The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	412810	436323	5478683	integrase,holin,transposase,tail	Enterobacteria_phage(33.33%)	27	404456:404470	437194:437208
404456:404470	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|412810_414016_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|414017_415331_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|415327_416959_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|416959_417358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|417455_417869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150572.1|418264_419545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|419620_419956_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|419958_420714_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|421031_421598_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|421572_422184_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|422180_422846_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|422842_423466_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|423718_424462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|424547_424715_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|425122_426976_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|427125_427341_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|427345_427690_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|428046_428427_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|428423_428771_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|429271_430485_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|430702_430972_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|431132_431555_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|431684_432743_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|432821_433472_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|433654_434245_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|434746_434995_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|435840_436323_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
437194:437208	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	713863	781547	5478683	portal,terminase,protease,holin,lysis,transposase,tail,capsid,integrase	Escherichia_phage(45.16%)	93	718258:718282	780516:780540
WP_000950857.1|713863_714433_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|714432_714900_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|714886_715567_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|715576_716713_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|716887_718045_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
718258:718282	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_001218308.1|718476_719646_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|719629_719812_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_000994803.1|719890_720268_-	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_001291844.1|720303_720516_-	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000163444.1|720475_721102_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_000268107.1|721098_721329_-	hypothetical protein	NA	Q08J65	Stx2-converting_phage	100.0	1.9e-37
WP_000669287.1|721328_721496_-	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	100.0	2.9e-27
WP_000203836.1|721538_722162_-	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	100.0	1.7e-112
WP_000376712.1|722517_722802_-	DUF4752 family protein	NA	A0A0N7KZC7	Stx2-converting_phage	100.0	4.5e-49
WP_000206751.1|722801_723419_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	7.7e-118
WP_000212746.1|723422_723710_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|723711_723930_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_001301947.1|723931_724147_-	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001301469.1|724106_724613_-	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001289942.1|724614_725562_-	ead/Ea22-like family protein	NA	A0A0P0ZDS3	Stx2-converting_phage	100.0	2.1e-183
WP_000774248.1|725558_725780_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001447493.1|725878_726160_-	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
WP_000548531.1|726170_726362_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682315.1|726334_726517_-	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000186866.1|726513_727194_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000100845.1|727190_727976_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995464.1|727981_728278_-	host-nuclease inhibitor protein Gam	NA	A0A0P0ZCL3	Stx2-converting_phage	100.0	2.1e-49
WP_000372940.1|728332_728497_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	100.0	1.9e-23
WP_001198861.1|728465_728630_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065487.1|728702_729071_-	DUF2528 family protein	NA	A0A0P0ZCC3	Stx2-converting_phage	100.0	4.5e-65
WP_000167595.1|729221_729692_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000198444.1|729750_730134_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000745484.1|730622_730787_-	hypothetical protein	NA	A0A0P0ZCU5	Stx2-converting_phage	100.0	3.0e-21
WP_000957426.1|730789_731836_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221210.1|731829_732291_-	hypothetical protein	NA	A0A0P0ZD85	Stx2-converting_phage	100.0	1.7e-77
WP_000885202.1|732358_732700_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_000250473.1|732760_733468_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|733546_733774_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438489.1|733912_734209_+	hypothetical protein	NA	A0A0N7KZD0	Stx2-converting_phage	100.0	5.2e-48
WP_000185456.1|734241_735180_+	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000788871.1|735176_735878_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_000145935.1|735874_736165_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|736235_736514_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103680.1|736646_736862_+	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_061069246.1|737035_737452_+	recombination protein NinB	NA	G9L686	Escherichia_phage	99.3	1.1e-72
WP_000573864.1|737444_738047_+	HNH endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_000153301.1|738043_738571_+	phage N-6-adenine-methyltransferase	NA	A0A0N7KZD1	Stx2-converting_phage	100.0	7.3e-101
WP_001254258.1|738567_738762_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000201603.1|739018_739693_+	phage antirepressor Ant	NA	G9L689	Escherichia_phage	100.0	1.6e-129
WP_000924600.1|739767_740169_+	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	1.4e-72
WP_001563210.1|740128_740338_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_001292288.1|740330_741053_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCJ8	Stx2-converting_phage	100.0	5.4e-131
WP_001107963.1|741052_741658_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144764.1|741654_741849_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|741841_742276_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000649753.1|743057_744017_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|744028_744298_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874499.1|744784_746722_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000143458.1|746856_747036_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|747076_747349_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|747425_747641_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087461.1|747645_748179_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001056885.1|748452_749022_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|749021_749171_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|749178_749643_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|749674_749968_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|750117_750321_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086069.1|750376_751183_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000143988.1|751163_752870_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787025.1|752869_755014_+|portal	portal protein	portal	A0A0P0ZBZ2	Stx2-converting_phage	100.0	0.0e+00
WP_162829202.1|755731_756945_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000994870.1|757075_757492_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.6e-69
WP_000214474.1|757515_758730_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|758785_759175_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|759224_759686_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|759669_760233_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207923.1|760232_760883_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_001301432.1|760879_762817_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCY7	Stx2-converting_phage	100.0	1.1e-64
WP_001024006.1|762818_763088_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|763226_763415_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146323.1|763709_765335_+	hypothetical protein	NA	A0A0P0ZDC2	Stx2-converting_phage	100.0	0.0e+00
WP_000197192.1|765331_766600_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|766614_766893_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|766898_767516_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835361.1|767606_768341_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_000078907.1|768571_768712_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035557.1|768768_769170_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000509483.1|769264_769921_+	hypothetical protein	NA	A0A0P0ZCM5	Stx2-converting_phage	100.0	5.1e-104
WP_000455652.1|769923_770370_+	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
WP_000540400.1|770379_770673_+	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	100.0	4.1e-13
WP_000012445.1|770683_771949_+	hypothetical protein	NA	A0A0P0ZD72	Stx2-converting_phage	100.0	4.4e-229
WP_000331680.1|772017_780393_+	hypothetical protein	NA	A0A0P0ZCC7	Stx2-converting_phage	100.0	0.0e+00
WP_000368131.1|780614_781547_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
780516:780540	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
>prophage 3
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	1027662	1136406	5478683	portal,terminase,holin,integrase,transposase,tail,protease,tRNA	Enterobacteria_phage(48.19%)	122	1113597:1113611	1138469:1138483
WP_000569336.1|1027662_1028589_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1028593_1029325_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1029305_1029413_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1029472_1030174_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1030194_1031481_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_032301456.1|1031514_1031757_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	98.8	4.6e-42
