The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014272	Escherichia coli K-12 strain K-12 C3026 chromosome, complete genome	4745255	223075	271759	4745255	transposase,integrase	Streptococcus_phage(20.0%)	49	237561:237620	271869:271928
WP_000006255.1|223075_223573_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|223796_225536_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|225480_226266_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|226336_227392_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|227443_227737_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|227739_228138_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|228147_228600_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|228905_229172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|229104_229641_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|229697_231155_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|231415_231874_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|231965_233210_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|233267_233669_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|233707_234763_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|235050_236154_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|236165_237419_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
237561:237620	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|237990_238332_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|238352_238670_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|238688_238910_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|238918_239395_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|239410_239869_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|239966_240206_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|240282_240750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|240772_241216_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|241215_241443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|241846_242668_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|242759_243623_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|243951_244845_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|245265_246417_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|248763_249780_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|249987_251391_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|251377_252310_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|252418_253465_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000015532.1|254686_255025_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|255047_255398_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|255491_256646_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|256940_257849_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|257863_259831_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|260057_261440_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|261451_263062_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|263066_263825_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|263963_264968_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|266162_266894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|266984_267611_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|267882_268581_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|268607_269462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|269580_269805_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|269801_270242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|270358_271759_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
271869:271928	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP014272	Escherichia coli K-12 strain K-12 C3026 chromosome, complete genome	4745255	492333	555292	4745255	tRNA,terminase,protease,integrase,transposase,lysis	Enterobacteria_phage(50.0%)	66	537950:537996	559252:559298
WP_001295836.1|492333_492957_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|492927_493614_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|493610_496025_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|496455_500736_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|500775_501144_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|501834_502095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|503326_504421_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|504489_505416_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|505645_506128_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|506205_507021_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|507110_508892_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|508904_509681_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|509780_510659_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|510827_512282_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|512341_513703_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|513759_515061_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|515082_516228_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|516455_517241_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|517251_518487_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|518508_519558_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|519874_521542_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|521551_522811_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|522821_523637_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|523633_524527_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|524721_525789_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|525785_526295_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|526412_527135_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|527137_527632_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|527805_529191_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|529226_529748_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|529855_530068_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|530069_530936_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|531406_531949_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|532168_532861_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|532891_535495_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|535473_536514_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|536524_537040_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|537042_537675_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
537950:537996	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|538009_539173_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|539292_539556_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|539878_539974_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_000169527.1|540036_540336_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|540332_541199_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_001070439.1|541509_541842_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|541889_542039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|542096_543623_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|544087_544639_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|544648_545446_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|545562_545664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|545660_546116_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|546115_546286_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|546278_546569_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|546565_546928_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|546924_547065_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|547150_547534_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|547931_548948_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|548952_550020_-	porin	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|550592_550808_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|550807_551305_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|551521_551704_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|551794_552088_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|552378_552789_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|553074_553281_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|553445_553640_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|554028_554574_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|554548_555292_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
