The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014304	Hymenobacter sp. PAMC 26628 chromosome, complete genome	5277381	185498	219216	5277381	tRNA,transposase	Trichoplusia_ni_ascovirus(33.33%)	30	NA	NA
WP_068227545.1|185498_186209_+|tRNA	tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD	tRNA	NA	NA	NA	NA
WP_157886741.1|186225_186939_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_071889719.1|186601_187258_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071889722.1|187311_187836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157886742.1|187750_188245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071889728.1|189062_189629_-	LUD domain-containing protein	NA	NA	NA	NA	NA
WP_068227560.1|189625_191008_-	lactate utilization protein	NA	NA	NA	NA	NA
WP_068227565.1|191004_191745_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_068227569.1|191886_193227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068227572.1|193223_194507_-	sugar isomerase	NA	NA	NA	NA	NA
WP_068227576.1|194646_195657_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068227579.1|195760_196798_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_068227582.1|197163_199272_+	bifunctional aldolase/short-chain dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.5	9.3e-06
WP_068227585.1|199475_202619_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_068227588.1|202633_204127_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_068227591.1|204174_206955_+	alpha-L-rhamnosidase	NA	NA	NA	NA	NA
WP_082773618.1|207004_209761_+	alpha-L-rhamnosidase	NA	NA	NA	NA	NA
WP_068227594.1|209817_210387_-	hypothetical protein	NA	A0A2P0VP61	Tetraselmis_virus	26.7	2.4e-09
WP_068227597.1|210669_211101_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068227600.1|211141_211444_-	type II toxin-antitoxin system HigB family toxin	NA	F5A3A2	Riemerella_phage	36.1	1.2e-12
WP_068227604.1|211731_212700_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_068227612.1|212740_213802_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_068227618.1|215161_215425_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_082773621.1|216158_216824_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_068227630.1|216814_217282_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082773622.1|217327_217417_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157886744.1|217485_217827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068227634.1|217929_218187_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_068227637.1|218174_218507_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_068227641.1|218517_219216_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP014304	Hymenobacter sp. PAMC 26628 chromosome, complete genome	5277381	2519494	2564792	5277381	integrase,tRNA,transposase	uncultured_virus(28.57%)	54	2539927:2539941	2567149:2567163
WP_068232754.1|2519494_2520928_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_068232758.1|2521213_2521435_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_068232760.1|2521454_2522756_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_068239269.1|2522817_2523276_+	LptE family protein	NA	NA	NA	NA	NA
WP_068232766.1|2523481_2524957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068232772.1|2524997_2525381_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_068232777.1|2525595_2525886_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	53.1	6.1e-17
WP_068232780.1|2525939_2527586_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	67.0	1.5e-192
WP_157886949.1|2527803_2528052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068232783.1|2528138_2529701_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.0	5.9e-66
WP_068232786.1|2529815_2530721_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082773832.1|2531067_2532690_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	54.2	1.9e-155
WP_071891213.1|2532838_2533633_+	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_068232794.1|2533671_2534379_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_068232798.1|2534487_2536464_+	glycoside hydrolase family 97 protein	NA	NA	NA	NA	NA
WP_068239273.1|2536447_2537167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082773833.1|2537235_2537955_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_082773834.1|2537983_2538655_+	DUF4159 domain-containing protein	NA	NA	NA	NA	NA
WP_068232811.1|2538668_2539244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068232813.1|2539276_2539849_-	glycerol acyltransferase	NA	NA	NA	NA	NA
WP_068239278.1|2539900_2540695_-	patatin-like phospholipase family protein	NA	A0A2H4UUE4	Bodo_saltans_virus	24.8	1.2e-09
2539927:2539941	attL	CCGCCCGGCCCAGGG	NA	NA	NA	NA
WP_068232815.1|2540766_2541615_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_068232817.1|2541719_2542667_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_068232819.1|2543170_2544487_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_068232822.1|2545264_2545633_-	glyoxalase	NA	NA	NA	NA	NA
WP_068232825.1|2546354_2546855_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_082773835.1|2546859_2547471_+	hypothetical protein	NA	A0A223W0X1	Agrobacterium_phage	31.6	2.1e-06
WP_157886950.1|2547581_2547770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082773676.1|2547923_2548340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068228700.1|2548345_2548819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157886951.1|2548798_2549530_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_068232830.1|2549511_2550417_+	response regulator	NA	NA	NA	NA	NA
WP_068232832.1|2550890_2551070_+	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_157886952.1|2551137_2551506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068232838.1|2551710_2552718_+	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
