The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014017	Serratia liquefaciens strain FDAARGOS_125 chromosome, complete genome	5284740	524566	530309	5284740	transposase	Erwinia_phage(33.33%)	11	NA	NA
WP_048760573.1|524566_525424_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	50.0	3.5e-76
WP_048760572.1|525528_525921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048760568.1|525952_526462_+	phage regulatory CII family protein	NA	F1BUS6	Erwinia_phage	58.0	5.3e-48
WP_123905322.1|526472_526709_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_046373862.1|526641_527097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046373863.1|527095_527317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046373864.1|527318_527672_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	54.5	3.6e-27
WP_048760566.1|527738_528011_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_048760564.1|528010_528229_+	TraR/DksA C4-type zinc finger protein	NA	A0A218M4I6	Erwinia_phage	59.7	2.3e-16
WP_061068883.1|528231_529056_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	45.7	6.1e-62
WP_104410900.1|529188_530309_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.0	1.1e-50
>prophage 2
NZ_CP014017	Serratia liquefaciens strain FDAARGOS_125 chromosome, complete genome	5284740	536585	544064	5284740	transposase	Shigella_phage(28.57%)	10	NA	NA
WP_071888861.1|536585_536903_-	DUF1364 domain-containing protein	NA	A0A2K8HR56	Pseudomonas_phage	48.8	3.3e-16
WP_048762167.1|536903_537551_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	32.5	1.4e-16
WP_048762210.1|537547_538210_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	67.1	8.3e-86
WP_104410902.1|538335_539549_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.1	5.2e-102
WP_061068886.1|539569_539818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048762164.1|539814_540957_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	66.4	5.8e-103
WP_161800673.1|540960_541521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048762159.1|541450_542503_-	hypothetical protein	NA	A0A1C8E9B4	Bacillus_phage	27.6	1.9e-07
WP_048762156.1|542681_543044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048762155.1|543422_544064_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	47.9	1.1e-47
>prophage 3
NZ_CP014017	Serratia liquefaciens strain FDAARGOS_125 chromosome, complete genome	5284740	550693	559926	5284740	transposase,integrase	uncultured_Caudovirales_phage(37.5%)	12	554196:554210	562821:562835
WP_048762135.1|550693_551848_+	hypothetical protein	NA	M4MHC3	Vibrio_phage	35.7	9.9e-34
WP_048762133.1|551849_552272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048762131.1|552278_552515_+	hypothetical protein	NA	H2DE70	Erwinia_phage	56.2	1.4e-16
WP_048762129.1|552511_552814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048762127.1|552813_553038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048762125.1|553312_553963_+	hypothetical protein	NA	NA	NA	NA	NA
554196:554210	attL	CAGGTGTGTTTATTT	NA	NA	NA	NA
WP_048762123.1|554813_555236_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	55.6	6.3e-31
WP_048762121.1|555235_556504_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	71.5	2.6e-176
WP_082748000.1|556506_556995_-	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	53.2	1.3e-40
WP_104410903.1|557092_558266_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	72.5	2.9e-134
WP_071888867.1|558596_558872_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.6	6.0e-14
WP_048762115.1|558840_559926_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.7	2.9e-104
562821:562835	attR	AAATAAACACACCTG	NA	NA	NA	NA
>prophage 4
NZ_CP014017	Serratia liquefaciens strain FDAARGOS_125 chromosome, complete genome	5284740	3424713	3455414	5284740	protease,transposase,integrase	Escherichia_phage(33.33%)	31	3437826:3437839	3460698:3460711
WP_172958955.1|3424713_3425001_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_061068999.1|3425157_3425547_-	DUF937 domain-containing protein	NA	NA	NA	NA	NA
WP_104410936.1|3426135_3426444_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_104410981.1|3426481_3426883_-	DUF3761 domain-containing protein	NA	NA	NA	NA	NA
WP_061069000.1|3427016_3427529_-	DUF2165 domain-containing protein	NA	NA	NA	NA	NA
WP_061069002.1|3428370_3428964_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.5	6.4e-53
WP_061069003.1|3429348_3429909_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_172958956.1|3429966_3430677_+	molecular chaperone	NA	NA	NA	NA	NA
WP_061069006.1|3430788_3431274_+	fimbrial protein	NA	NA	NA	NA	NA