559252:559298	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 3
NZ_CP014272	Escherichia coli K-12 strain K-12 C3026 chromosome, complete genome	4745255	763025	918479	4745255	terminase,protease,tail,integrase,transposase,head,capsid,portal,lysis	Enterobacteria_phage(74.73%)	198	825638:825655	922404:922421
WP_085947917.1|763025_764299_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000191497.1|764516_765563_-	galactose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_001265433.1|765572_766589_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.7	2.3e-79
WP_000096869.1|766849_768322_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|768389_769178_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|769306_769456_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101984.1|769622_770396_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|770395_771085_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|771087_772146_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
WP_001300666.1|772146_772965_-	bifunctional pyridoxal phosphate/fructose-1,6-bisphosphate phosphatase	NA	NA	NA	NA	NA
WP_000815435.1|773119_774115_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_001350493.1|774155_775109_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000723652.1|775292_776345_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_001036475.1|776420_777854_+	anion permease	NA	NA	NA	NA	NA
WP_000593938.1|778036_780298_+	hydratase	NA	NA	NA	NA	NA
WP_001091569.1|780531_781815_-	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_000533640.1|781949_783020_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
WP_002414258.1|782997_783216_-	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000545733.1|783255_783423_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000026224.1|783511_783793_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|783984_784533_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000763367.1|784529_784751_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_015979260.1|785142_785334_-	DUF1382 family protein	NA	Q38267	Escherichia_phage	100.0	2.1e-26
WP_000149542.1|785306_785489_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000186853.1|785485_786166_-	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000100844.1|786162_786948_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995451.1|786953_787250_-	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000372937.1|787324_787468_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|787436_787601_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|787673_788042_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213975.1|788224_788425_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|788691_789174_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_001245922.1|789963_790398_-	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_000788349.1|790413_791253_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_000104864.1|791365_792079_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	98.3	1.3e-129
WP_000437875.1|792179_792380_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|792498_792792_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|792824_793724_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788910.1|793720_794422_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000145933.1|794418_794709_+	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|794782_795223_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000611491.1|795219_796092_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000984218.1|796088_796262_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113775.1|796228_796411_+	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000566997.1|796407_796578_+	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_001108044.1|796570_797182_+	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_002901791.1|797178_797385_+	protein ninH	NA	Q716C0	Shigella_phage	98.5	2.8e-32
WP_001271136.1|797362_798028_+	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_001235459.1|798024_798648_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_000229403.1|799631_800108_+	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_012738274.1|800324_800507_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738492.1|800597_800891_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012775990.1|801180_801591_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_001031427.1|801876_802083_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|802247_802442_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453580.1|802830_803376_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|803350_805276_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000198149.1|805272_805479_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001359455.1|805475_807077_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000123343.1|807057_808377_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001297109.1|808386_808719_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|808774_809800_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158919.1|809841_810240_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000752979.1|810251_810605_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|810616_811195_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|811191_811587_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|811594_812335_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|812350_812773_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|812754_813189_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840207.1|813181_815743_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000847379.1|815739_816069_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|816068_816767_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|816772_817516_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090889.1|817452_818085_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_001206316.1|823907_824699_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_071888726.1|824999_825326_-	serine hydrolase	NA	Q38212	Enterobacteria_phage	99.1	5.4e-54
825638:825655	attL	ATTTGATGCCTGGCAGTT	NA	NA	NA	NA
WP_061057650.1|825895_826582_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000805902.1|826870_827953_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000533640.1|830416_831487_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
WP_002414258.1|831464_831683_-	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000545733.1|831722_831890_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000026224.1|831978_832260_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|832451_833000_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000763367.1|832996_833218_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_015979260.1|833609_833801_-	DUF1382 family protein	NA	Q38267	Escherichia_phage	100.0	2.1e-26
WP_000149542.1|833773_833956_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000186853.1|833952_834633_-	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000100844.1|834629_835415_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995451.1|835420_835717_-	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_000372937.1|835791_835935_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|835903_836068_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|836140_836509_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213975.1|836691_836892_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|837158_837641_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_001245922.1|838430_838865_-	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_000788349.1|838880_839720_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_000104864.1|839832_840546_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	98.3	1.3e-129