WP_000556581.1|1031783_1031918_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_000457728.1|1031921_1032164_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1032251_1032614_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1032610_1032967_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1033300_1033477_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1033478_1034426_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1034422_1034644_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1034742_1035024_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1035034_1035226_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1035198_1035381_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1035380_1036058_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1036054_1036840_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1036845_1037142_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|1037217_1037424_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1037904_1038282_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1038259_1039321_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000858974.1|1039401_1040091_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067457.1|1040195_1040426_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_001182899.1|1040495_1041035_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_000147876.1|1041031_1042051_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.0e-111
WP_162829202.1|1042356_1043570_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000145915.1|1044058_1044361_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070451.1|1044428_1044761_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032102575.1|1044852_1044960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1045017_1046544_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001302427.1|1047008_1047560_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1047569_1048367_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1048483_1048585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054341.1|1048581_1049037_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_000224916.1|1049036_1049207_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|1049199_1049490_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|1049486_1049849_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1049845_1049986_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1050071_1050506_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1050757_1050910_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1051713_1053660_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1053796_1053976_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1054016_1054262_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1054339_1054555_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1054559_1055093_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1055363_1055933_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1055932_1056079_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1056306_1056492_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1057009_1057486_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1057482_1059606_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1059602_1059815_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1059814_1061317_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1061261_1063286_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1063373_1063700_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1063692_1063974_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1063976_1064600_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1064612_1065011_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1065018_1065771_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1065784_1066207_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|1066233_1066542_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918269.1|1066585_1069231_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1069227_1069557_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1069556_1070255_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|1070265_1071009_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1070954_1071584_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000514989.1|1071824_1075298_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001228302.1|1075365_1075965_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000268872.1|1076029_1077343_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.5	2.2e-77
WP_001023381.1|1077344_1077614_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_001261937.1|1077981_1078230_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1078744_1080430_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1080426_1081146_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1081192_1081663_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1081704_1082166_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1082290_1084294_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001301655.1|1084290_1085427_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528952.1|1085419_1086151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1086169_1087699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1087709_1088798_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1090038_1090356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1090417_1094047_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1101004_1103038_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1103169_1104279_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1104540_1104822_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1105113_1105656_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1105743_1106418_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1106433_1108914_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1108924_1109959_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1110040_1110379_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134630.1|1110596_1111442_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1111562_1111835_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1111944_1112259_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1112268_1112616_-	hypothetical protein	NA	NA	NA	NA	NA
1113597:1113611	attL	TTTTTATGATCATAG	NA	NA	NA	NA
WP_000141034.1|1113666_1113906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1114239_1115028_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1115024_1115825_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1115889_1116708_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1116759_1117506_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1117479_1118445_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1118441_1119446_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1119442_1120720_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1120976_1122029_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1122327_1123182_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1123210_1124473_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1124482_1124935_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1124965_1125250_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1125253_1126609_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1126656_1127697_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1127796_1128576_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1128657_1129557_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1129962_1130280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985260.1|1130544_1131558_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1131673_1131973_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1132094_1132370_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1132380_1132551_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|1132547_1133048_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|1133111_1133336_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1133335_1133635_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1133637_1133862_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1133858_1134134_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1134123_1136406_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
1138469:1138483	attR	CTATGATCATAAAAA	NA	NA	NA	NA
>prophage 4
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	1140502	1166724	5478683	portal,terminase,plate,holin,lysis,tail,capsid,head,tRNA	Escherichia_phage(73.53%)	35	NA	NA
WP_000038161.1|1140502_1141537_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1141536_1143309_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1143482_1144337_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1144395_1145469_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1145472_1146216_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1146315_1146825_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1146824_1147028_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1147031_1147313_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1147312_1147810_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1147824_1148250_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1148237_1148663_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1148634_1148808_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1148770_1149238_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001810.1|1149230_1149683_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_001093728.1|1149749_1150385_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1150381_1150729_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1150733_1151642_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1151634_1152246_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217043.1|1152242_1153442_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.5	2.0e-215
WP_001008233.1|1153462_1153906_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|1153877_1154480_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_000983068.1|1154479_1155013_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.3	4.8e-100
WP_000905094.1|1155040_1155634_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286706.1|1155693_1156884_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_001251408.1|1156896_1157415_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1157471_1157747_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1157779_1157899_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1157891_1160339_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1160353_1160833_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1160832_1161996_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1162077_1162296_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1162569_1163931_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001301848.1|1164078_1164411_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1164601_1165324_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1165320_1166724_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	1249948	1390843	5478683	portal,terminase,protease,holin,lysis,transposase,tail,capsid,integrase,head	Stx2-converting_phage(38.58%)	164	1246566:1246580	1350310:1350324
