The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014029	Klebsiella aerogenes strain FDAARGOS_152 chromosome, complete genome	5317141	456314	493271	5317141	plate,lysis	Salmonella_phage(54.76%)	53	NA	NA
WP_032710244.1|456314_457196_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	60.2	3.6e-28
WP_032710246.1|457195_457969_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	55.6	9.7e-78
WP_032710247.1|457965_459165_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	70.5	4.4e-154
WP_032710248.1|459164_459518_-	bacteriophage protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_032710249.1|459519_460173_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	56.3	2.2e-70
WP_032710251.1|460243_461470_-	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	62.2	9.3e-99
WP_086557771.1|461560_461869_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	85.7	7.6e-34
WP_032710252.1|461904_462966_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	75.5	2.6e-142
WP_032710253.1|462968_463271_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	67.0	4.0e-35
WP_032710255.1|463270_463858_-	bacteriophage protein	NA	A0A0M3ULD5	Salmonella_phage	77.7	1.1e-73
WP_032710257.1|463857_465774_-	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	64.4	3.1e-226
WP_032710259.1|465763_465916_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_032710261.1|465951_466437_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	64.1	7.8e-49
WP_032710262.1|466440_466881_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	83.6	2.7e-64
WP_032710263.1|466892_468044_-	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	82.5	1.0e-179
WP_032710264.1|468045_468597_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	48.6	6.5e-44
WP_032710265.1|468589_468994_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	72.3	9.7e-45
WP_032710266.1|468993_469500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032710268.1|469499_469916_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	64.4	5.5e-43
WP_032710270.1|469884_470145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032710272.1|470190_471132_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.1e-139
WP_032710274.1|471143_471638_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	65.8	4.5e-52
WP_032710276.1|471649_472849_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	55.6	1.8e-107
WP_032710277.1|473110_473659_-	phage Mu F like family protein	NA	A0A0M4REK0	Salmonella_phage	56.1	1.1e-48
WP_032710279.1|473714_475166_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	69.6	4.8e-195
WP_032710280.1|475168_476782_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	82.9	1.1e-275
WP_032710281.1|476980_477454_-	DUF2280 domain-containing protein	NA	H9C190	Pectobacterium_phage	67.1	4.7e-51
WP_045368486.1|477485_478142_-	hypothetical protein	NA	I6S676	Salmonella_phage	90.2	4.8e-110
WP_032710283.1|478167_478368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032710284.1|478438_478900_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	59.1	1.8e-39
WP_032710285.1|478896_479394_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	82.4	1.1e-77
WP_049046135.1|479393_479696_-	hypothetical protein	NA	O64361	Escherichia_phage	75.2	4.0e-35
WP_032710286.1|480022_480631_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	52.0	1.3e-53
WP_032710288.1|480627_481272_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	74.0	4.3e-87
WP_032710291.1|481268_481571_-	DUF968 domain-containing protein	NA	A0A2I7QXN1	Vibrio_phage	57.6	3.1e-24
WP_162868533.1|481707_481875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032710292.1|482024_482258_-	DinI family protein	NA	H6WRY5	Salmonella_phage	70.1	3.4e-26
WP_032710294.1|482411_482741_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	64.9	5.1e-28
WP_032710400.1|482822_483092_-	hypothetical protein	NA	S4TNF2	Salmonella_phage	80.2	1.0e-34
WP_032710297.1|484256_484682_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	81.5	4.2e-59
WP_050483361.1|484681_485113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050483363.1|485390_485951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032710299.1|485947_486736_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.5	2.6e-62
WP_126000396.1|486955_487351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050483364.1|487377_487650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032710303.1|487663_488698_-	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	50.4	7.7e-30
WP_032710307.1|488963_489377_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	70.5	7.6e-45
WP_032710308.1|489376_489628_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	56.6	5.6e-19
WP_032710309.1|489735_490137_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	39.3	1.9e-13
WP_032710310.1|490591_490873_+	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_126000395.1|490968_491187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032710312.1|491775_491991_+	excisionase family protein	NA	NA	NA	NA	NA