WP_000437875.1|840646_840847_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|840965_841259_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|841291_842191_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788910.1|842187_842889_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000145933.1|842885_843176_+	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|843249_843690_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000611491.1|843686_844559_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000984218.1|844555_844729_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113775.1|844695_844878_+	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000566997.1|844874_845045_+	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_001108044.1|845037_845649_+	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_002901791.1|845645_845852_+	protein ninH	NA	Q716C0	Shigella_phage	98.5	2.8e-32
WP_001271136.1|845829_846495_+	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_001235459.1|846491_847115_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_000229403.1|848098_848575_+	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_012738274.1|848791_848974_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738492.1|849064_849358_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012775990.1|849647_850058_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_001031427.1|850343_850550_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|850714_850909_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453580.1|851297_851843_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|851817_853743_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000198149.1|853739_853946_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001359455.1|853942_855544_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000123343.1|855524_856844_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001297109.1|856853_857186_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|857241_858267_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158919.1|858308_858707_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000752979.1|858718_859072_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|859083_859662_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|859658_860054_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|860061_860802_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|860817_861240_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|861221_861656_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840207.1|861648_864210_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000847379.1|864206_864536_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|864535_865234_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|865239_865983_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090889.1|865919_866552_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_001206316.1|872374_873166_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_071888726.1|873466_873793_-	serine hydrolase	NA	Q38212	Enterobacteria_phage	99.1	5.4e-54
WP_061057650.1|874362_875049_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000805902.1|875337_876420_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000533640.1|878883_879954_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PMH8	Enterobacteria_phage	100.0	3.9e-202
WP_002414258.1|879931_880150_-	excisionase	NA	C6ZCU6	Enterobacteria_phage	100.0	1.3e-35
WP_000545733.1|880189_880357_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_000026224.1|880445_880727_-	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	100.0	2.8e-51
WP_001289873.1|880918_881467_-	ead/Ea22-like family protein	NA	A0A0K2FJF6	Enterobacteria_phage	100.0	2.2e-100
WP_000763367.1|881463_881685_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_015979260.1|882076_882268_-	DUF1382 family protein	NA	Q38267	Escherichia_phage	100.0	2.1e-26
WP_000149542.1|882240_882423_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	100.0	1.6e-28
WP_000186853.1|882419_883100_-	YqaJ viral recombinase family protein	NA	A0A0K2FIU4	Escherichia_phage	100.0	2.7e-132
WP_000100844.1|883096_883882_-	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000995451.1|883887_884184_-	host-nuclease inhibitor protein Gam	NA	C6ZCV5	Enterobacteria_phage	100.0	2.1e-49
WP_001198861.1|884371_884536_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|884608_884977_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213975.1|885159_885360_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000281856.1|885626_886109_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_001564525.1|886109_886433_-	antitermination protein	NA	A0A0K2FII1	Escherichia_phage	100.0	4.5e-53
WP_001245922.1|886897_887332_-	protein rexB	NA	M1FPN8	Enterobacteria_phage	100.0	1.9e-70
WP_000788349.1|887347_888187_-	protein rexA	NA	M1FPD4	Enterobacteria_phage	100.0	3.7e-155
WP_000104864.1|888299_889013_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	98.3	1.3e-129
WP_000437875.1|889113_889314_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|889432_889726_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|889758_890658_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788910.1|890654_891356_+	hypothetical protein	NA	A0A0K2FIT1	Enterobacteria_phage	100.0	7.6e-130
WP_000145933.1|891352_891643_+	protein ren	NA	K7P7K7	Enterobacteria_phage	100.0	9.6e-47
WP_000736903.1|891716_892157_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000611491.1|892153_893026_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A0K2FIH3	Escherichia_phage	100.0	9.3e-178
WP_000984218.1|893022_893196_+	hypothetical protein	NA	I6S1V2	Salmonella_phage	100.0	5.8e-31
WP_000113775.1|893162_893345_+	NinE family protein	NA	C6ZR57	Salmonella_phage	96.7	8.2e-28
WP_000566997.1|893341_893512_+	protein ninF	NA	Q716C4	Shigella_phage	100.0	3.2e-26
WP_001108044.1|893504_894116_+	recombination protein NinG	NA	K7P8B1	Enterobacteria_phage	100.0	3.5e-99
WP_002901791.1|894112_894319_+	protein ninH	NA	Q716C0	Shigella_phage	98.5	2.8e-32
WP_001271136.1|894296_894962_+	serine/threonine protein phosphatase	NA	K7P7V3	Enterobacteria_phage	100.0	1.7e-131
WP_001235459.1|894958_895582_+	antitermination protein	NA	K7P6X1	Enterobacteria_phage	100.0	3.0e-114
WP_000229403.1|896565_897042_+	glycoside hydrolase family protein	NA	A0A0K2FIS2	Enterobacteria_phage	100.0	4.4e-89
WP_012738274.1|897258_897441_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	100.0	1.7e-17
WP_000738492.1|897531_897825_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	100.0	4.0e-48
WP_012775990.1|898114_898525_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	100.0	2.5e-72
WP_001031427.1|898810_899017_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|899181_899376_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453580.1|899764_900310_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|900284_902210_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000198149.1|902206_902413_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001359455.1|902409_904011_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000123343.1|903991_905311_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	100.0	7.9e-237
WP_001297109.1|905320_905653_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|905708_906734_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158919.1|906775_907174_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	100.0	3.1e-64
WP_000752979.1|907185_907539_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|907550_908129_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|908125_908521_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001349920.1|908528_909269_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000479153.1|909284_909707_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|909688_910123_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840207.1|910115_912677_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	100.0	0.0e+00
WP_000847379.1|912673_913003_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000194780.1|913707_914451_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090889.1|914387_915020_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	100.0	5.9e-97
WP_000515495.1|915080_918479_+	host specificity protein J	NA	C6ZCZ5	Enterobacteria_phage	100.0	0.0e+00
922404:922421	attR	ATTTGATGCCTGGCAGTT	NA	NA	NA	NA
>prophage 4
NZ_CP014272	Escherichia coli K-12 strain K-12 C3026 chromosome, complete genome	4745255	1500244	1541062	4745255	tRNA,tail,integrase,transposase,lysis	Escherichia_phage(45.16%)	43	1501391:1501409	1531766:1531784
WP_010723085.1|1500244_1501261_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
