The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014223	Anaerotignum propionicum DSM 1682 strain X2 chromosome, complete genome	3120417	757959	767453	3120417	integrase,tRNA	Ostreococcus_tauri_virus(16.67%)	9	749373:749387	768745:768759
749373:749387	attL	AGAATGAAAAAGCCA	NA	NA	NA	NA
WP_066047947.1|757959_759618_+	biosynthetic-type acetolactate synthase large subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	30.2	1.7e-55
WP_066047949.1|759628_760144_+	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_072743437.1|760122_761163_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_066047953.1|761544_762147_-	cytidylate kinase-like family protein	NA	NA	NA	NA	NA
WP_066047954.1|762431_764243_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L424	Tupanvirus	27.8	9.1e-18
WP_066047956.1|764791_765994_-|integrase	site-specific integrase	integrase	P97010	Streptococcus_pyogenes_phage	25.7	1.0e-17
WP_066047958.1|766128_766587_-	hypothetical protein	NA	A0A0A7RTX7	Clostridium_phage	48.2	5.6e-25
WP_066047961.1|766611_767052_-	helix-turn-helix transcriptional regulator	NA	B6SBW8	Clostridium_virus	39.0	3.1e-20
WP_066047963.1|767231_767453_+	helix-turn-helix transcriptional regulator	NA	E8ZDN3	Streptococcus_phage	60.0	1.6e-14
768745:768759	attR	AGAATGAAAAAGCCA	NA	NA	NA	NA
>prophage 2
NZ_CP014223	Anaerotignum propionicum DSM 1682 strain X2 chromosome, complete genome	3120417	770576	790502	3120417	portal,capsid,terminase	Faecalibacterium_phage(37.5%)	23	NA	NA
WP_066047975.1|770576_771731_+	DUF2800 domain-containing protein	NA	H7BVP9	unidentified_phage	44.1	6.1e-84
WP_066047976.1|771754_772456_+	DUF2815 family protein	NA	A0A0A7RVM4	Clostridium_phage	44.6	1.7e-33
WP_066047978.1|772462_774463_+	DNA polymerase	NA	H7BVQ1	unidentified_phage	55.3	1.4e-213
WP_066047980.1|774474_776895_+	virulence-associated protein E	NA	D2J048	Enterococcus_phage	44.4	1.4e-194
WP_066047982.1|777133_777433_+	VRR-NUC domain-containing protein	NA	Q775A2	Bordetella_phage	51.2	1.1e-16
WP_066047983.1|777413_778793_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	51.9	4.3e-137
WP_066047984.1|778786_779170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066047986.1|779183_779498_+	hypothetical protein	NA	A0A2K9V3Z1	Faecalibacterium_phage	44.8	1.1e-08
WP_066047988.1|779558_780044_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4JC68	uncultured_Caudovirales_phage	27.7	2.8e-06
WP_066047990.1|780116_780329_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	62.7	1.6e-14
WP_143148964.1|780541_780739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066047993.1|780731_781193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066047994.1|781667_782411_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_066047996.1|782476_783040_+|terminase	terminase small subunit	terminase	A0A2K9V3C4	Faecalibacterium_phage	32.8	2.7e-13
WP_066047997.1|783026_784241_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2K9V3G6	Faecalibacterium_phage	37.5	1.0e-60
WP_082754214.1|784253_785621_+|portal	phage portal protein	portal	A0A1Z1LZJ4	Bacillus_phage	33.1	5.6e-60
WP_066047998.1|785620_787159_+	hypothetical protein	NA	A0A2K9V3K1	Faecalibacterium_phage	40.5	1.2e-82
WP_066048000.1|787161_787440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048002.1|787676_788192_+	hypothetical protein	NA	A0A1Z1LZK8	Bacillus_phage	32.5	4.0e-11
WP_066048006.1|788200_789385_+|capsid	phage major capsid protein	capsid	A0A2K9V3F8	Faecalibacterium_phage	62.0	6.2e-108
WP_066048008.1|789398_789743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048010.1|789747_790071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048011.1|790073_790502_+	hypothetical protein	NA	A0A2K9V3E3	Faecalibacterium_phage	33.8	5.7e-11
>prophage 3
NZ_CP014223	Anaerotignum propionicum DSM 1682 strain X2 chromosome, complete genome	3120417	862925	873898	3120417	plate,portal,tail	Clostridium_phage(63.64%)	18	NA	NA