WP_068232841.1|2552714_2553320_+	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_082773621.1|2553366_2554032_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_068227630.1|2554022_2554490_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071891223.1|2554651_2555152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068232844.1|2555214_2555472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068232847.1|2555472_2555661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068232850.1|2555780_2556236_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_068232852.1|2556421_2556640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068232855.1|2556710_2557277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157886953.1|2557334_2558006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082773837.1|2558016_2558235_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068232862.1|2558294_2558546_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157886954.1|2558570_2558936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068232874.1|2558932_2559241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082773839.1|2559745_2561536_+	serine hydrolase	NA	NA	NA	NA	NA
WP_071891040.1|2561795_2562671_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	29.4	2.4e-24
WP_068232883.1|2563288_2563654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157886955.1|2563767_2564238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068232889.1|2564273_2564792_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
2567149:2567163	attR	CCGCCCGGCCCAGGG	NA	NA	NA	NA
>prophage 3
NZ_CP014304	Hymenobacter sp. PAMC 26628 chromosome, complete genome	5277381	2568144	2608357	5277381	integrase,transposase	Moraxella_phage(12.5%)	38	2564959:2564978	2587224:2587243
2564959:2564978	attL	GTAGAAGAAGATGAGCACGA	NA	NA	NA	NA
WP_068232900.1|2568144_2568978_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157886957.1|2569201_2569498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068232907.1|2569669_2570800_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	51.0	2.8e-89
WP_082773840.1|2570771_2572883_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_068232912.1|2572886_2573513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068232915.1|2573516_2574152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071891226.1|2574319_2574751_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	50.9	7.2e-30
WP_068232918.1|2574867_2575176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068232922.1|2575352_2575811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071891229.1|2575827_2578110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068232934.1|2579723_2580500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068232937.1|2581029_2581296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157886958.1|2581380_2581719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068232940.1|2581839_2582085_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068232943.1|2582221_2583094_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_157886959.1|2583074_2583848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157886960.1|2583817_2585017_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_157886961.1|2586242_2587046_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_068239281.1|2587374_2587881_+	hypothetical protein	NA	NA	NA	NA	NA
2587224:2587243	attR	TCGTGCTCATCTTCTTCTAC	NA	NA	NA	NA
WP_068232957.1|2587873_2588575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068232960.1|2588607_2589660_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	29.9	5.5e-07
WP_068232963.1|2589637_2591248_-	PAS domain-containing sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	23.1	9.6e-19
WP_157886962.1|2591403_2592162_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_082773843.1|2592188_2592968_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	4.2e-20
WP_068232968.1|2593028_2594018_+	MCE family protein	NA	NA	NA	NA	NA
WP_068232971.1|2594171_2594522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068232974.1|2594660_2595110_+	BLUF domain-containing protein	NA	NA	NA	NA	NA
WP_068232977.1|2595296_2595797_+	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
WP_068232979.1|2595893_2596361_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162268260.1|2596128_2596527_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068232982.1|2596675_2597446_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_068232985.1|2597480_2599154_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	A0A1X9I671	Streptococcus_phage	24.5	3.5e-16
WP_068232988.1|2602024_2604574_+	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	27.6	1.5e-42
WP_068232990.1|2604851_2605283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068232993.1|2605489_2606326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068232997.1|2606448_2607429_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_068233000.1|2607593_2607974_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.7	2.4e-21
WP_071891231.1|2607868_2608357_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP014304	Hymenobacter sp. PAMC 26628 chromosome, complete genome	5277381	2648479	2677747	5277381	integrase,transposase	Mycobacterium_phage(33.33%)	30	2644730:2644746	2678766:2678782
2644730:2644746	attL	CGCCGCCCTGGCCCGCC	NA	NA	NA	NA
WP_157886967.1|2648479_2649262_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.3	6.7e-18
WP_082773848.1|2651504_2652515_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082773849.1|2652667_2654857_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	25.3	1.1e-57
