The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	1946934	1964726	6547320	tail	Burkholderia_virus(25.0%)	18	NA	NA
WP_054414597.1|1946934_1948404_+	DUF1254 domain-containing protein	NA	M1IA53	Paramecium_bursaria_Chlorella_virus	33.5	2.8e-57
WP_054414600.1|1948498_1949197_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054415419.1|1949494_1950064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049076510.1|1950315_1950783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054414602.1|1950788_1951262_+|tail	phage tail protein	tail	A4JX08	Burkholderia_virus	44.4	2.4e-26
WP_054414604.1|1951261_1951552_+	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	48.8	9.1e-13
WP_054414606.1|1951609_1952911_+|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	29.7	2.2e-13
WP_054414608.1|1952913_1953252_+|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	49.1	3.1e-28
WP_054414610.1|1953256_1955899_+|tail	tail fiber domain-containing protein	tail	A0A0B5A596	Achromobacter_phage	26.7	6.4e-36
WP_054414612.1|1955901_1956630_+|tail	phage minor tail protein L	tail	A0A2R3UA90	Siphoviridae_environmental_samples	51.0	3.0e-68
WP_054414614.1|1956632_1957412_+	C40 family peptidase	NA	A4JX14	Burkholderia_virus	50.2	1.9e-65
WP_049076500.1|1957408_1958014_+|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	55.7	9.4e-52
WP_054414616.1|1958010_1961634_+	host specificity protein J	NA	A0A2R3UA88	Siphoviridae_environmental_samples	45.3	1.3e-268
WP_144419173.1|1961638_1962004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054414618.1|1961984_1962200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054495517.1|1962196_1962793_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	53.3	8.6e-50
WP_054495519.1|1962922_1963852_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054414621.1|1963907_1964726_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	49.3	4.1e-10
>prophage 2
NZ_CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	1998723	2009668	6547320		Pseudomonas_phage(22.22%)	16	NA	NA
WP_104010566.1|1998723_1999425_-	site-specific DNA-methyltransferase	NA	B4UTY5	Rhizobium_phage	38.8	1.1e-32
WP_104010567.1|1999414_2000344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104010568.1|2000340_2000862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146074686.1|2000864_2001362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104010570.1|2001524_2002121_-	hypothetical protein	NA	A0A0F6SIL9	Sinorhizobium_phage	58.6	1.1e-63
WP_104010571.1|2002147_2002660_-	single-stranded DNA-binding protein	NA	I6NRL7	Burkholderia_virus	58.7	7.0e-40
WP_104010572.1|2002659_2003331_-	hypothetical protein	NA	A0A0M3LP90	Mannheimia_phage	37.3	9.1e-32
WP_104010573.1|2003323_2004157_-	hypothetical protein	NA	E5DV80	Deep-sea_thermophilic_phage	30.5	6.3e-14
WP_104010574.1|2004167_2004659_-	HNH endonuclease	NA	A5H1K2	Xanthomonas_virus	45.2	1.5e-28
WP_104010575.1|2004666_2005767_-	hypothetical protein	NA	Q9MC69	Pseudomonas_phage	48.2	9.1e-37
WP_104010576.1|2005771_2005951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104010577.1|2006018_2006381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104010578.1|2006383_2006683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104010579.1|2006724_2007753_-	pentapeptide repeat-containing protein	NA	A0A221SAP8	Ralstonia_phage	54.8	1.5e-17
WP_104010580.1|2007946_2008708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010581.1|2008720_2009668_-	phage repressor protein	NA	A0A1C6ZDG7	Pseudomonas_phage	27.3	2.4e-09
>prophage 3
NZ_CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	2016586	2043123	6547320	tail,capsid,integrase,plate,head	Burkholderia_phage(38.46%)	33	2039134:2039147	2045902:2045915
WP_104010591.1|2016586_2017102_+	Rha family transcriptional regulator	NA	A0A0P0ZFJ1	Escherichia_phage	40.7	5.4e-16
WP_104010592.1|2017549_2018203_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	40.9	1.4e-29
WP_104010593.1|2018202_2019798_+	TerL protein	NA	A9YWZ6	Burkholderia_phage	76.6	3.7e-249
WP_104010594.1|2019806_2021258_+	DUF1073 domain-containing protein	NA	A0A0P0I486	Acinetobacter_phage	58.5	1.1e-146
WP_104010595.1|2021148_2021988_+|capsid	minor capsid protein	capsid	A9YWZ8	Burkholderia_phage	54.6	4.4e-68
WP_104010596.1|2022008_2023301_+	DUF2213 domain-containing protein	NA	A0A0P0IRE1	Acinetobacter_phage	45.9	1.5e-78
WP_104010597.1|2023310_2023799_+	hypothetical protein	NA	A0A0P0I8F3	Acinetobacter_phage	51.9	2.4e-34
WP_104010598.1|2023859_2024882_+	DUF2184 domain-containing protein	NA	A0A0N7IRF2	Acinetobacter_phage	68.5	2.5e-129
WP_104010599.1|2024892_2025291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010600.1|2025300_2025684_+	DUF4054 domain-containing protein	NA	A9YX25	Burkholderia_phage	59.8	2.7e-36
WP_104010601.1|2026169_2026550_+|head,tail	head-tail adaptor	head,tail	A0A2H4J1A4	uncultured_Caudovirales_phage	56.9	4.8e-30
WP_104010602.1|2026542_2027130_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	56.0	2.0e-51
WP_104010603.1|2027194_2028676_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	51.4	5.9e-132
WP_054475565.1|2028691_2029135_+	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	60.3	7.9e-40
WP_104010604.1|2029134_2029533_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	32.9	3.8e-09
WP_104010605.1|2029728_2031546_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	33.1	1.1e-84
WP_104010606.1|2031542_2032115_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	40.5	1.6e-29
WP_104010607.1|2032111_2032417_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	43.6	3.4e-18
WP_104010608.1|2032420_2033344_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	50.9	7.5e-69