1246566:1246580	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|1249948_1251127_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1251107_1251299_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1251376_1251721_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1251908_1252259_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|1252255_1252612_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1252945_1253122_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289930.1|1253123_1254071_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|1254067_1254289_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1254387_1254669_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548544.1|1254679_1254871_-	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_000682306.1|1254843_1255026_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_001301718.1|1255697_1256483_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	99.6	2.4e-148
WP_000995486.1|1256488_1256785_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|1256859_1257003_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1256971_1257136_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1257208_1257577_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1257759_1258011_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1258069_1258342_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1258319_1258502_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1259070_1259592_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|1260093_1260789_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1260864_1261080_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1261221_1261518_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1261550_1261712_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|1261698_1262520_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|1262516_1263893_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|1263963_1264242_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|1264374_1264590_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1264600_1264837_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1264793_1265240_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1265236_1265764_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1265760_1265943_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208502.1|1266217_1266976_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_000849633.1|1267231_1267912_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_001004016.1|1267986_1268709_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|1268708_1269314_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|1269310_1269982_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|1269972_1270461_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1271110_1272070_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1272081_1272351_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1272647_1272971_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143110.1|1273214_1275152_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.4	0.0e+00
WP_000143458.1|1275288_1275468_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1275508_1275781_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1275857_1276073_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1276072_1276570_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1276566_1277004_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1277206_1277704_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1277700_1277958_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|1278420_1278648_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|1278689_1279055_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958416.1|1279345_1279909_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301438.1|1279905_1281567_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|1281630_1283568_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1283612_1283834_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_001301679.1|1283779_1286281_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	97.2	0.0e+00
WP_000126019.1|1286360_1286687_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1286696_1287047_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573391.1|1287043_1287490_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1287486_1287831_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1287889_1288606_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1288611_1288986_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1289081_1289291_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212920.1|1289342_1292585_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.6	0.0e+00
WP_000807954.1|1292577_1292919_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001302649.1|1293661_1293982_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1294089_1294263_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001414206.1|1294333_1295257_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	99.3	3.2e-176
WP_000967278.1|1295311_1296049_+|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	98.8	3.8e-148
WP_122994717.1|1295994_1296627_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.0	3.1e-106
WP_000514828.1|1296865_1300345_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.0	0.0e+00
WP_001230514.1|1300412_1301012_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268851.1|1301076_1302390_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.1	2.0e-83
WP_001023455.1|1302391_1302661_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000458686.1|1302801_1303677_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	99.7	3.2e-162
WP_001121226.1|1303900_1304551_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|1305872_1307039_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|1307157_1307631_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|1307829_1308888_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|1309059_1309389_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|1309489_1309672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|1310160_1310274_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|1310286_1310481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|1310939_1311308_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|1311381_1311603_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|1311665_1312142_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860080.1|1312156_1312636_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	5.2e-13
WP_001234544.1|1312717_1313539_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|1313759_1314170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|1314185_1314869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|1315004_1316075_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|1316071_1316977_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_061069249.1|1316973_1317828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966626.1|1318109_1320257_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_162829202.1|1320986_1322199_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000998048.1|1323017_1324556_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1324605_1324953_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|1324949_1325330_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000973176.1|1325691_1326237_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|1326233_1326977_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|1326988_1328068_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|1328129_1329065_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|1329520_1330438_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|1330539_1331490_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|1331607_1333251_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|1333876_1334593_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|1334935_1336390_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|1336491_1337808_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|1338121_1339174_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_134793145.1|1339435_1347418_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_001302302.1|1347907_1348705_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|1348940_1349963_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|1349962_1350166_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|1350224_1352696_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
1350310:1350324	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|1352791_1352980_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|1352976_1353165_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|1353645_1353798_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|1354072_1354717_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|1354813_1355041_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|1355037_1355463_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|1355531_1356569_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|1356480_1357023_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|1357057_1357756_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|1357777_1358002_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|1357998_1358355_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|1358387_1358540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|1358536_1358848_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|1358974_1359538_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|1359647_1359752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|1359938_1360151_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|1360318_1360597_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|1360598_1361648_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|1361660_1362020_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|1362016_1362706_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|1363339_1363768_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|1364245_1366096_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|1366177_1367391_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|1367701_1367917_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|1367921_1368266_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|1368316_1368850_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|1369005_1369188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|1369200_1369332_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|1369559_1369745_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|1370271_1370586_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|1370667_1370892_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|1371286_1371796_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|1373680_1373887_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|1373883_1375476_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|1375465_1376971_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|1377007_1377355_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|1377412_1377679_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|1377660_1378401_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|1378414_1378846_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|1378872_1379286_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_061069250.1|1379266_1381846_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000847274.1|1381842_1382172_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|1382171_1382870_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1382880_1383624_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_050546863.1|1383569_1384202_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|1384392_1384920_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_061069251.1|1385053_1388527_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.6	0.0e+00