WP_068233124.1|2655000_2655546_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_068233126.1|2655856_2656594_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_082773850.1|2656703_2658281_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_068233132.1|2658390_2658585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068233135.1|2658814_2659804_+	amidohydrolase	NA	NA	NA	NA	NA
WP_068233138.1|2659917_2660907_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_071891237.1|2661062_2661371_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071891241.1|2661367_2662240_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	32.0	3.4e-26
WP_068227630.1|2662282_2662750_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082773621.1|2662740_2663406_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_068233147.1|2663450_2663879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068233150.1|2663897_2664665_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_068233153.1|2664999_2665293_+	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_157886968.1|2665342_2666464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157886969.1|2666481_2666655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082773851.1|2666775_2667009_-	DUF4138 domain-containing protein	NA	NA	NA	NA	NA
WP_082773852.1|2667009_2667639_-	DUF4138 domain-containing protein	NA	NA	NA	NA	NA
WP_068233163.1|2667650_2668829_-	conjugative transposon protein TraM	NA	NA	NA	NA	NA
WP_068227612.1|2668936_2669998_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_068233166.1|2670354_2671224_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_068233169.1|2671290_2671713_-	DUF5519 family protein	NA	NA	NA	NA	NA
WP_068233171.1|2671730_2672645_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068233174.1|2673053_2673833_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_068233177.1|2673825_2674449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157886970.1|2676463_2676727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082773853.1|2677000_2677354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068233189.1|2677492_2677747_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2678766:2678782	attR	GGCGGGCCAGGGCGGCG	NA	NA	NA	NA
>prophage 5
NZ_CP014304	Hymenobacter sp. PAMC 26628 chromosome, complete genome	5277381	3222644	3259105	5277381	protease,tRNA,transposase	Sphingobium_phage(20.0%)	45	NA	NA
WP_068234376.1|3222644_3222986_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_068234379.1|3222988_3223393_-	DUF4296 domain-containing protein	NA	NA	NA	NA	NA
WP_068234381.1|3223430_3224333_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_068234383.1|3224325_3225261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068234386.1|3225279_3226005_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_068234390.1|3226112_3226763_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_068234392.1|3226976_3228005_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_068234395.1|3228224_3228896_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_068234400.1|3229032_3229407_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_068234402.1|3229499_3229946_-	DUF1573 domain-containing protein	NA	NA	NA	NA	NA
WP_068234405.1|3230112_3231543_-	AAA family ATPase	NA	A0A1W6DX18	Sphingobium_phage	24.8	1.1e-15
WP_157887026.1|3231699_3232176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071892731.1|3232172_3232532_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_082774124.1|3232841_3233498_+	DUF4126 domain-containing protein	NA	NA	NA	NA	NA
WP_068234412.1|3233504_3234017_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_157887027.1|3234073_3234955_+	DUF3822 family protein	NA	NA	NA	NA	NA
WP_068234417.1|3235047_3235518_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	35.1	1.5e-20
WP_068234420.1|3235635_3236109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068234422.1|3236124_3236832_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_068234424.1|3236937_3237447_+	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_068234426.1|3237523_3237751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068234428.1|3237919_3238141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068234429.1|3238357_3239050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068239449.1|3239230_3240280_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_068234430.1|3240447_3241104_+	hypothetical protein	NA	A0A0F6WBP4	Sinorhizobium_phage	30.1	4.5e-15
WP_082773902.1|3241163_3241865_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_068234433.1|3241822_3242365_-	2'-5' RNA ligase family protein	NA	NA	NA	NA	NA
WP_068234436.1|3242409_3243435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068234439.1|3243570_3245481_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.3	3.1e-56
WP_071891348.1|3245604_3246303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082773904.1|3246299_3246752_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068227630.1|3246851_3247319_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082773621.1|3247309_3247975_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_157887028.1|3248339_3248729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082773905.1|3248725_3250171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068234454.1|3250412_3251168_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_068234459.1|3251385_3251670_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_068234461.1|3251666_3251870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157887029.1|3251891_3252542_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157887030.1|3252758_3253253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157887031.1|3253140_3253692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068234474.1|3254065_3254695_+|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	23.3	1.9e-07