1501391:1501409	attL	GCTTATTCGCACCTTCCCT	NA	NA	NA	NA
WP_000605090.1|1501533_1501791_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_001262123.1|1501840_1502791_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000611911.1|1502942_1503695_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_000945011.1|1503889_1504405_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
WP_000062973.1|1504415_1505942_-	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_001156451.1|1505978_1507424_-	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000444929.1|1507423_1508734_-	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_000885458.1|1508909_1509818_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001046829.1|1510147_1510711_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000628058.1|1510731_1511964_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1512218_1513202_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1513679_1515053_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1515181_1516117_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1516168_1517404_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1517405_1517621_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1517699_1517909_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1517901_1518096_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1518152_1518962_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1518954_1521555_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1521656_1521932_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1522006_1522177_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1522176_1522398_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1522839_1523328_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1523324_1523480_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1523933_1524410_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1524533_1524830_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1524852_1525275_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1525287_1526145_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1526151_1526898_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1526920_1527481_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1527568_1527754_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1527950_1529408_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1529545_1529809_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1529789_1530149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019451.1|1531914_1532895_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	1.5e-184
1531766:1531784	attR	AGGGAAGGTGCGAATAAGC	NA	NA	NA	NA
WP_000279097.1|1533217_1536580_+|tail	side tail fiber protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1536579_1537155_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1537252_1537843_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1538159_1538393_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1538461_1538575_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1539353_1539788_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1539928_1541062_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 5
NZ_CP014272	Escherichia coli K-12 strain K-12 C3026 chromosome, complete genome	4745255	1733621	1778286	4745255	transposase,lysis,protease,tail	Enterobacteria_phage(30.0%)	61	NA	NA
WP_000527743.1|1733621_1735082_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1735170_1736454_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1737058_1737172_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1737240_1737474_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1737790_1738381_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1738478_1739054_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1739053_1740016_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1739966_1740536_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1740924_1741158_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1741215_1741626_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1741777_1741951_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1742122_1742278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1742356_1742422_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1742424_1742613_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1742623_1742836_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1743198_1743696_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1743692_1744226_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1744222_1744534_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1744538_1744754_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1745507_1745723_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1746023_1746236_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1746290_1746380_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1746657_1747410_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1747423_1748473_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1748474_1748753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1748819_1749071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1749287_1749443_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1749514_1749802_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1749801_1750041_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1750065_1750371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1750573_1750906_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1751342_1751492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1751788_1752019_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1752102_1752510_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1752676_1752832_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1752991_1753210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014639039.1|1753213_1753378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1753777_1753966_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1753962_1754154_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_085947917.1|1756035_1757309_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001360138.1|1758232_1758343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|1758400_1759420_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1759431_1760646_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1760851_1761178_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1761312_1761654_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1761688_1762249_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1762251_1762962_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1763069_1763375_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|1763573_1766000_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|1766060_1768484_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|1768494_1769112_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|1769113_1769968_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1770010_1770625_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071592181.1|1770783_1772076_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|1772028_1772724_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225262.1|1772848_1774069_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019525.1|1774203_1775097_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1775203_1776457_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743957.1|1776853_1777189_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233093.1|1777281_1777365_+	stationary phase-induced protein	NA	NA	NA	NA	NA
WP_001260865.1|1777464_1778286_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP014272	Escherichia coli K-12 strain K-12 C3026 chromosome, complete genome	4745255	2212763	2221434	4745255		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|2212763_2213867_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|2213874_2215122_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|2215118_2215676_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|2215675_2216557_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2216614_2217514_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2217513_2218599_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2218971_2219865_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2220039_2221434_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 7
