacter_phage	50.4	3.9e-26
WP_158500939.1|22981_23821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020818528.1|23943_24417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025160754.1|24458_24788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020818526.1|24850_25378_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048574958.1|26003_28235_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_020818524.1|28402_28615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021224259.1|28855_29305_+	hypothetical protein	NA	I6NP90	Burkholderia_phage	37.7	8.3e-05
WP_020818522.1|29315_30230_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
>prophage 2
NZ_CP005191	Sphingobium sp. MI1205 plasmid pMI2, complete sequence	287488	66363	114183	287488	transposase,integrase	Lactococcus_phage(40.0%)	49	61457:61471	120099:120113
61457:61471	attL	CCTTTCTGGCTGGAT	NA	NA	NA	NA
WP_020818477.1|66363_67563_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_020818476.1|67583_68237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020818475.1|68308_68509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020818474.1|68558_71630_-	conjugative relaxase	NA	NA	NA	NA	NA
WP_020818473.1|71629_73936_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025160433.1|73925_74216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020818471.1|74770_74989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020818470.1|75108_75333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025160434.1|75699_76233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015460598.1|76786_77050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020818468.1|77052_77619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020818467.1|77800_78799_-	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_020818466.1|79469_80072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020818465.1|80104_80434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007015553.1|80487_80817_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_031297199.1|81688_82003_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_015460591.1|82171_82711_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_015460590.1|83101_83386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015460589.1|83397_84093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020818773.1|84405_85077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015460587.1|85069_85942_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_015460586.1|86081_86387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015460585.1|86391_86781_-	hypothetical protein	NA	A0A1B1IUL8	uncultured_Mediterranean_phage	58.7	8.7e-35
WP_015460584.1|86784_87258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020818772.1|87254_87773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020818771.1|87981_88395_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_020818770.1|88391_88658_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020818759.1|88958_90464_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_020818758.1|90463_91273_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.7	2.4e-26
WP_062121841.1|91490_91853_-	dioxygenase	NA	NA	NA	NA	NA
WP_021222964.1|91918_92347_-	DoxX family protein	NA	NA	NA	NA	NA
WP_020818768.1|92563_93502_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020818767.1|94151_94754_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_020818766.1|95010_95934_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_021222966.1|96089_96404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020818764.1|96400_97567_+	muconate cycloisomerase family protein	NA	Q6A202	Oenococcus_phage	25.5	7.7e-10
WP_020818763.1|97665_99093_+	sodium:solute symporter family protein	NA	NA	NA	NA	NA
WP_021224462.1|99168_100050_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_021224463.1|100385_101159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020818760.1|101326_102394_+	maleylacetate reductase	NA	NA	NA	NA	NA
WP_021224464.1|102472_102619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020818759.1|102804_104310_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_020818758.1|104309_105119_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.7	2.4e-26
WP_020818775.1|105490_105955_-	DUF736 domain-containing protein	NA	NA	NA	NA	NA
WP_020818778.1|107919_108273_-	DUF3768 domain-containing protein	NA	L7TKV8	Rhizobium_phage	43.2	2.2e-13
WP_020819456.1|108975_109434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025160958.1|109417_111226_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_020819454.1|111230_113048_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_025160957.1|113040_114183_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
120099:120113	attR	ATCCAGCCAGAAAGG	NA	NA	NA	NA
>prophage 3
NZ_CP005191	Sphingobium sp. MI1205 plasmid pMI2, complete sequence	287488	145567	166842	287488	transposase,integrase	Mycobacterium_phage(25.0%)	17	145746:145761	170492:170507
WP_020819418.1|145567_146566_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	28.6	3.3e-09
145746:145761	attL	TCTTCGAGGCGCTGAG	NA	NA	NA	NA
WP_020819416.1|148405_149050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020819415.1|149111_150146_-	hypothetical protein	NA	A0A2P1JZU1	Mycobacterium_phage	31.3	1.4e-10
WP_020819414.1|150174_150669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020819413.1|150704_151211_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_100239852.1|151264_151711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020819411.1|151862_152069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020819409.1|152463_154386_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	27.8	3.7e-25
WP_020819407.1|155432_156359_+	cysteine synthase family protein	NA	A0A1W6JHY1	Lactococcus_phage	35.9	3.3e-32
WP_062118092.1|156763_156988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020818728.1|156978_157842_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.0	2.5e-42
WP_020818727.1|158011_160174_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_020818726.1|160170_161958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020818725.1|161954_163304_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_020818724.1|163697_164690_-|integrase	site-specific integrase	integrase	A0A1P8DJ76	Virus_Rctr85	32.3	1.4e-12
WP_020818723.1|164686_165628_-|integrase	tyrosine-type recombinase/integrase	integrase	U3PCM7	Lactobacillus_phage	30.6	1.4e-06
WP_020818722.1|165624_166842_-|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	27.4	4.7e-10
170492:170507	attR	CTCAGCGCCTCGAAGA	NA	NA	NA	NA
>prophage 4
NZ_CP005191	Sphingobium sp. MI1205 plasmid pMI2, complete sequence	287488	188667	218263	287488	transposase,integrase	Salmonella_phage(18.18%)	32	182724:182739	206640:206655