WP_068234478.1|3254860_3255475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068234481.1|3255510_3258741_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_082773906.1|3258754_3259105_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP014304	Hymenobacter sp. PAMC 26628 chromosome, complete genome	5277381	4572735	4625239	5277381	tRNA,transposase	Tupanvirus(20.0%)	54	NA	NA
WP_068237385.1|4572735_4573491_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_068237388.1|4573552_4575340_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	2.1e-54
WP_068237391.1|4575336_4576023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068237394.1|4576102_4577386_-	kynureninase	NA	NA	NA	NA	NA
WP_068237396.1|4577687_4578221_-	3-hydroxyanthranilate 3,4-dioxygenase	NA	NA	NA	NA	NA
WP_068237399.1|4578318_4580103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068239821.1|4580420_4581149_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_068237402.1|4581211_4582732_+	DUF2079 domain-containing protein	NA	NA	NA	NA	NA
WP_068237404.1|4582930_4583560_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_068237406.1|4583598_4584894_+	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_068237409.1|4584991_4586014_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	42.7	2.6e-70
WP_068237424.1|4586118_4587174_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D8EQC0	Escherichia_phage	49.4	9.2e-87
WP_068237428.1|4587283_4588291_+	SDR family oxidoreductase	NA	A0A2K9L4U8	Tupanvirus	52.5	6.5e-90
WP_068237431.1|4588396_4589278_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.3	1.9e-93
WP_068237436.1|4589447_4591523_+	OmpA family protein	NA	NA	NA	NA	NA
WP_068237438.1|4591610_4591952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068237441.1|4592069_4592252_-	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_068237444.1|4592367_4592913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068237446.1|4592981_4593782_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_071892349.1|4593878_4595624_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_068237449.1|4595610_4596435_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.5	1.7e-43
WP_068237452.1|4596549_4597068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068237455.1|4597180_4597387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068237458.1|4597540_4599046_-	phytoene desaturase	NA	NA	NA	NA	NA
WP_157887139.1|4599084_4599537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068237462.1|4599554_4600754_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	29.0	5.3e-22
WP_068239827.1|4600837_4601314_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_068237467.1|4601315_4601756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068237470.1|4601802_4603344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157887140.1|4603369_4603732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068237477.1|4603903_4604551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068237479.1|4604677_4605691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068237482.1|4605910_4607323_-	curli production assembly/transport component CsgG	NA	M1ICK2	Pelagibacter_phage	46.2	1.6e-41
WP_068237484.1|4607410_4607833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157887141.1|4607910_4608447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157887142.1|4608674_4609757_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_068237490.1|4609775_4610897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068237498.1|4610981_4611347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157887143.1|4611365_4611572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082774006.1|4611568_4612285_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_068234664.1|4612331_4612808_+|transposase	DDE transposase family protein	transposase	NA	NA	NA	NA
WP_082773909.1|4612813_4613218_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_071892352.1|4613221_4613632_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_068237505.1|4613678_4616651_-	DEAD/DEAH box helicase	NA	A0A0N7D8L3	Dasychira_pudibunda_nucleopolyhedrovirus	29.7	3.8e-45
WP_068237508.1|4616781_4618011_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_157887144.1|4618020_4618485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068237512.1|4618552_4619362_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_071892355.1|4619455_4619887_-	ribosome-binding factor A	NA	NA	NA	NA	NA
WP_068237515.1|4620026_4621460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068237518.1|4621514_4621823_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_157887145.1|4621975_4622719_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157887146.1|4622887_4623307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157887147.1|4623333_4624227_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157887248.1|4624455_4625239_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	32.9	1.7e-21
>prophage 7
NZ_CP014304	Hymenobacter sp. PAMC 26628 chromosome, complete genome	5277381	4631808	4710121	5277381	transposase	Mycobacterium_phage(40.0%)	52	NA	NA
WP_157887148.1|4631808_4632642_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	40.8	2.6e-36
WP_082774008.1|4632757_4632949_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157887149.1|4633206_4634859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082774009.1|4635632_4638716_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_068237537.1|4638738_4640403_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_068237539.1|4640659_4641883_+	T9SS type A sorting domain-containing protein	NA	NA	NA	NA	NA