WP_066048139.1|862925_863339_+	HK97 gp10 family phage protein	NA	A0A0A8WFV8	Clostridium_phage	36.1	2.5e-16
WP_066048140.1|863335_863761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048141.1|863732_863921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048142.1|863921_865220_+|tail	phage tail protein	tail	X5JAJ1	Clostridium_phage	57.7	1.0e-143
WP_066048144.1|865236_865707_+|tail	phage tail tube protein	tail	A0A0A8WJ62	Clostridium_phage	66.4	9.2e-55
WP_066048146.1|865727_866147_+|portal	phage portal protein	portal	X5JAB6	Clostridium_phage	52.4	6.7e-33
WP_066048148.1|866422_868111_+	hypothetical protein	NA	H7BVH2	unidentified_phage	29.5	8.8e-23
WP_066048150.1|868097_868763_+	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	30.7	8.8e-19
WP_096348657.1|868755_869709_+	hydrolase	NA	H7BVH4	unidentified_phage	47.9	4.9e-79
WP_072743416.1|869701_870112_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_066048156.1|870108_870510_+	DUF2634 domain-containing protein	NA	X5JB38	Clostridium_phage	48.7	7.6e-26
WP_066048158.1|870502_871564_+|plate	baseplate J/gp47 family protein	plate	A0A0A8WJT7	Clostridium_phage	52.7	4.0e-98
WP_066048161.1|871556_872102_+	DUF2313 domain-containing protein	NA	X5J9Z9	Clostridium_phage	36.4	4.2e-19
WP_066048163.1|872094_872286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048166.1|872289_873009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048168.1|873022_873364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072743449.1|873387_873519_+	XkdX family protein	NA	NA	NA	NA	NA
WP_066053692.1|873607_873898_+	hypothetical protein	NA	A0A2K9V2T8	Faecalibacterium_phage	41.0	7.0e-13
>prophage 4
NZ_CP014223	Anaerotignum propionicum DSM 1682 strain X2 chromosome, complete genome	3120417	1103997	1121995	3120417	portal,terminase,tail,integrase	Clostridium_phage(38.46%)	32	1103982:1104001	1127025:1127044
1103982:1104001	attL	GCGTACTAAAAACGTACTAT	NA	NA	NA	NA
WP_066048690.1|1103997_1105053_-|integrase	site-specific integrase	integrase	Q8SBN2	Clostridium_phage	49.9	1.4e-95
WP_066048693.1|1105186_1105654_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_066048696.1|1105765_1106194_-	ImmA/IrrE family metallo-endopeptidase	NA	D2XR38	Bacillus_phage	37.7	3.7e-18
WP_066048698.1|1106204_1106636_-	helix-turn-helix transcriptional regulator	NA	Q5YAA4	Bacillus_phage	36.8	9.7e-19
WP_066048701.1|1106850_1107051_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_096348679.1|1107095_1107236_+	transcriptional regulator	NA	Q8SBM7	Clostridium_phage	55.8	1.8e-06
WP_066048707.1|1107267_1107462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048710.1|1107458_1107695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048713.1|1107691_1108036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048716.1|1108016_1108343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048719.1|1108399_1108645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048721.1|1108655_1109456_+	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	36.4	4.2e-15
WP_066048724.1|1109496_1109883_+	TFIIB-type zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_157881635.1|1109900_1110077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048727.1|1110081_1110510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157881636.1|1110506_1110677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048729.1|1110673_1111060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066053727.1|1111186_1111744_+|integrase	tyrosine-type recombinase/integrase	integrase	E2ELN7	Clostridium_phage	48.4	8.1e-42
WP_066048732.1|1112029_1112530_+|terminase	terminase small subunit	terminase	A0A2K9V3C4	Faecalibacterium_phage	48.9	4.9e-30
WP_096348678.1|1112519_1113731_+|terminase	PBSX family phage terminase large subunit	terminase	I1TJV3	Clostridium_phage	52.9	1.6e-111
WP_066048738.1|1113730_1115005_+|portal	phage portal protein	portal	I1TJV4	Clostridium_phage	35.6	3.0e-60