WP_032710313.1|491990_493271_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	50.0	4.6e-117
>prophage 2
NZ_CP014029	Klebsiella aerogenes strain FDAARGOS_152 chromosome, complete genome	5317141	1472657	1555302	5317141	tail,tRNA,holin,portal,terminase,coat	Salmonella_phage(18.6%)	76	NA	NA
WP_015703166.1|1472657_1473932_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_015370324.1|1474021_1475143_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_015370323.1|1475169_1476168_-	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_015370322.1|1476442_1477609_-|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_004866348.1|1477959_1478391_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.3e-18
WP_015370321.1|1478551_1480876_-	peptidoglycan glycosyltransferase PbpC	NA	NA	NA	NA	NA
WP_015370320.1|1480876_1485820_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_015370319.1|1486024_1486873_+	3-mercaptopyruvate sulfurtransferase	NA	NA	NA	NA	NA
WP_015370318.1|1486916_1487693_-	enhanced serine sensitivity protein SseB	NA	NA	NA	NA	NA
WP_015370317.1|1487777_1489064_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	3.8e-34
WP_002913954.1|1489135_1489336_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_012540871.1|1489337_1489673_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_061069197.1|1489674_1491525_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	39.5	1.9e-103
WP_012540869.1|1491540_1492056_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_012540868.1|1492130_1492454_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.2e-21
WP_004866383.1|1492473_1492860_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.0e-52
WP_015370315.1|1492886_1494101_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.2e-34
WP_015370314.1|1494278_1494770_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_015370313.1|1495014_1495749_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_015370312.1|1495869_1496673_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_015370311.1|1496721_1497702_-	nickel/cobalt transporter	NA	NA	NA	NA	NA
WP_015370310.1|1497692_1498331_-	DUF1007 family protein	NA	NA	NA	NA	NA
WP_032706139.1|1498455_1499733_+	stationary phase inducible protein CsiE	NA	NA	NA	NA	NA
WP_015370308.1|1499729_1500866_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_015370306.1|1501165_1501588_+	DoxX family protein	NA	NA	NA	NA	NA
WP_015370305.1|1501644_1502898_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	3.3e-99
WP_015370304.1|1503222_1504413_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|1504486_1504825_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_015370303.1|1504890_1506228_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	36.3	2.0e-09
WP_026612244.1|1506214_1506907_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_015703178.1|1506924_1508361_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	9.1e-13
WP_015370300.1|1508923_1512811_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.1	8.0e-128
WP_032706270.1|1512984_1514604_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_015370298.1|1514600_1515104_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	6.5e-06
WP_015370297.1|1515183_1515819_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_015370295.1|1516033_1516882_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032707170.1|1517292_1518546_+|tail	phage tail fiber protein	tail	A0A1J0MHZ5	Klebsiella_phage	47.3	9.9e-88
WP_061069198.1|1519997_1521944_-	hypothetical protein	NA	Q716G1	Shigella_phage	46.2	9.8e-34
WP_049029804.1|1522081_1522330_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	54.5	1.5e-16
WP_049029807.1|1522716_1525437_-	lytic transglycosylase domain-containing protein	NA	A0A2D1GLK8	Escherichia_phage	31.3	6.2e-103
WP_049029809.1|1525436_1526762_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	51.5	4.0e-63
WP_049029812.1|1526771_1527422_-	hypothetical protein	NA	G5DA80	Enterobacteria_phage	69.2	1.2e-41
WP_049029814.1|1527396_1527876_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	75.3	3.4e-65
WP_049029815.1|1527875_1528706_-	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	64.5	4.4e-44
WP_049029817.1|1528705_1530133_-	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	69.5	6.6e-205
WP_049029819.1|1530104_1530608_-	recombinase RmuC	NA	A0A2D1GLR5	Escherichia_phage	63.0	8.0e-49
WP_049029821.1|1530626_1530857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049029823.1|1530907_1532197_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	74.2	7.3e-187
WP_049029824.1|1532196_1533108_-	scaffolding protein	NA	A0A0M3ULI9	Salmonella_phage	71.9	5.3e-115
WP_049029868.1|1533122_1535300_-|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	75.3	5.2e-302
WP_049029826.1|1535303_1536809_-|terminase	terminase large subunit	terminase	A0A0M4S5Z3	Salmonella_phage	83.9	9.5e-263
WP_032707197.1|1536789_1537350_-|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	68.4	2.0e-56
WP_049029829.1|1537381_1537915_-	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	29.9	4.3e-08