WP_001230508.1|1388594_1389194_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_061069252.1|1389258_1390572_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	1.8e-76
WP_001023407.1|1390573_1390843_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	1448423	1468409	5478683	integrase,transposase,tail	Enterobacteria_phage(75.0%)	28	1461545:1461558	1471551:1471564
WP_032161583.1|1448423_1449560_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|1449510_1449834_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|1449991_1451176_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|1451175_1451688_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|1451742_1452108_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|1452116_1452272_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|1455074_1455563_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|1455719_1456292_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|1456335_1456866_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|1457957_1458272_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|1458276_1459236_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|1459312_1462135_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
1461545:1461558	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|1462141_1462507_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|1462503_1463121_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|1463132_1463432_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|1463428_1463695_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|1463691_1463895_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|1463918_1464335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|1464427_1464541_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|1464537_1464780_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|1464791_1465070_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|1465080_1465431_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|1465452_1465656_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|1465727_1465865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|1465954_1466359_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|1466374_1467025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|1467054_1467402_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|1467407_1468409_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
1471551:1471564	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	1788954	1898130	5478683	portal,terminase,holin,transposase,tail,capsid,protease,head	Stx2-converting_phage(41.58%)	130	NA	NA
WP_001260835.1|1788954_1789776_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1789875_1789959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|1790051_1790387_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|1790783_1792037_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|1792143_1793037_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|1793171_1794392_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|1794516_1795212_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|1795164_1796457_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|1796614_1797229_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|1797271_1798126_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|1798127_1798745_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|1798755_1801179_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_061069257.1|1801239_1803666_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	7.2e-212
WP_000778147.1|1803864_1804170_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|1804277_1804988_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|1804990_1805551_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|1805585_1805927_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|1806061_1806388_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|1807376_1807628_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001491751.1|1807700_1809041_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	1.8e-58
WP_162829202.1|1809135_1810349_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001090200.1|1811577_1811769_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1811765_1811954_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|1812354_1812519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|1812522_1812741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|1812812_1813112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|1813464_1813743_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|1813744_1813936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|1813956_1814328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|1814425_1814728_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|1814724_1815150_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|1815172_1816135_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|1816141_1816882_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|1817692_1818088_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|1818144_1818729_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|1818844_1818949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|1819137_1819350_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|1819517_1819796_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|1819797_1820847_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|1820859_1821219_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|1821215_1821905_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|1822542_1822971_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|1823449_1825300_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|1825739_1825955_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|1825959_1826304_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|1826354_1826888_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1827158_1827728_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539789.1|1827727_1827844_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	3.4e-11
WP_012816791.1|1828101_1828287_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1828711_1828939_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|1828980_1829346_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958416.1|1829637_1830201_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_001301438.1|1830197_1831859_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_061069258.1|1831922_1833860_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.8	0.0e+00
WP_001063099.1|1833904_1834126_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_064198829.1|1834071_1836573_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.4	0.0e+00
WP_000126019.1|1836652_1836979_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|1836988_1837339_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573391.1|1837335_1837782_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1837778_1838123_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1838188_1838905_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1838919_1839294_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453698.1|1839389_1839599_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_021498526.1|1839651_1842894_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.7	0.0e+00
WP_000807954.1|1842886_1843228_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179509.1|1843227_1843665_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_012779365.1|1843852_1847113_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_001304111.1|1847115_1847331_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|1847398_1847998_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|1848062_1849286_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|1849287_1849557_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|1849670_1850246_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|1850956_1851607_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|1852189_1853728_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1853777_1854125_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|1854121_1854502_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001120551.1|1855464_1855707_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|1856417_1857662_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|1857754_1857943_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|1857939_1858128_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|1858692_1858902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|1858902_1859541_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|1859552_1859705_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|1859997_1860336_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|1860727_1860970_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|1860953_1861379_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|1861447_1862491_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|1862483_1862945_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|1862978_1863695_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|1863727_1864009_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|1864005_1864233_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|1864225_1864537_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|1864664_1864883_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|1864884_1865442_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|1865675_1865888_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|1866007_1866352_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|1866473_1866746_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|1866747_1867797_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|1867809_1868115_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|1868177_1868732_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|1868956_1869154_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|1869289_1870003_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|1870453_1870885_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|1871362_1873213_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|1873651_1873867_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731239.1|1873871_1874279_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.2	1.3e-52