WP_066048740.1|1114994_1115846_+	hypothetical protein	NA	A0A097BYH6	Leuconostoc_phage	28.3	2.4e-08
WP_066048743.1|1115959_1116601_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_066048746.1|1116617_1117397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048750.1|1117414_1117705_+	hypothetical protein	NA	A0A2H4JD74	uncultured_Caudovirales_phage	37.9	8.3e-06
WP_066048752.1|1117704_1118022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048755.1|1118021_1118438_+	hypothetical protein	NA	A0A0E3T8J0	Staphylococcus_phage	46.7	2.4e-14
WP_066048758.1|1118424_1118778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048760.1|1118783_1119326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048766.1|1119390_1119747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048769.1|1119758_1120028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066048771.1|1120024_1121995_+|tail	phage tail tape measure protein	tail	A0A1J1J8L9	Escherichia_phage	35.5	2.9e-41
1127025:1127044	attR	GCGTACTAAAAACGTACTAT	NA	NA	NA	NA
>prophage 5
NZ_CP014223	Anaerotignum propionicum DSM 1682 strain X2 chromosome, complete genome	3120417	1360823	1426135	3120417	terminase,head,integrase,protease,portal,plate,tail	Faecalibacterium_phage(50.0%)	72	1353456:1353472	1420185:1420201
1353456:1353472	attL	TCAATGCTTTGAAAATA	NA	NA	NA	NA
WP_082754257.1|1360823_1361024_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2MV79	Bacillus_phage	82.0	2.1e-21
WP_066049308.1|1361259_1361757_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_066049311.1|1361810_1362305_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_096348662.1|1362316_1363675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066049317.1|1363865_1364282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066049318.1|1364290_1364863_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_066049320.1|1364887_1365802_-	Fic family protein	NA	NA	NA	NA	NA
WP_066049323.1|1365965_1366274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066049326.1|1366270_1366546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066049329.1|1366937_1367318_-	TnpV protein	NA	NA	NA	NA	NA
WP_066049332.1|1367322_1368510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066049335.1|1368583_1368817_-	complexin-2	NA	NA	NA	NA	NA
WP_072743537.1|1369033_1369993_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_066049338.1|1370107_1370437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066049342.1|1370417_1371503_-|integrase	site-specific integrase	integrase	A0A0A8WF08	Clostridium_phage	48.2	5.7e-92
WP_066049345.1|1371503_1371692_-	hypothetical protein	NA	Q8SBM7	Clostridium_phage	40.7	5.3e-06
WP_066049348.1|1371837_1372350_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066049351.1|1372401_1372716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066049354.1|1372920_1374459_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.4	3.4e-21
WP_066049357.1|1374729_1376067_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.6	6.0e-51
WP_066049360.1|1376475_1377699_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_066049362.1|1377795_1378335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066053791.1|1378711_1380724_+	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_066049365.1|1380726_1381395_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_066049368.1|1381635_1384083_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2C9CXH0	Yersinia_phage	39.3	2.2e-123
WP_066049371.1|1384240_1384654_+	endosialidase	NA	NA	NA	NA	NA
WP_066049373.1|1384908_1386309_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_066049376.1|1386453_1389915_+	pyruvate carboxylase	NA	NA	NA	NA	NA
WP_066049379.1|1390182_1390758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066049382.1|1390824_1391478_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_157881641.1|1391670_1394367_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_066053794.1|1394522_1395509_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_066049390.1|1396416_1397895_-	recombinase family protein	NA	M9Q2G2	Clostridium_phage	34.7	8.1e-57