WP_162837727.1|1537923_1538169_-	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	67.1	1.6e-18
WP_071647605.1|1538231_1538612_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	63.5	1.6e-41
WP_099093486.1|1538767_1539097_-	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	51.9	2.5e-19
WP_032707202.1|1539174_1539654_-	glycoside hydrolase family 104 protein	NA	S5FV07	Shigella_phage	79.1	2.1e-67
WP_020947700.1|1539640_1539982_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	67.9	5.3e-28
WP_049029837.1|1540320_1540755_-	antitermination protein Q	NA	B6SD39	Bacteriophage	59.3	1.4e-41
WP_049029841.1|1541434_1543690_-	DNA primase	NA	A0A1J0ME63	Escherichia_phage	32.4	1.3e-05
WP_071647601.1|1543693_1543861_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049029843.1|1543977_1544670_+	helix-turn-helix transcriptional regulator	NA	R9TNM0	Vibrio_phage	49.8	2.9e-57
WP_049029845.1|1545024_1545594_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	52.1	9.4e-38
WP_162837726.1|1545845_1545995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049029847.1|1545991_1546924_+	hypothetical protein	NA	Q3LZP9	Bacteriophage	55.4	2.4e-06
WP_049029849.1|1546927_1548226_+	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	58.9	6.5e-143
WP_032707214.1|1548242_1548791_+	DUF2815 family protein	NA	Q775A5	Bordetella_phage	64.8	6.0e-66
WP_049029851.1|1548818_1549418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049029852.1|1549444_1551565_+	DNA polymerase	NA	Q775A3	Bordetella_phage	65.2	1.1e-264
WP_049029853.1|1551567_1551768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061069199.1|1551772_1552000_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080972521.1|1552072_1552891_+	DNA cytosine methyltransferase	NA	A0A2I7QZY6	Vibrio_phage	52.7	2.0e-60
WP_049029855.1|1552814_1553099_+	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	66.7	3.7e-27
WP_155959226.1|1553095_1553239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049029856.1|1553257_1553869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049029858.1|1553910_1555302_+	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.3	7.8e-211
>prophage 3
NZ_CP014029	Klebsiella aerogenes strain FDAARGOS_152 chromosome, complete genome	5317141	1568774	1647363	5317141	capsid,tail,lysis,tRNA,holin,plate,portal,terminase,integrase,head	Escherichia_phage(30.61%)	85	1611471:1611484	1654208:1654221
WP_015370282.1|1568774_1569512_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_015370281.1|1569642_1570974_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.1	1.5e-46
WP_002914084.1|1571019_1571403_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_015370280.1|1571715_1572405_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.6	4.2e-56
WP_015703188.1|1572460_1573531_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_015370277.1|1573735_1574161_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	3.5e-13
WP_015703189.1|1574230_1574929_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_015370275.1|1574964_1577640_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_015370274.1|1577736_1579092_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_015370273.1|1579134_1579458_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_015370272.1|1579460_1580759_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.2	1.5e-43
WP_032706294.1|1586792_1589366_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	2.0e-127
WP_015370270.1|1589495_1590227_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_015370269.1|1590223_1591204_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_015370268.1|1591335_1592073_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|1592345_1592681_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100279143.1|1592795_1592843_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_015370267.1|1592944_1594105_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_015370266.1|1594101_1594974_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_015370265.1|1595041_1596163_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_015370264.1|1596172_1597243_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.7	5.3e-90
WP_026612240.1|1597586_1598096_+	YfiR family protein	NA	NA	NA	NA	NA
WP_015370262.1|1598088_1599312_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_015370261.1|1599324_1599804_+	OmpA family protein	NA	NA	NA	NA	NA
WP_015370260.1|1599809_1601180_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_032706438.1|1601236_1601686_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_032710447.1|1601919_1602951_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	87.0	6.1e-176
WP_015370196.1|1603034_1603535_-	PH domain-containing protein	NA	A0A1D9C9Q4	Salinivibrio_phage	62.7	3.0e-48
WP_071647611.1|1603556_1603895_-	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	63.4	1.7e-34
WP_032710448.1|1603903_1604761_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	56.0	5.2e-88