WP_068237541.1|4641955_4643365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068237544.1|4643413_4645522_+	glycoside hydrolase family 97 protein	NA	NA	NA	NA	NA
WP_068237546.1|4645644_4647042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068237549.1|4647131_4649930_+	starch-binding protein	NA	K4FB16	Cronobacter_phage	33.2	1.5e-06
WP_157887150.1|4650401_4650707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157887151.1|4650808_4651165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068237555.1|4651211_4651487_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082774010.1|4651387_4652224_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_068237569.1|4652561_4652816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071892361.1|4653141_4653357_-	DUF2490 domain-containing protein	NA	NA	NA	NA	NA
WP_068237571.1|4653360_4653789_-	DUF2490 domain-containing protein	NA	NA	NA	NA	NA
WP_068237573.1|4653906_4654623_-	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_068237576.1|4654803_4655994_-	oxalate decarboxylase family bicupin	NA	NA	NA	NA	NA
WP_068237580.1|4656081_4657374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082774012.1|4657499_4659767_-	catalase	NA	A0A2K9L572	Tupanvirus	46.1	2.5e-137
WP_068237582.1|4659928_4660417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068237585.1|4660486_4661419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068237591.1|4663278_4663641_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068237594.1|4665157_4665448_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068237598.1|4665763_4666723_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_068237600.1|4667013_4667520_-	phosphoheptose isomerase	NA	NA	NA	NA	NA
WP_082774013.1|4667615_4667948_-	glycoside hydrolase family 30 protein	NA	NA	NA	NA	NA
WP_068237605.1|4668017_4671356_-	DUF5107 domain-containing protein	NA	NA	NA	NA	NA
WP_068237607.1|4671369_4672767_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_068237614.1|4673139_4673787_-	DUF4861 family protein	NA	NA	NA	NA	NA
WP_068237617.1|4673886_4674813_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_068237620.1|4674875_4676864_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_082774014.1|4676937_4678518_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_068239839.1|4678593_4679589_-	multidrug DMT transporter permease	NA	NA	NA	NA	NA
WP_157887152.1|4679667_4682274_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_068237625.1|4682355_4683270_-	ribokinase	NA	NA	NA	NA	NA
WP_068237627.1|4683324_4685238_-	heparinase	NA	NA	NA	NA	NA
WP_068237630.1|4685311_4686352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068237633.1|4686389_4689056_-	glucan 1,4-alpha-glucosidase	NA	NA	NA	NA	NA
WP_071892366.1|4689088_4690288_-	DUF4861 family protein	NA	NA	NA	NA	NA
WP_068237638.1|4690433_4691888_-	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_082774016.1|4691906_4695152_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_068237644.1|4695243_4696437_-	glucuronyl hydrolase	NA	NA	NA	NA	NA
WP_068239842.1|4696494_4697388_-	carbohydrate kinase	NA	NA	NA	NA	NA
WP_157887153.1|4697669_4700597_-	substrate-binding domain-containing protein	NA	W8CYF6	Bacillus_phage	25.8	8.4e-13
WP_082774017.1|4700767_4702411_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_068237654.1|4702846_4703878_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_068237656.1|4704099_4704870_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	NA	NA	NA	NA
WP_068237659.1|4704886_4705717_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_157887154.1|4705853_4708133_+	alpha-mannosidase	NA	NA	NA	NA	NA
WP_157887155.1|4709305_4710121_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	40.8	2.6e-36
>prophage 8
NZ_CP014304	Hymenobacter sp. PAMC 26628 chromosome, complete genome	5277381	4998431	5019697	5277381	integrase,transposase	Bacteroides_phage(50.0%)	22	5009227:5009244	5032491:5032508
WP_068238365.1|4998431_4998788_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068238367.1|4998835_4999474_-	recombinase family protein	NA	H2A0H0	Bacteroides_phage	35.5	1.7e-19
WP_068238369.1|4999612_4999996_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_082774038.1|4999920_5000541_+	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_157887181.1|5001514_5001655_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_068238375.1|5001664_5002693_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	33.1	1.1e-31
WP_082774041.1|5002931_5003468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162268276.1|5003675_5003960_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071892632.1|5004072_5004468_-|transposase	IS1 transposase	transposase	NA	NA	NA	NA
WP_071892408.1|5004891_5005659_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_068238387.1|5006138_5006765_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068238390.1|5006981_5008064_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_068238394.1|5008079_5011223_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
5009227:5009244	attL	TCACGTTTGCCGTGCTGC	NA	NA	NA	NA
WP_082774043.1|5011239_5012544_+	TolC family protein	NA	NA	NA	NA	NA
WP_068238398.1|5012856_5013444_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_068238400.1|5013525_5014278_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_068238402.1|5014321_5015206_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_068238404.1|5015218_5016190_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_068238406.1|5016402_5016639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068238408.1|5016855_5017791_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_068238410.1|5017891_5018686_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_068238412.1|5018734_5019697_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