WP_066049392.1|1398010_1399195_-	DUF4236 domain-containing protein	NA	F6K8R9	Clostridium_phage	48.6	5.4e-11
WP_066049395.1|1399377_1400532_-	hypothetical protein	NA	A0A2I6PEZ7	Staphylococcus_phage	27.8	1.3e-22
WP_066049404.1|1401394_1401898_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_066049407.1|1402050_1402269_+	helix-turn-helix transcriptional regulator	NA	Q4ZA66	Staphylococcus_virus	36.6	5.6e-07
WP_157881642.1|1402282_1402453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066049411.1|1402436_1402718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066049413.1|1402918_1403098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066049417.1|1403145_1403433_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	68.8	1.4e-10
WP_066049420.1|1403459_1403732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066049423.1|1404230_1404959_+	hypothetical protein	NA	Q0SPI6	Clostridium_phage	35.2	1.1e-17
WP_157881643.1|1404927_1405092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066049426.1|1405088_1405889_+	DNA adenine methylase	NA	A0A2H4JFS7	uncultured_Caudovirales_phage	71.1	2.9e-101
WP_066049429.1|1405888_1406419_+	hypothetical protein	NA	A0A2K9V2V4	Faecalibacterium_phage	46.0	2.8e-28
WP_066049432.1|1406415_1406757_+	hypothetical protein	NA	Q24LD2	Clostridium_phage	39.1	4.2e-09
WP_066049435.1|1406788_1407244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066049437.1|1407409_1407598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066049439.1|1407931_1408468_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_082754263.1|1408467_1410303_+|terminase	terminase	terminase	A0A2K9V301	Faecalibacterium_phage	53.8	2.6e-177
WP_066049441.1|1410315_1410534_+	hypothetical protein	NA	A0A2K9V311	Faecalibacterium_phage	57.4	6.4e-11
WP_066049444.1|1410539_1412006_+|portal	phage portal protein	portal	A0A2K9V303	Faecalibacterium_phage	60.3	5.6e-167
WP_082754264.1|1411980_1412562_+|head,protease	caudovirus prohead protease	head,protease	A0A2K9V308	Faecalibacterium_phage	56.7	4.2e-49
WP_082754265.1|1412558_1414025_+	hypothetical protein	NA	A0A2K9V304	Faecalibacterium_phage	46.2	2.3e-120
WP_066049449.1|1414045_1414375_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_066049453.1|1414733_1415078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082754266.1|1415074_1415686_+	hypothetical protein	NA	A0A2K9V354	Faecalibacterium_phage	38.7	4.4e-25
WP_066049457.1|1415682_1416150_+	hypothetical protein	NA	A0A2K9V310	Faecalibacterium_phage	30.3	8.9e-10
WP_066049460.1|1416143_1416434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066049463.1|1416423_1417878_+|tail	phage tail protein	tail	A0A2K9V328	Faecalibacterium_phage	56.1	8.3e-155
WP_066049466.1|1417880_1418399_+|tail	phage major tail tube protein	tail	A0A2K9V428	Faecalibacterium_phage	38.4	6.8e-27
WP_066049469.1|1418398_1418974_+|tail	phage tail assembly protein	tail	A0A2K9V324	Faecalibacterium_phage	38.8	6.7e-15
WP_066049471.1|1419118_1421194_+|tail	phage tail tape measure protein	tail	A0A193GYN8	Enterobacter_phage	38.2	4.0e-78
1420185:1420201	attR	TCAATGCTTTGAAAATA	NA	NA	NA	NA
WP_066049474.1|1421248_1421446_+|tail	phage tail protein	tail	A0A2K9V3Y4	Faecalibacterium_phage	50.0	2.8e-13
WP_143148974.1|1421433_1422432_+	hypothetical protein	NA	A0A2K9V3Y5	Faecalibacterium_phage	36.4	2.7e-56
WP_066049479.1|1422460_1423051_+	hypothetical protein	NA	A0A2K9V3Y7	Faecalibacterium_phage	38.3	3.0e-10
WP_066049480.1|1423063_1423453_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_066053809.1|1423486_1423756_+	hypothetical protein	NA	A0A2K9V3X2	Faecalibacterium_phage	54.0	5.7e-17
WP_082754268.1|1423748_1424897_+|plate	baseplate J/gp47 family protein	plate	A0A2K9V320	Faecalibacterium_phage	44.8	1.3e-86