WP_001063023.1|1874822_1875044_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126026.1|1877084_1877411_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	4.5e-53
WP_001007901.1|1877420_1877771_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|1877767_1878214_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1878210_1878555_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1878613_1879330_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1879335_1879710_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1879805_1880015_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212925.1|1880066_1883309_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_000807954.1|1883301_1883643_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179510.1|1883642_1884341_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000194720.1|1884351_1885095_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|1885040_1885673_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000514693.1|1886014_1887583_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.2	1.1e-298
WP_001230508.1|1890160_1890760_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268848.1|1890824_1892138_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	1.4e-81
WP_001023407.1|1892139_1892409_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|1892522_1893098_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001303500.1|1893170_1893800_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|1893881_1894523_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|1894684_1894927_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|1895058_1896342_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|1896430_1897891_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|1897926_1898130_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	2169738	2243375	5478683	portal,terminase,lysis,holin,transposase,tail,capsid,protease,head,integrase	Enterobacteria_phage(32.73%)	84	2185240:2185267	2243512:2243539
WP_000422055.1|2169738_2170788_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2171007_2171766_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2171762_2172353_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2172392_2173265_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2173477_2175061_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2175088_2175709_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2175705_2176587_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2176724_2176769_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2176860_2178423_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2178422_2180018_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2180018_2181380_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2181391_2182585_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2182584_2183391_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2183771_2183951_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2184036_2184537_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2184582_2185089_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2185240:2185267	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001144877.1|2188560_2189151_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2189334_2189982_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2190118_2190265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2190692_2190971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171540.1|2191310_2191691_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2191687_2192035_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2192084_2193623_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2194588_2195158_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2195223_2196135_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2196241_2196364_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2197961_2199287_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2200313_2200583_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216534.1|2200584_2201889_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001228334.1|2202040_2202640_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000514948.1|2202707_2205563_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.8	0.0e+00
WP_122989782.1|2205803_2206433_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_001151105.1|2207132_2207831_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|2207830_2208160_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918257.1|2208156_2210802_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	98.6	0.0e+00
WP_000438877.1|2210845_2211154_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000479043.1|2211180_2211603_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2211616_2212369_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2212376_2212772_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2212768_2213302_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2213316_2213670_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2213681_2214080_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2214121_2215147_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2215202_2215535_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2215544_2216864_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2216844_2218446_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2218442_2218649_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027185.1|2218645_2220571_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000867498.1|2220545_2221091_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2221477_2221702_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2221783_2222098_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001082601.1|2222561_2223029_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_000539792.1|2223036_2223183_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2223182_2223752_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2224022_2224556_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2224606_2224951_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2224955_2225171_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_001415558.1|2226039_2226198_-	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	100.0	3.5e-11
WP_000935548.1|2226937_2227996_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2228146_2228344_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2228585_2229116_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2229124_2229484_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2229496_2230543_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2230544_2230823_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2230892_2231150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2231370_2231583_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2231861_2232620_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2233318_2233483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2233479_2234061_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2234247_2234790_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2234701_2235742_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2235713_2236265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2236248_2236476_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2236552_2236960_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2237223_2237523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2237595_2237814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2237836_2238244_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2238221_2238455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|2238448_2238616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2239013_2239202_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090196.1|2239198_2239390_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2239482_2241954_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2242018_2242267_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2242244_2243375_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2243512:2243539	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 9
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	2290071	2379386	5478683	portal,terminase,lysis,holin,integrase,transposase,tail,capsid,protease,head,tRNA	Enterobacteria_phage(50.0%)	97	2307574:2307589	2373289:2373304
WP_001299679.1|2290071_2291328_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|2291541_2292165_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|2292164_2293016_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|2293166_2294114_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_071802451.1|2294238_2295918_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.8e-23
WP_000823885.1|2295972_2296251_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|2296528_2297113_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|2297229_2298321_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001295616.1|2300433_2301045_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|2301144_2302059_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|2302154_2303891_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|2304279_2305350_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|2305359_2306658_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|2306987_2308520_+	SpoVR family protein	NA	NA	NA	NA	NA