5032491:5032508	attR	TCACGTTTGCCGTGCTGC	NA	NA	NA	NA
>prophage 9
NZ_CP014304	Hymenobacter sp. PAMC 26628 chromosome, complete genome	5277381	5052003	5078411	5277381	integrase,transposase	Trichoplusia_ni_ascovirus(50.0%)	30	5046847:5046861	5053919:5053933
5046847:5046861	attL	AGGTGCGGGCGAAGG	NA	NA	NA	NA
WP_068238455.1|5052003_5052972_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_068238457.1|5053085_5053484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068238459.1|5053673_5054411_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.5	1.9e-22
5053919:5053933	attR	AGGTGCGGGCGAAGG	NA	NA	NA	NA
WP_068238460.1|5054549_5055410_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_068238461.1|5055579_5055915_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068238462.1|5056304_5057255_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_068238464.1|5057402_5058269_+	oxidoreductase	NA	NA	NA	NA	NA
WP_082774046.1|5058420_5058597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068238465.1|5058808_5059846_+	aldehyde reductase	NA	NA	NA	NA	NA
WP_082774047.1|5059842_5060349_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_068238469.1|5060327_5061146_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068238473.1|5062115_5062472_-	EthD domain-containing protein	NA	NA	NA	NA	NA
WP_068238475.1|5062526_5063324_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_068238477.1|5063418_5063994_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_068238478.1|5064289_5065243_-	ketopantoate reductase	NA	NA	NA	NA	NA
WP_068238482.1|5065370_5065994_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_068238484.1|5066306_5066912_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_068238486.1|5067068_5067416_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082774048.1|5067926_5068295_+	DoxX family protein	NA	NA	NA	NA	NA
WP_068238489.1|5068311_5069340_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_082774049.1|5069581_5070508_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_068238491.1|5071687_5072620_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_068238493.1|5072690_5073686_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_068227993.1|5074238_5075300_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_068238495.1|5075436_5076231_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_068238497.1|5076302_5076857_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	40.6	1.1e-27
WP_157887183.1|5076825_5077428_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_157887184.1|5077496_5077643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071892413.1|5077707_5078106_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_068238502.1|5078102_5078411_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP014304	Hymenobacter sp. PAMC 26628 chromosome, complete genome	5277381	5087960	5156370	5277381	transposase	Mycobacterium_phage(20.0%)	54	NA	NA
WP_157887185.1|5087960_5088794_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	40.3	1.7e-35
WP_068238519.1|5089042_5089330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068238521.1|5089460_5089718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068238523.1|5089775_5090135_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_068238525.1|5090247_5090511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082774053.1|5090528_5091266_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	33.9	6.1e-13
WP_082773621.1|5091602_5092268_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_068227630.1|5092258_5092726_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071892420.1|5092785_5093427_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_068238531.1|5093937_5094945_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_068238533.1|5095183_5096851_+	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_068238535.1|5096973_5098125_-	TIGR03364 family FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_082774054.1|5098253_5098829_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068238542.1|5098942_5099677_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_068238544.1|5099673_5100942_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_068239918.1|5100960_5103672_-	phosphoesterase	NA	NA	NA	NA	NA
WP_068238546.1|5103845_5105429_-	SusD/RagB family nutrient-binding outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_068238548.1|5105450_5108771_-	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_068238550.1|5108880_5109453_-	HD domain-containing protein	NA	L7RG22	Acanthamoeba_polyphaga_moumouvirus	41.6	4.9e-34
WP_068238552.1|5109737_5111045_-	MFS transporter	NA	NA	NA	NA	NA
WP_157887187.1|5111698_5111974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082774156.1|5112126_5114841_+	bifunctional YncE family protein/alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_082774055.1|5114989_5118004_+	SusC/RagA family TonB-linked outer membrane protein	NA	NA	NA	NA	NA
WP_068239927.1|5118064_5119633_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_068238556.1|5119640_5120735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157887188.1|5120739_5122194_+	CehA/McbA family metallohydrolase	NA	NA	NA	NA	NA
WP_157887189.1|5124544_5125111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068234647.1|5126239_5127244_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068238563.1|5127329_5127563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068230369.1|5127553_5128351_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_068238565.1|5128296_5128815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157887190.1|5128938_5130019_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.6	6.8e-45