WP_066049481.1|1424889_1425453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143148979.1|1425511_1426135_+	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	44.4	9.4e-23
>prophage 6
NZ_CP014223	Anaerotignum propionicum DSM 1682 strain X2 chromosome, complete genome	3120417	2149426	2158089	3120417		uncultured_virus(33.33%)	7	NA	NA
WP_066051174.1|2149426_2151055_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	55.2	1.4e-150
WP_066051177.1|2151074_2151362_-	co-chaperone GroES	NA	A0A221S386	uncultured_virus	45.8	2.8e-14
WP_066051180.1|2151751_2152612_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_066051183.1|2153020_2155099_-	elongation factor G	NA	A0A1S5SF82	Streptococcus_phage	23.7	1.2e-45
WP_066051186.1|2155747_2156188_-	Fe-S cluster assembly scaffold protein NifU	NA	A0A2H4N7M4	Lake_Baikal_phage	52.8	3.3e-30
WP_066051189.1|2156215_2157397_-	cysteine desulfurase NifS	NA	H7BUW1	unidentified_phage	38.1	1.6e-39
WP_066051192.1|2157669_2158089_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPJ2	Marinitoga_camini_virus	39.1	2.8e-10
>prophage 7
NZ_CP014223	Anaerotignum propionicum DSM 1682 strain X2 chromosome, complete genome	3120417	2509404	2523755	3120417	capsid,terminase,protease,portal,plate,tail	Clostridium_phage(50.0%)	13	NA	NA
WP_066052064.1|2509404_2510592_-|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_066052067.1|2510591_2511299_-	hypothetical protein	NA	A0A1C8EA72	Bacillus_phage	29.6	6.3e-23
WP_066052071.1|2511301_2515687_-|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	46.6	1.7e-86
WP_066052073.1|2516224_2516617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066052076.1|2516631_2517222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066052080.1|2517237_2517720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066052084.1|2517700_2518054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066052087.1|2518040_2518397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066052090.1|2518365_2518671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066054027.1|2518816_2520061_-|capsid	phage major capsid protein	capsid	E2ELI5	Clostridium_phage	38.9	4.1e-70
WP_066052094.1|2520130_2520892_-|protease	Clp protease ClpP	protease	A0A0C5AJ10	Paenibacillus_phage	42.3	8.5e-34
WP_066052097.1|2520869_2522057_-|portal	phage portal protein	portal	E2ELI3	Clostridium_phage	38.5	2.1e-71
WP_066052101.1|2522069_2523755_-|terminase	terminase large subunit	terminase	E2ELI2	Clostridium_phage	39.4	8.5e-111
>prophage 8
NZ_CP014223	Anaerotignum propionicum DSM 1682 strain X2 chromosome, complete genome	3120417	2850056	2903457	3120417	capsid,terminase,tRNA,integrase,portal,plate,tail	Clostridium_phage(23.53%)	57	2877512:2877571	2903612:2903675
WP_066052903.1|2850056_2851418_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_066052905.1|2851722_2854125_-	stage II sporulation protein E	NA	NA	NA	NA	NA
WP_066052908.1|2854346_2857022_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_066052911.1|2857164_2858433_-	amidohydrolase	NA	NA	NA	NA	NA
WP_066052915.1|2858444_2859254_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_066052918.1|2859540_2860875_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_143148973.1|2860944_2862045_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_066052923.1|2862456_2863131_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_066052926.1|2863111_2864026_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_066052929.1|2864687_2865803_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	38.4	1.1e-50
WP_066052931.1|2865906_2866551_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	42.1	7.4e-39
WP_066052934.1|2866562_2867768_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	49.1	7.5e-109
WP_066052939.1|2868037_2868514_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	54.0	3.8e-40
WP_066052944.1|2868771_2869842_+	sporulation integral membrane protein YtvI	NA	NA	NA	NA	NA