2307574:2307589	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|2308571_2309291_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|2309512_2311054_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|2311199_2311730_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|2311775_2313044_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|2313043_2313463_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|2313835_2314747_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|2314953_2315415_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|2315491_2316151_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|2316222_2316516_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|2316527_2316686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|2316756_2317158_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|2317260_2317629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|2318148_2318844_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|2318867_2319680_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|2319683_2319950_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|2321115_2322329_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|2322502_2323087_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|2323585_2324539_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|2324725_2326210_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998042.1|2326512_2328051_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|2328100_2328448_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|2328444_2328825_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000937476.1|2328900_2329149_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|2329205_2329874_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|2330371_2330554_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|2330632_2331133_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|2331169_2331676_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|2331694_2332585_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|2332704_2333286_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|2333285_2336201_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|2336265_2336865_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|2336931_2340330_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|2340390_2341023_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|2340959_2341703_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|2341708_2342407_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|2342406_2342736_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|2342732_2345282_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|2345274_2345709_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|2345690_2346113_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|2346128_2346869_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|2346876_2347272_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|2347268_2347847_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|2347858_2348212_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|2348223_2348622_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2348663_2349689_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2349744_2350077_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2350086_2351406_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2351386_2352988_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2352984_2353191_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|2353187_2355113_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|2355087_2355633_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|2356021_2356216_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|2356380_2356587_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|2356872_2357283_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|2357574_2357868_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|2357958_2358141_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|2358357_2358834_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|2358820_2359126_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|2359447_2360137_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|2360133_2360274_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|2360270_2360633_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|2360629_2360920_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|2360912_2361083_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|2361082_2361538_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_001302833.1|2363619_2363742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|2363806_2364139_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|2364206_2364509_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|2364505_2365207_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|2366131_2366368_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|2366357_2367500_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|2367613_2368864_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|2369035_2369689_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2369698_2370160_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|2370213_2371320_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|2371355_2371997_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|2372000_2373371_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
2373289:2373304	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|2373539_2374211_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|2374210_2375671_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|2376271_2376553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2376808_2377351_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|2377556_2377970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|2377982_2378318_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|2378330_2379386_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	2385478	2440151	5478683	portal,terminase,holin,tail,capsid,integrase,head	Stx2-converting_phage(30.77%)	67	2407124:2407139	2446894:2446909
WP_000085256.1|2385478_2386708_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|2386956_2388078_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|2388126_2389353_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|2389602_2390739_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|2390722_2391586_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|2391949_2393311_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|2393371_2393647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|2395955_2399357_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|2399947_2402296_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|2402315_2402405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|2402417_2402654_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|2402599_2403337_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|2403390_2404269_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|2404571_2404682_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|2404791_2405046_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|2405062_2405761_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807950.1|2405760_2406102_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212850.1|2406094_2409337_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.7	0.0e+00
2407124:2407139	attL	CAGTTCACCCAGCGCT	NA	NA	NA	NA
WP_001453698.1|2409389_2409599_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000710952.1|2409694_2410069_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|2410083_2410800_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|2410865_2411210_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2411206_2411653_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2411649_2412000_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2412009_2412336_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_064198829.1|2412415_2414917_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.4	0.0e+00
WP_001063099.1|2414862_2415084_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2415128_2417066_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2417129_2418791_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|2418787_2419351_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|2419640_2420006_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|2420047_2420233_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|2420362_2420503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|2420859_2421084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|2421148_2421355_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|2421582_2421729_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2421728_2422298_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|2422568_2423102_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|2423152_2423497_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|2423501_2423717_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|2423792_2424062_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|2424099_2424282_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001265168.1|2425972_2427022_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|2427023_2427302_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|2427469_2427682_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|2427870_2427975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|2428090_2428678_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|2428680_2428872_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|2428873_2429311_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|2429297_2429615_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|2429568_2429886_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|2429875_2430178_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|2430174_2430456_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|2430488_2431205_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|2431238_2431781_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|2431692_2432730_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|2432798_2433224_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|2433207_2433531_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|2433655_2434132_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|2434447_2434600_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|2434714_2435230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|2435362_2435752_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|2435813_2436083_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|2436051_2437170_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580304.1|2437336_2438131_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|2438127_2439174_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|2439329_2440151_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
2446894:2446909	attR	AGCGCTGGGTGAACTG	NA	NA	NA	NA
>prophage 11
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	2701831	2756836	5478683	portal,holin,transposase,tail,capsid,protease,head	Enterobacteria_phage(29.27%)	60	NA	NA
WP_000003653.1|2701831_2702419_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|2702415_2703123_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|2703141_2704935_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001301613.1|2704931_2706050_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|2708322_2708592_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|2708593_2709907_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230514.1|2709971_2710571_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_061069265.1|2710638_2714118_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.7	0.0e+00