WP_014343378.1|1604981_1605113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015370192.1|1605144_1605654_+	phage regulatory CII family protein	NA	Q6K1F8	Salmonella_virus	93.5	9.2e-85
WP_071647612.1|1605661_1605862_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	78.0	1.0e-15
WP_015370191.1|1605942_1606230_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	57.0	1.3e-24
WP_015370190.1|1606293_1606527_+	DUF2732 family protein	NA	Q6K1F6	Salmonella_virus	75.3	1.7e-22
WP_015370189.1|1606526_1606748_+	TraR/DksA family transcriptional regulator	NA	A0A218M4I6	Erwinia_phage	86.3	5.3e-29
WP_032710449.1|1606748_1607045_+	DUF3850 domain-containing protein	NA	A0A2D1GP44	Escherichia_phage	45.5	3.0e-11
WP_015370188.1|1607041_1607323_+	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	91.4	1.4e-42
WP_161940104.1|1607471_1609568_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	88.1	0.0e+00
WP_032710487.1|1609680_1609863_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	88.3	3.6e-23
WP_015370185.1|1610150_1610639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032710452.1|1610653_1611745_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
1611471:1611484	attL	ATCCAGAACTCTTT	NA	NA	NA	NA
WP_015370183.1|1612415_1613462_-|portal	phage portal protein	portal	A0A2I8TV74	Erwinia_phage	94.0	1.4e-188
WP_032710453.1|1613464_1615234_-|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	97.3	0.0e+00
WP_015370180.1|1615399_1616254_+|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	94.0	1.7e-152
WP_032710454.1|1616330_1617398_+|capsid	phage major capsid protein, P2 family	capsid	O80304	Escherichia_phage	89.6	4.6e-179
WP_015370178.1|1617402_1618152_+|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	90.4	4.9e-111
WP_015370177.1|1618245_1618755_+|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	94.7	1.5e-87
WP_015370176.1|1618754_1618958_+|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	91.0	8.3e-29
WP_015370175.1|1618960_1619257_+|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	95.9	1.1e-45
WP_015370174.1|1619243_1619741_+	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	93.3	1.1e-87
WP_015370173.1|1619737_1620151_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	94.2	1.6e-63
WP_001384078.1|1620122_1620296_+	hypothetical protein	NA	O80311	Escherichia_phage	98.2	6.2e-25
WP_015370172.1|1620258_1620726_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	97.4	2.3e-82
WP_015370171.1|1620718_1621180_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	76.2	1.1e-52
WP_015370170.1|1621231_1622590_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_032710455.1|1622663_1623305_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.9	6.3e-99
WP_015370168.1|1623301_1623649_+	GPW/gp25 family protein	NA	A0A218M4K8	Erwinia_phage	92.2	3.1e-52
WP_015370167.1|1623655_1624564_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	96.4	2.6e-154
WP_015370166.1|1624556_1625165_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	93.1	1.6e-107
WP_015370165.1|1625161_1626637_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	49.0	1.2e-108
WP_015370164.1|1626636_1627254_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	55.2	3.9e-53
WP_015370163.1|1627385_1628564_+|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	94.9	6.0e-212
WP_015370162.1|1628579_1629098_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	9.4e-93
WP_015370161.1|1629160_1629496_+|tail	phage tail assembly protein	tail	Q37846	Escherichia_phage	86.2	6.1e-45
WP_015370160.1|1629528_1629648_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	97.4	8.8e-15
WP_015370159.1|1629640_1632082_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	88.6	0.0e+00
WP_015370158.1|1632096_1632582_+|tail	phage tail protein	tail	O80317	Escherichia_phage	94.3	5.0e-80
WP_015370157.1|1632578_1633742_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	93.5	2.8e-201
WP_071647615.1|1633820_1634039_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	88.9	2.0e-33
WP_002914145.1|1634198_1634546_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_008806092.1|1634585_1635353_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_015703198.1|1635384_1635933_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_015370257.1|1635951_1636200_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_020078159.1|1636438_1637803_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_015703199.1|1637969_1638761_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_026612238.1|1638778_1640065_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_061069200.1|1640168_1640759_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_015370252.1|1640882_1641761_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_015370251.1|1641847_1643509_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_015370250.1|1643656_1643995_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_015370249.1|1644058_1644349_-	RnfH family protein	NA	NA	NA	NA	NA
WP_026612237.1|1644338_1644815_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_015370247.1|1644929_1645412_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	5.2e-29