WP_157887256.1|5132362_5132725_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162268277.1|5132669_5133296_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_068238571.1|5133356_5133965_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_068238573.1|5134781_5135360_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_068239928.1|5135461_5135803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157887191.1|5136043_5136766_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	29.8	4.6e-13
WP_068238575.1|5136924_5138544_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_068238577.1|5138562_5140071_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_082774057.1|5140246_5141029_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_068238581.1|5141262_5142369_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_068238583.1|5142408_5143527_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_068238584.1|5143839_5144259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068238586.1|5144255_5144699_-	oligosaccharide biosynthesis protein Alg14	NA	NA	NA	NA	NA
WP_071892428.1|5144700_5145705_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_082774059.1|5145712_5146228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157887192.1|5146278_5147412_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_068238592.1|5147471_5148899_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_068238593.1|5148975_5151291_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_068238595.1|5151298_5152081_-	sugar transporter	NA	NA	NA	NA	NA
WP_071892437.1|5153255_5154089_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_068238599.1|5154266_5154548_+	recombinase family protein	NA	NA	NA	NA	NA
WP_068238605.1|5155911_5156370_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP014304	Hymenobacter sp. PAMC 26628 chromosome, complete genome	5277381	5216457	5266351	5277381	protease,transposase	Bodo_saltans_virus(25.0%)	42	NA	NA
WP_068230834.1|5216457_5217471_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_068238691.1|5217946_5219212_+	TCR/Tet family MFS transporter	NA	A0A2H4UVM2	Bodo_saltans_virus	25.7	2.5e-06
WP_068238693.1|5219256_5219703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068239933.1|5220273_5220648_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_068238695.1|5220650_5222417_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_068238697.1|5222467_5223034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068238699.1|5223039_5223561_-	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_068238701.1|5223765_5224971_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_068238703.1|5225886_5226957_-	bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II	NA	NA	NA	NA	NA
WP_068238705.1|5227036_5227882_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_068238707.1|5227977_5229189_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_068239935.1|5229385_5230255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068238709.1|5230695_5232801_+	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.3	1.5e-72
WP_068239938.1|5232989_5233841_-	pirin family protein	NA	NA	NA	NA	NA
WP_082774068.1|5233933_5235295_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_068238711.1|5235446_5236517_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_068238714.1|5236619_5237039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157887200.1|5237111_5237897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068238718.1|5238008_5238614_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_068238722.1|5239730_5240759_+	acetamidase/formamidase family protein	NA	NA	NA	NA	NA
WP_157887201.1|5241092_5241194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068238724.1|5243276_5244026_+	hydroxymethylpyrimidine/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_157887258.1|5244030_5244663_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_068238728.1|5245547_5246669_+	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_068238730.1|5246665_5247769_+	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SAV8	Catovirus	31.8	8.6e-11
WP_068238732.1|5247805_5248426_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_068238734.1|5248436_5250986_-	carboxypeptidase-like regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_068238736.1|5251119_5252379_-	WcaI family glycosyltransferase	NA	NA	NA	NA	NA
WP_068238738.1|5252418_5252970_-	colanic acid biosynthesis acetyltransferase WcaF	NA	NA	NA	NA	NA
WP_157887202.1|5253002_5253470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068238742.1|5253496_5254657_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_082774071.1|5254838_5255081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082774072.1|5255253_5255685_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_082774073.1|5255697_5255883_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071892458.1|5256282_5256957_-	exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase	NA	NA	NA	NA	NA
WP_162268279.1|5258054_5258303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068238750.1|5258526_5258727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068238752.1|5258759_5259593_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_068238754.1|5259827_5260421_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_068238756.1|5260605_5261439_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157887204.1|5262009_5265264_+	hypothetical protein	NA	A0A1B3AYB1	Gordonia_phage	39.2	9.0e-08
WP_157887259.1|5265400_5266351_+|transposase	transposase	transposase	NA	NA	NA	NA