WP_097454001.1|2714358_2714988_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_000194801.1|2714933_2715677_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|2715687_2716386_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847274.1|2716385_2716715_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_061069250.1|2716711_2719291_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|2719271_2719685_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|2719711_2720143_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|2720156_2720897_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|2720878_2721145_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|2721202_2721550_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|2721586_2723092_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|2723081_2724674_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|2724670_2724877_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|2727053_2728592_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2728641_2728989_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|2728985_2729366_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000235421.1|2729441_2729717_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|2730467_2730674_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|2730929_2731202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|2731361_2731895_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|2732115_2732229_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|2732450_2732636_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|2733163_2733478_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|2733682_2734896_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|2735071_2736922_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|2737689_2738403_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|2739023_2739842_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|2739993_2740365_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|2740354_2740726_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|2740738_2741788_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|2741789_2742068_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|2742235_2742391_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|2742492_2742630_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|2742995_2743769_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|2744120_2744534_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|2744549_2745320_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788745.1|2745341_2746088_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_001205823.1|2746094_2747186_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|2747264_2747720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|2747926_2748352_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|2748335_2748608_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|2748716_2749118_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|2749145_2749337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|2749336_2749624_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|2749901_2750057_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|2750198_2750588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|2750774_2750960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|2751533_2751722_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|2751718_2751910_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|2752003_2754475_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|2754542_2754785_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000375128.1|2756176_2756836_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
>prophage 12
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	2987758	3025860	5478683	portal,terminase,lysis,holin,tail,protease,integrase	Enterobacteria_phage(50.0%)	49	2987343:2987357	3025934:3025948
2987343:2987357	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|2987758_2988457_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951025.1|2988687_2989569_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_072127173.1|2989738_2989900_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|2990396_2991416_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|2991449_2992430_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|2992606_2992876_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741889.1|2992877_2994194_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001233141.1|2994253_2994853_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|2994923_2998337_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|2998397_2999006_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|2998942_2999686_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|2999691_3000390_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3000399_3000729_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3000728_3003794_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3003765_3004095_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3004103_3004490_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3004550_3005294_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3005304_3005706_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3005702_3006281_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3006292_3006568_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3006560_3006884_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3006970_3008998_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3008942_3009278_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3009399_3010524_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3010451_3010664_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3010660_3012763_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3012762_3013254_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3013928_3014081_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3014068_3014536_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3014532_3015030_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_001303850.1|3015029_3015245_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000499454.1|3015867_3016026_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3016111_3016855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3017038_3017728_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3017742_3017865_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3018202_3019162_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3019373_3020039_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3020035_3020656_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3020648_3020819_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3020815_3020998_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3021695_3022376_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3022372_3022555_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3022527_3022719_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3022729_3023011_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3023109_3023331_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3023541_3024144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3024386_3024554_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3024593_3024812_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3024789_3025860_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3025934:3025948	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	3604829	3661842	5478683	integrase,plate,transposase	Enterobacteria_phage(27.78%)	51	3604400:3604414	3641907:3641921
3604400:3604414	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130488.1|3604829_3606011_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.1	2.3e-142
WP_162829202.1|3606720_3607933_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000246059.1|3608286_3609030_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|3609853_3610627_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|3610684_3611239_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_000788819.1|3613482_3613794_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000185505.1|3613790_3614690_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000251069.1|3614722_3615016_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|3615134_3615335_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|3615435_3616149_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_001303805.1|3616906_3617152_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|3618221_3619475_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|3619486_3620590_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3620877_3621933_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|3621971_3622373_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|3622430_3623675_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3623766_3624225_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|3624485_3625943_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|3625999_3626557_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|3626468_3626735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|3627041_3627494_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|3627503_3627902_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|3627904_3628198_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|3628249_3629305_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|3629375_3630161_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|3630105_3631845_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|3632662_3633436_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|3633621_3633882_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|3633900_3634161_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|3634316_3635057_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|3635027_3635795_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|3635899_3636478_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|3636717_3639162_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|3639204_3639678_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|3639831_3640602_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|3640719_3641892_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|3641972_3642158_+	protein YncO	NA	NA	NA	NA	NA
3641907:3641921	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|3642072_3642336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|3642537_3644298_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|3644300_3645437_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_137097097.1|3646182_3646794_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339419.1|3646862_3648371_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_000995683.1|3648552_3649269_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_032167757.1|3649408_3653641_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103125.1|3653716_3655858_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|3656067_3656586_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|3657282_3657783_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|3657817_3658042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|3658092_3659484_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|3659574_3659988_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|3659991_3661842_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 14