WP_061069007.1|3431404_3432019_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_061069008.1|3432053_3432761_+	molecular chaperone	NA	NA	NA	NA	NA
WP_061069009.1|3433033_3433789_+	molecular chaperone	NA	NA	NA	NA	NA
WP_104410938.1|3433851_3436506_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_061069012.1|3436502_3437174_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
3437826:3437839	attL	ACCCCGGCCAAGGG	NA	NA	NA	NA
WP_123905315.1|3439807_3440428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123905316.1|3440538_3442215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061069015.1|3442617_3443103_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_061069016.1|3443162_3443579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061069172.1|3444104_3444827_+	aquaporin Z	NA	NA	NA	NA	NA
WP_104410940.1|3444823_3445591_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_061069019.1|3445587_3445899_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061069020.1|3446056_3446251_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_123905317.1|3446256_3446871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061069023.1|3448283_3448568_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061069024.1|3448934_3449570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071888895.1|3449830_3450478_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	56.8	6.9e-53
WP_172958957.1|3450910_3451231_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	61.3	3.1e-30
WP_061069025.1|3451227_3451575_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	92.2	6.5e-58
WP_082748009.1|3452446_3452779_-|transposase	transposase	transposase	Q716C1	Shigella_phage	46.0	3.7e-18
WP_061069028.1|3453660_3453843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061069029.1|3454166_3455414_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.1	1.7e-79
3460698:3460711	attR	CCCTTGGCCGGGGT	NA	NA	NA	NA
>prophage 5
NZ_CP014017	Serratia liquefaciens strain FDAARGOS_125 chromosome, complete genome	5284740	3867647	3909427	5284740	plate,holin,terminase,integrase	Escherichia_phage(48.94%)	64	3863203:3863216	3900091:3900104
3863203:3863216	attL	ATAAAAAACAATGG	NA	NA	NA	NA
WP_061069039.1|3867647_3868877_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	67.0	5.0e-177
WP_071888898.1|3868854_3869130_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	52.4	2.3e-18
WP_061069040.1|3869319_3869721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071888899.1|3869717_3869927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082748010.1|3869985_3870480_-	antA/AntB antirepressor family protein	NA	A0A0P0ZDY7	Stx2-converting_phage	64.9	2.8e-38
WP_061069041.1|3870779_3871283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061069042.1|3871286_3871490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082748018.1|3871489_3871735_-	hypothetical protein	NA	R9W086	Serratia_phage	61.8	2.6e-16
WP_061069044.1|3872180_3872480_-	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	75.3	4.3e-42
WP_061069045.1|3872741_3873266_-	hypothetical protein	NA	A0A0H4IQ56	Shigella_phage	68.5	2.1e-63
WP_061069046.1|3873252_3873681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061069047.1|3873677_3874373_-	hypothetical protein	NA	A0A076G7C3	Sinorhizobium_phage	35.1	1.8e-27
WP_123905319.1|3874369_3874690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061069174.1|3874664_3875513_-	hypothetical protein	NA	R9W077	Serratia_phage	44.7	1.1e-55
WP_061069049.1|3875528_3875771_-	hypothetical protein	NA	A0A248SKY6	Klebsiella_phage	52.9	4.8e-07
WP_172958959.1|3875761_3875923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123905320.1|3875909_3876317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061069050.1|3876747_3877032_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_172958960.1|3877014_3877191_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	75.6	5.2e-11
WP_061069051.1|3877235_3877817_-	hypothetical protein	NA	A0A291AXG3	Shigella_phage	57.5	2.4e-65
WP_082748019.1|3878206_3878659_-	helix-turn-helix domain-containing protein	NA	A0A2R2X2B0	Escherichia_phage	62.6	1.3e-21
WP_061069175.1|3878763_3878970_+	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	55.2	2.5e-09
WP_061069053.1|3878988_3879279_+	hypothetical protein	NA	I6PCV6	Cronobacter_phage	39.8	2.3e-08
WP_082748011.1|3879293_3879533_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_071888900.1|3879529_3879892_+	HNH endonuclease	NA	A0A2I7RX05	Vibrio_phage	42.2	1.3e-13
WP_061069055.1|3879888_3880941_+	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	54.6	1.8e-29