NZ_CP014272	Escherichia coli K-12 strain K-12 C3026 chromosome, complete genome	4745255	2567446	2578656	4745255	integrase,tail	Enterobacteria_phage(50.0%)	17	2565421:2565437	2582331:2582347
2565421:2565437	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2567446_2568379_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2568690_2569848_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2570000_2570363_+	GtrA family protein	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2570359_2571280_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2571276_2572608_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2572642_2572924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2573222_2573663_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2573689_2574208_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2574257_2574533_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2574532_2575027_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000128175.1|2575023_2575392_-	hypothetical protein	NA	U5P0A0	Shigella_phage	99.2	1.3e-69
WP_000135673.1|2575749_2576112_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2576177_2577002_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2577129_2577666_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2577656_2578019_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2578018_2578324_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2578455_2578656_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2582331:2582347	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 8
NZ_CP014272	Escherichia coli K-12 strain K-12 C3026 chromosome, complete genome	4745255	2959238	2966377	4745255		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2959238_2961800_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2961905_2962562_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272547.1|2962612_2963410_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_000848004.1|2963575_2964484_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2964480_2965647_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278991.1|2965738_2966377_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	3.1e-82
>prophage 1
NZ_CP014273	Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence	213924	3507	53832	213924	integrase,transposase	Acinetobacter_phage(25.0%)	55	17993:18052	34585:34644
WP_000006255.1|3507_4005_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|4228_5968_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|5912_6698_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|6768_7824_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	27.3	4.4e-12
WP_000554758.1|7875_8169_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|8171_8570_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|8579_9032_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|9337_9604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326471.1|9536_10073_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|10129_11587_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|11847_12306_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|12397_13642_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|13699_14101_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|14139_15195_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|15482_16586_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|16597_17851_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
17993:18052	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|18422_18764_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|18784_19102_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|19120_19342_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	41.7	3.7e-06
WP_000811693.1|19350_19827_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|19842_20301_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000194654.1|20398_20638_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|20714_21182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|21204_21648_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|21647_21875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|22278_23100_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|23191_24055_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|24383_25277_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|25697_26849_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|29195_30212_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001214248.1|30598_31297_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|31323_32178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|32296_32521_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|32517_32958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|33074_34475_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
WP_001111342.1|34759_35170_-	hypothetical protein	NA	NA	NA	NA	NA
34585:34644	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000121359.1|35148_36105_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|36114_38313_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|38309_39266_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070700.1|39262_39952_-	aldehyde dehydrogenase iron-sulfur subunit	NA	A0A0P0IVM8	Acinetobacter_phage	34.3	9.4e-16
WP_001019920.1|40369_40984_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|41231_41561_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|41873_42584_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001310578.1|42552_44196_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|44185_46711_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716398.1|46736_47405_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|47462_48050_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|48124_48667_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|49490_49718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|49752_49893_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|49892_50156_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|50519_50621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020224.1|51735_52623_+	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_000169527.1|52669_52969_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|52965_53832_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 2
NZ_CP014273	Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence	213924	59733	100275	213924	integrase,transposase	Macacine_betaherpesvirus(28.57%)	23	97047:97060	106952:106965
WP_001143750.1|59733_62742_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.4	0.0e+00
WP_001092154.1|63332_64394_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001351580.1|64503_64917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351581.1|65080_65545_-	membrane protein	NA	NA	NA	NA	NA
WP_000483319.1|65650_66064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131420.1|66666_66855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000169527.1|67761_68061_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001443048.1|68057_68924_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	3.3e-50
WP_085947917.1|70276_71550_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000286435.1|72699_73392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064753882.1|74144_77051_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000995793.1|80089_84205_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.1	1.6e-126
WP_072145210.1|85976_87464_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001066941.1|88220_88961_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000361610.1|89245_90223_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_000990665.1|91062_91704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538310.1|93818_94109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963206.1|94098_94998_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000698737.1|95047_97273_-	phage T7 exclusion protein	NA	NA	NA	NA	NA
97047:97060	attL	GCATCTTTTTTCAG	NA	NA	NA	NA
WP_000952217.1|97274_98363_-	transcriptional repressor PifC	NA	NA	NA	NA	NA
WP_000813634.1|98942_99161_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|99162_99468_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016982.1|99468_100275_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
106952:106965	attR	CTGAAAAAAGATGC	NA	NA	NA	NA