WP_066052947.1|2869884_2870511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066052949.1|2870510_2871449_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	53.7	1.3e-81
WP_066052952.1|2871702_2872572_+	methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_066052955.1|2872590_2873772_+	MFS transporter	NA	NA	NA	NA	NA
WP_082754374.1|2873864_2875091_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_066052959.1|2875702_2876890_-	hypothetical protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.6	3.3e-08
WP_066052962.1|2877049_2877355_-	hypothetical protein	NA	NA	NA	NA	NA
2877512:2877571	attL	CATTGATGCGGATGACAGGACTTGAACCTGCACCAGGAAACCCCGACTAGAACCTGAATC	NA	NA	NA	NA
WP_066051315.1|2877781_2878057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066051318.1|2878070_2879330_-	hypothetical protein	NA	A0A0A7RUI9	Clostridium_phage	39.7	1.8e-57
WP_072743524.1|2879329_2879464_-	XkdX family protein	NA	NA	NA	NA	NA
WP_066048777.1|2879463_2879790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066051321.1|2879799_2880855_-|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_082754326.1|2880856_2881549_-	hypothetical protein	NA	M1PFK1	Streptococcus_phage	26.0	3.2e-11
WP_066052964.1|2881550_2883521_-|tail	phage tail tape measure protein	tail	A0A1J1J8L9	Escherichia_phage	35.5	2.9e-41
WP_066048769.1|2883517_2883787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066048766.1|2883798_2884155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066052967.1|2884219_2884762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066051334.1|2884764_2885145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066052971.1|2885134_2885440_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_066052973.1|2885436_2885733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066052976.1|2886041_2886827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066052979.1|2886851_2887418_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_066052982.1|2887546_2888302_-|capsid	minor capsid protein	capsid	A0A090D822	Clostridium_phage	24.0	3.1e-20
WP_066052984.1|2888291_2889608_-|portal	phage portal protein	portal	I1TJV4	Clostridium_phage	28.8	1.4e-39
WP_066052987.1|2889620_2890865_-|terminase	PBSX family phage terminase large subunit	terminase	I1TJV3	Clostridium_phage	43.4	5.5e-91
WP_066052991.1|2891420_2891831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066052995.1|2891895_2892291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066052998.1|2892293_2892854_-	hypothetical protein	NA	A0A2D1GQ84	Lysinibacillus_phage	42.5	2.3e-28
WP_066053002.1|2892846_2893065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066053005.1|2893137_2893662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066053007.1|2893809_2894406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066053010.1|2894405_2895650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066053013.1|2895880_2896066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066053016.1|2896135_2896888_-	DUF3102 domain-containing protein	NA	A0A2H4J025	uncultured_Caudovirales_phage	53.6	2.4e-25
WP_159430689.1|2897480_2898185_-	hypothetical protein	NA	H7BV04	unidentified_phage	33.9	1.3e-33
WP_066053022.1|2898243_2899104_-	hypothetical protein	NA	H7BV05	unidentified_phage	43.4	1.1e-66
WP_066053025.1|2899197_2899932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066053028.1|2900031_2900259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066053031.1|2900852_2901047_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_066053033.1|2901118_2901424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066053036.1|2901752_2901968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066053038.1|2901988_2902228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066053040.1|2902500_2903457_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7NQ69	Enterobacteria_phage	26.0	1.2e-08
2903612:2903675	attR	CATTGATGCGGATGACAGGACTTGAACCTGCACCAGGAAACCCCGACTAGAACCTGAATCTAGC	NA	NA	NA	NA