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	4102836	4161847	5478683	protease,transposase	Klosneuvirus(12.5%)	60	NA	NA
WP_001162171.1|4102836_4104189_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4104282_4104834_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4104989_4106363_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4106538_4107537_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4107569_4108565_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4108551_4109574_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000265942.1|4111229_4112186_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4112495_4113026_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4113105_4113456_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4113449_4113701_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4113912_4114254_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4114256_4118036_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4118032_4119766_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4119971_4120610_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4120932_4122276_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4122354_4122561_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175281.1|4122885_4123440_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937659.1|4123502_4124441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4124652_4125393_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4125582_4127526_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4127643_4128024_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4128112_4128973_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4129080_4130046_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4130153_4130816_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4130860_4132273_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4132581_4133202_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4133419_4134058_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4134192_4135401_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4135408_4135840_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4136462_4137257_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4137327_4137777_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4137818_4138046_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4138050_4138365_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4138371_4138767_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4139093_4139369_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4139497_4140184_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949515.1|4140183_4141038_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4141047_4141698_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4141711_4142176_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4142185_4142491_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4142506_4143904_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4144258_4145323_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4145430_4146186_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4146182_4146932_-	esterase	NA	NA	NA	NA	NA
WP_000254630.1|4147113_4147443_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4147591_4147867_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4147983_4149609_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4149692_4150856_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4150858_4151497_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4151506_4151905_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4151922_4152582_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4152632_4153331_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4153349_4153751_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4153877_4154609_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4154789_4157231_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177633.1|4157269_4157695_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4157899_4159198_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4159301_4159499_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4159580_4160585_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4160587_4161847_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 15
NZ_CP014314	Escherichia coli O157:H7 strain JEONG-1266 chromosome, complete genome	5478683	4298727	4313392	5478683	integrase,tail,tRNA	Enterobacteria_phage(43.75%)	19	4294568:4294583	4312097:4312112
4294568:4294583	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|4298727_4300143_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|4300225_4301209_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|4301374_4301617_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543818.1|4301750_4302788_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|4302876_4303974_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|4304035_4304284_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|4304444_4305086_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|4305167_4305797_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|4305869_4306442_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|4306553_4306823_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|4306824_4308138_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|4308202_4308802_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|4310123_4310660_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|4310650_4311001_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|4310997_4311282_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|4311617_4311815_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|4312159_4312441_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
4312097:4312112	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|4312488_4312662_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|4312858_4313392_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP015816	Escherichia coli O157:H7 strain JEONG-1266 plasmid p0157, complete sequence	95910	13295	82754	95910	protease,transposase,integrase	Macacine_betaherpesvirus(22.22%)	55	17052:17065	81743:81756
WP_001358886.1|13295_15992_-|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_000998042.1|16654_18193_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
17052:17065	attL	CGCTGACGTTCAGC	NA	NA	NA	NA
WP_000612591.1|18242_18590_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|18586_18967_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001302181.1|19334_20333_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000550559.1|20406_22128_-	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_000975743.1|22217_23324_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001302199.1|23323_24145_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001034100.1|26323_30226_-|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_001172748.1|31451_31841_-	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_000592771.1|31884_34095_-	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001302179.1|34271_34457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105064.1|35797_36004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421248.1|36098_36374_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001178089.1|36373_36658_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000130945.1|37569_38427_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001370046.1|38419_38494_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083831.1|38729_38984_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000766796.1|39223_39562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302200.1|39599_39809_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_001233856.1|39854_40316_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	9.4e-20
WP_001302189.1|40560_40773_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840472.1|40905_41466_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704522.1|41568_42429_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000205762.1|42487_43234_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_001509912.1|45492_55002_-	toxin B	NA	NA	NA	NA	NA
WP_001453090.1|56781_57213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302184.1|59435_59594_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_162829202.1|60517_61731_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000845908.1|61896_62331_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117168.1|62385_64344_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000005995.1|64409_64643_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000290823.1|64699_65152_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000547965.1|65177_65384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001492078.1|65453_65897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302171.1|65982_66546_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_000199442.1|66592_67954_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|68005_68236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303399.1|68723_69113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027495.1|69231_69423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271685.1|69419_69842_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_010891293.1|69888_70191_-	antirestriction protein	NA	NA	NA	NA	NA
WP_001310284.1|70286_70859_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_001358893.1|71553_72108_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104869.1|72001_72223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|72223_72907_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_010891292.1|72983_73289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000273919.1|73292_74195_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817031.1|74889_75861_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000772446.1|75860_77027_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852148.1|77614_78370_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_162829202.1|78445_79658_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000016989.1|80381_81188_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_027868286.1|81188_81488_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_162829348.1|81541_82754_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
81743:81756	attR	GCTGAACGTCAGCG	NA	NA	NA	NA