WP_061069056.1|3880937_3881408_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	39.8	6.6e-13
WP_061069057.1|3881404_3882037_+	recombination protein NinG	NA	H6WRY9	Salmonella_phage	44.4	2.7e-41
WP_071888901.1|3882033_3882441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061069058.1|3882437_3883268_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	49.1	1.2e-68
WP_071888902.1|3883494_3883731_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_061069059.1|3883699_3884029_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_048794968.1|3884560_3884938_+	membrane protein	NA	A0A1S5NRL1	Burkholderia_phage	45.2	1.2e-12
WP_061069060.1|3884927_3885206_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	43.2	1.5e-09
WP_061069061.1|3885211_3885598_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	76.4	1.9e-50
WP_061069062.1|3885594_3885981_+	DUF2570 family protein	NA	NA	NA	NA	NA
WP_061069176.1|3886290_3886476_+	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	71.7	2.3e-17
WP_071888904.1|3886501_3887050_+	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	50.3	1.0e-44
WP_061069063.1|3887042_3887951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061069064.1|3887947_3888568_+	methyltransferase domain-containing protein	NA	A0A0U4IIB3	Pseudomonas_phage	47.7	2.5e-44
WP_061069065.1|3888585_3889617_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	49.4	8.2e-64
WP_104410948.1|3889626_3890952_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	75.8	4.8e-202
WP_061069067.1|3890967_3892398_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	76.1	1.6e-211
WP_071888905.1|3892351_3893188_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	80.2	3.1e-130
WP_061069068.1|3893168_3894509_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	73.9	2.1e-144
WP_061069069.1|3894501_3895119_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	70.7	2.2e-80
WP_061069070.1|3895129_3896158_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	79.8	1.4e-156
WP_061069071.1|3896224_3896695_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	71.2	5.6e-60
WP_061069072.1|3896694_3897150_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	63.8	4.0e-47
WP_061069073.1|3897146_3897578_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	61.6	2.7e-45
WP_061069074.1|3897564_3898509_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	65.3	8.7e-113
WP_061069075.1|3898508_3899834_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	73.0	6.8e-180
WP_061069076.1|3899858_3900287_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	70.4	1.6e-53
3900091:3900104	attR	ATAAAAAACAATGG	NA	NA	NA	NA
WP_061069077.1|3900286_3900871_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	66.8	9.0e-68
WP_061069078.1|3900965_3902915_+	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	45.8	1.1e-146
WP_061069079.1|3902918_3903572_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	71.6	3.7e-86
WP_061069080.1|3903571_3903841_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	64.4	2.1e-27
WP_061069081.1|3903841_3904846_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	51.7	6.5e-90
WP_061069082.1|3904846_3905548_+	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	69.7	1.1e-85
WP_061069083.1|3905547_3905895_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	73.9	7.5e-46
WP_061069084.1|3905916_3906618_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172958961.1|3906692_3906869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061069085.1|3906935_3907766_+	hypothetical protein	NA	A0A2H4FRZ6	Salmonella_phage	67.3	6.5e-80
WP_071888906.1|3908164_3909427_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	60.4	2.3e-137
>prophage 6
NZ_CP014017	Serratia liquefaciens strain FDAARGOS_125 chromosome, complete genome	5284740	4153363	4163298	5284740		Planktothrix_phage(33.33%)	8	NA	NA
WP_020827997.1|4153363_4154452_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	40.7	9.3e-34
WP_020827996.1|4154536_4155418_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	40.3	1.1e-53
WP_048760972.1|4155421_4157374_-	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	41.6	3.5e-39
WP_048760971.1|4157376_4158570_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	70.0	3.4e-29
WP_048760969.1|4158744_4159425_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_048761016.1|4159430_4160747_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	25.6	3.2e-20
WP_012146162.1|4161011_4161521_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_020827991.1|4161570_4163298_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	32.9	1.1e-17
>prophage 7