WP_015370148.1|1646121_1647363_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	48.0	3.7e-103
1654208:1654221	attR	ATCCAGAACTCTTT	NA	NA	NA	NA
>prophage 4
NZ_CP014029	Klebsiella aerogenes strain FDAARGOS_152 chromosome, complete genome	5317141	4652448	4709327	5317141	integrase,tail,protease,holin	Klebsiella_phage(25.0%)	52	4642251:4642270	4717392:4717411
4642251:4642270	attL	GCCGTCGGGATTTTGCGTCG	NA	NA	NA	NA
WP_032705615.1|4652448_4654206_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_015367432.1|4654391_4654844_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_080473199.1|4654935_4655988_-	porin OmpA	NA	NA	NA	NA	NA
WP_020079240.1|4656340_4656850_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_026612357.1|4657299_4657923_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_015367427.1|4657910_4660046_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_015367426.1|4660063_4660510_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_015367425.1|4660633_4662688_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	28.0	4.6e-18
WP_015367424.1|4662718_4663177_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_020079236.1|4663334_4663748_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_100280363.1|4664360_4670492_+	BapA prefix-like domain-containing protein	NA	NA	NA	NA	NA
WP_015367420.1|4670662_4672099_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_015367419.1|4672095_4674243_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	2.4e-25
WP_015367418.1|4674239_4675457_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_015367417.1|4675511_4678646_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015367416.1|4678792_4679665_+	peptidase	NA	NA	NA	NA	NA
WP_015367415.1|4679710_4680028_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_015367414.1|4680126_4681329_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_015704915.1|4681511_4681793_+	acylphosphatase	NA	NA	NA	NA	NA
WP_015367412.1|4681789_4682119_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_015367411.1|4682206_4682866_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	4.9e-46
WP_015367409.1|4683131_4684760_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032710168.1|4685268_4685538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032710169.1|4685541_4685967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032710377.1|4686113_4687142_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	50.0	1.7e-82
WP_071609812.1|4687125_4687359_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_080473201.1|4687428_4688967_-	exonuclease	NA	S4TNL0	Salmonella_phage	62.9	9.9e-82
WP_032710172.1|4688856_4689222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032710174.1|4689214_4689883_+	morphogenetic protein	NA	A0A077KCB2	Edwardsiella_phage	49.6	2.6e-55
WP_162473736.1|4689879_4690032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032710176.1|4690115_4690373_+	DNA polymerase III subunit theta	NA	A0A077SLL5	Escherichia_phage	77.3	7.8e-24
WP_125961803.1|4690754_4691327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125961801.1|4691338_4691572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032710180.1|4691574_4691967_+	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032710182.1|4692104_4692434_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	60.0	1.1e-27
WP_032710185.1|4692586_4692820_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.4	8.9e-27
WP_048338985.1|4693162_4693555_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	44.3	4.8e-17
WP_032710186.1|4693551_4693755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032710187.1|4693754_4694786_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	50.1	1.2e-96
WP_032710384.1|4694799_4695402_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	71.1	2.4e-79
WP_032705626.1|4696478_4696790_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	84.5	1.1e-43
WP_032705627.1|4696786_4697329_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	71.3	5.1e-73
WP_032710188.1|4697325_4697673_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	76.5	2.2e-37
WP_032705629.1|4697669_4697933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032705630.1|4697883_4698081_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	90.9	9.5e-22
WP_032707023.1|4698959_4699247_+	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	43.8	1.3e-11
WP_125961794.1|4702079_4702679_+	hypothetical protein	NA	A0A1X7QGJ8	Escherichia_phage	37.3	8.2e-32
WP_032705633.1|4702687_4703830_+|tail	tail fiber domain-containing protein	tail	A0A0D4D9I5	Escherichia_phage	47.2	3.0e-19
WP_032705635.1|4704161_4704749_+	LysE family translocator	NA	NA	NA	NA	NA
WP_032705636.1|4704806_4705700_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032710189.1|4705988_4707266_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_032705639.1|4707329_4709327_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.7	2.2e-20
4717392:4717411	attR	GCCGTCGGGATTTTGCGTCG	NA	NA	NA	NA