182724:182739	attL	GCGAGGACGTCACCGA	NA	NA	NA	NA
WP_020819377.1|188667_189795_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_031286075.1|189914_192872_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	44.2	1.7e-234
WP_020817918.1|193010_193562_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	56.6	2.0e-45
WP_020817919.1|193558_194347_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_020820238.1|194516_195326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020820237.1|195322_195571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107395150.1|195901_196658_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.2	9.4e-25
WP_020820236.1|196753_198190_-	DUF4942 domain-containing protein	NA	A0A1P8VVC9	Erythrobacter_phage	41.6	4.7e-25
WP_020820235.1|198207_198468_-	hypothetical protein	NA	A0A2I7S8R6	Vibrio_phage	51.0	1.9e-06
WP_020820234.1|198809_199046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020820233.1|199515_200055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020820232.1|200051_200261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020820231.1|200273_200540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020820230.1|200536_200824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020820229.1|200835_201225_-	DUF3768 domain-containing protein	NA	L7TKV8	Rhizobium_phage	35.4	3.1e-08
WP_025160929.1|201552_202833_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_020820227.1|202836_203097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139385176.1|203704_204875_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.6	3.1e-35
WP_020820224.1|204949_205321_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	29.4	3.3e-07
WP_020820223.1|205317_205731_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_020820222.1|205810_206302_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_021222989.1|206434_207805_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	39.6	7.5e-89
206640:206655	attR	GCGAGGACGTCACCGA	NA	NA	NA	NA
WP_079640072.1|207924_208569_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001389365.1|208706_209471_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_013041683.1|210540_211452_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013041682.1|212573_213383_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_007686010.1|213379_214096_+	esterase	NA	NA	NA	NA	NA
WP_007686013.1|214103_214736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013035740.1|214795_215836_+	2,5-dichlorohydroquinone reductive dechlorinase	NA	NA	NA	NA	NA
WP_013041681.1|215949_216915_+	oxidoreductase	NA	NA	NA	NA	NA
WP_145902396.1|217187_217457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|217498_218263_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 1
NZ_CP005192	Sphingobium sp. MI1205 plasmid pMI3, complete sequence	88374	10064	55763	88374	transposase	Escherichia_phage(30.43%)	46	NA	NA
WP_011627727.1|10064_12956_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	38.7	3.5e-189
WP_001389365.1|13249_14014_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_007682392.1|14055_15426_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_015460611.1|15465_16218_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.5	4.3e-14
WP_007682394.1|16239_16926_+	EthD domain-containing protein	NA	NA	NA	NA	NA
WP_007682395.1|16925_17288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|17385_18150_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_007687861.1|18693_19452_-	esterase	NA	NA	NA	NA	NA
WP_007687863.1|19928_20132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|20625_21390_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_062121711.1|22545_23220_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062121710.1|23379_23949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007685991.1|24049_25027_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_007685992.1|25026_26679_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_007685993.1|26671_27268_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	47.8	4.0e-39
WP_007685994.1|27433_28126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007685995.1|28154_28607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015460616.1|29095_29731_+	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	52.6	1.2e-44
WP_015460617.1|29756_30038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015460618.1|30094_31006_-	replication initiation protein	NA	A0A1V0E006	Clostridioides_phage	32.3	3.1e-06
WP_015460621.1|32951_33176_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_015460622.1|33213_33519_-	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_015460623.1|33691_36826_+	Ti-type conjugative transfer relaxase TraA	NA	V5UQN3	Mycobacterium_phage	25.3	2.9e-11
WP_015460630.1|36833_37556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|37965_38730_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_007682112.1|38758_39013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007682110.1|39098_39989_+	haloalkane dehalogenase	NA	B9U1C3	Vaccinia_virus	43.0	3.7e-57
WP_001389365.1|40148_40913_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_007682112.1|40941_41196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007682110.1|41281_42172_+	haloalkane dehalogenase	NA	B9U1C3	Vaccinia_virus	43.0	3.7e-57
WP_001389365.1|42331_43096_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_029987071.1|43140_43701_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	51.2	3.0e-36
WP_007682056.1|43732_44041_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_007682049.1|44021_44354_+	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_007682041.1|44815_45490_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	31.9	4.3e-05
WP_145907151.1|45672_45966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081440685.1|45910_46579_-	EthD domain-containing protein	NA	NA	NA	NA	NA
WP_007682039.1|46624_47386_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	28.2	8.8e-15
WP_145902397.1|47432_47594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011627729.1|47650_50608_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	44.6	1.5e-235
WP_013039114.1|50747_51341_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	56.6	2.2e-45
WP_001389365.1|52245_53010_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_083536069.1|53034_53586_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.0	4.9e-31
WP_007686150.1|53582_54113_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_083536070.1|54130_54490_+	S24 family peptidase	NA	A0A1W6JNS2	Morganella_phage	34.1	2.1e-06
WP_083536073.1|54521_55763_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	38.4	1.5e-72