NZ_CP014017	Serratia liquefaciens strain FDAARGOS_125 chromosome, complete genome	5284740	4981256	5020015	5284740	protease,holin,portal,tail,integrase,terminase,lysis,coat	Salmonella_phage(28.57%)	45	4983370:4983392	5022535:5022557
WP_048758644.1|4981256_4983146_-	hypothetical protein	NA	A0A289Z7P2	Serratia_phage	33.0	2.4e-93
4983370:4983392	attL	CTAGAACACCTGTTTGAACGGTT	NA	NA	NA	NA
WP_061069110.1|4983571_4984753_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	57.5	3.0e-139
WP_061069112.1|4984957_4986349_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	75.4	2.9e-213
WP_061069113.1|4986485_4986701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061069114.1|4986827_4987097_-	VRR-NUC domain-containing protein	NA	Q3LZN4	Bacteriophage	64.0	6.0e-27
WP_061069115.1|4987160_4987421_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	60.0	2.0e-19
WP_061069116.1|4987478_4988135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061069118.1|4988390_4988816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061069119.1|4988821_4990918_-	DNA polymerase I	NA	Q775A3	Bordetella_phage	65.9	1.2e-268
WP_061069120.1|4990940_4991444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061069121.1|4991507_4992377_-|protease	serine protease	protease	K4F991	Cronobacter_phage	80.8	3.1e-104
WP_061069122.1|4992373_4992574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020826266.1|4992616_4993165_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	67.6	2.5e-67
WP_061069123.1|4993177_4994491_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	5.6e-134
WP_061069124.1|4994494_4995418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061069125.1|4995649_4996018_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	67.2	2.4e-42
WP_061069126.1|4996098_4996305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061069127.1|4996315_4996498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061069128.1|4996511_4996721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172958964.1|4997183_4997345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061069129.1|4997607_4998273_-	helix-turn-helix domain-containing protein	NA	B6SCU0	Bacteriophage	44.0	2.3e-51
WP_061069130.1|4998402_4998612_+	transcriptional regulator	NA	K7RWG7	Bacteriophage	60.4	4.9e-08
WP_061069131.1|4998615_5000784_+	bifunctional DNA primase/polymerase	NA	B6SD37	Bacteriophage	68.4	4.7e-162
WP_061069132.1|5001079_5001502_+	antitermination protein Q	NA	B6SCZ7	Bacteriophage	41.7	3.3e-19
WP_041416149.1|5001973_5002324_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	52.3	2.4e-28
WP_061069133.1|5002329_5002941_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	56.9	1.4e-58
WP_061069134.1|5002937_5003399_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	44.2	2.6e-17
WP_061069135.1|5003395_5003761_+	hypothetical protein	NA	K7PH35	Enterobacteria_phage	66.4	2.2e-35
WP_061069136.1|5003890_5004133_+	DUF2560 family protein	NA	A0A192Y6S9	Salmonella_phage	67.1	1.7e-17
WP_061069137.1|5004141_5004675_+	hypothetical protein	NA	A0A192Y6U9	Salmonella_phage	27.0	5.6e-08
WP_061069138.1|5004706_5005267_+|terminase	terminase small subunit	terminase	A0A1W6JNT5	Morganella_phage	65.4	5.8e-56
WP_061069139.1|5005247_5006753_+|terminase	terminase	terminase	E7C9T5	Salmonella_phage	82.9	7.6e-260
WP_061069180.1|5006756_5008934_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	78.8	1.5e-309
WP_061069140.1|5008948_5009860_+	scaffolding protein	NA	A0A0M3ULI9	Salmonella_phage	71.0	3.4e-114
WP_074025869.1|5009859_5011149_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	74.5	5.6e-187
WP_061069141.1|5011197_5011491_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	54.5	2.0e-07
WP_061069142.1|5011510_5012014_+	recombinase RmuC	NA	A0A2D1GLR5	Escherichia_phage	63.6	1.8e-48
WP_061069143.1|5011985_5013413_+	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	69.7	3.7e-200
WP_071888911.1|5013412_5014240_+|tail	phage tail protein	tail	A0A192Y6T9	Salmonella_phage	61.2	4.0e-37
WP_061069145.1|5014239_5014701_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	2.1e-64
WP_061069146.1|5014694_5015345_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	64.1	1.8e-40
WP_061069147.1|5015354_5016698_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	48.1	9.0e-63
WP_061069148.1|5016697_5019385_+	lytic transglycosylase domain-containing protein	NA	A0A2D1GLK8	Escherichia_phage	33.0	2.4e-99
WP_061069149.1|5019457_5019745_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	53.6	1.5e-20
WP_061069150.1|5019766_5020015_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	51.9	2.0e-16
5022535:5022557	attR	CTAGAACACCTGTTTGAACGGTT	NA	NA	NA	NA