WP_104010609.1|2033336_2034083_+	translation initiation factor IF-2	NA	A9YX06	Burkholderia_phage	59.3	4.2e-78
WP_104010610.1|2034091_2034445_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	61.5	4.8e-32
WP_104010611.1|2034441_2035623_+|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	65.1	2.0e-130
WP_104010612.1|2035624_2036293_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	65.4	2.4e-77
WP_104010613.1|2036302_2036974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_185762524.1|2036970_2037402_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	36.7	1.4e-17
WP_185762525.1|2037391_2038498_-	acyltransferase	NA	A0A2H4IZR3	uncultured_Caudovirales_phage	26.5	1.9e-18
WP_104010615.1|2038617_2038926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010616.1|2038927_2039206_+	hypothetical protein	NA	NA	NA	NA	NA
2039134:2039147	attL	CGCGCTGGCCGCGT	NA	NA	NA	NA
WP_104010617.1|2039202_2039694_+	hypothetical protein	NA	I6NSS1	Burkholderia_phage	61.1	5.3e-45
WP_185762526.1|2039690_2040086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010618.1|2040182_2040401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104010619.1|2040403_2041387_-|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	41.3	5.4e-65
WP_146074691.1|2041746_2043123_+|integrase	integrase	integrase	NA	NA	NA	NA
2045902:2045915	attR	ACGCGGCCAGCGCG	NA	NA	NA	NA
>prophage 4
NZ_CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	2885128	2939281	6547320	transposase,portal,plate,tail,capsid,holin,integrase,terminase,tRNA,head	uncultured_Caudovirales_phage(20.69%)	58	2889997:2890016	2920831:2920850
WP_054417190.1|2885128_2885617_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_054417191.1|2885826_2886405_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_049075429.1|2886566_2887595_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	1.0e-34
WP_049075427.1|2887839_2888229_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_026383152.1|2888353_2889151_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
2889997:2890016	attL	TTAACTACGGCGAGACGGGC	NA	NA	NA	NA
WP_104010684.1|2890180_2891209_+|integrase	site-specific integrase	integrase	A0A2D1GMX8	Marinobacter_phage	39.1	4.3e-57
WP_083827922.1|2891205_2891424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173361348.1|2891482_2893312_-	DNA cytosine methyltransferase	NA	L7TH64	Pseudomonas_virus	53.9	3.6e-179
WP_054448001.1|2893311_2893581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104011024.1|2893577_2896253_-	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	53.4	3.8e-270
WP_054479074.1|2896282_2896516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146074700.1|2896602_2896992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104010687.1|2896981_2897263_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_146074743.1|2897553_2897958_+	helix-turn-helix domain-containing protein	NA	A4JWR8	Burkholderia_virus	44.1	4.8e-12
WP_146074701.1|2898016_2898301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010689.1|2898431_2898722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010690.1|2898733_2899819_-	late control protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	49.8	6.8e-85
WP_104010691.1|2899818_2900274_-|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	52.8	2.1e-32
WP_104010692.1|2900286_2903025_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	42.2	1.7e-169
WP_081322395.1|2903028_2903145_-|tail	GpE family phage tail protein	tail	E5FFG6	Burkholderia_phage	75.8	3.0e-07
WP_104010693.1|2903153_2903513_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	42.9	1.6e-14
WP_058664993.1|2903534_2904050_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	54.1	3.8e-46
WP_104010694.1|2904107_2905289_-|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	65.2	1.4e-147
WP_146074702.1|2905409_2905904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104010696.1|2905908_2907255_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	62.0	5.7e-49
WP_104010697.1|2907251_2907890_-|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	56.4	1.3e-51
WP_104010698.1|2907873_2908791_-|plate	baseplate J/gp47 family protein	plate	A0A077K9X9	Ralstonia_phage	55.6	9.8e-77
WP_068980947.1|2908792_2909134_-	GPW/gp25 family protein	NA	E5E3V5	Burkholderia_phage	53.2	1.4e-17
WP_104010699.1|2909145_2909781_-|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	51.2	6.0e-49
WP_104010700.1|2909842_2910304_-	phage virion morphogenesis protein	NA	Q6K1H7	Salmonella_virus	50.0	4.2e-28
WP_104010701.1|2910296_2910800_-|tail	phage tail protein	tail	E5E3R4	Burkholderia_phage	50.0	8.1e-25
WP_063569185.1|2910898_2911321_-	hypothetical protein	NA	Q9ZXL5	Pseudomonas_virus	31.5	3.6e-10
WP_104010702.1|2911317_2912127_-	N-acetylmuramidase family protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	57.0	1.9e-76
WP_063569183.1|2912119_2912419_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_006390739.1|2912415_2912778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006390738.1|2912783_2912990_-|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	59.1	1.1e-15
WP_068953600.1|2912989_2913460_-|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	53.5	1.6e-35
WP_104010703.1|2913552_2914248_-	hypothetical protein	NA	A0A2H4J948	uncultured_Caudovirales_phage	40.9	7.5e-37
WP_068953596.1|2914250_2915258_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	61.2	1.2e-115
WP_068953593.1|2915302_2916166_-|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	46.2	9.3e-53
WP_104010704.1|2916306_2918061_+|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	67.5	1.5e-230
WP_104010705.1|2918057_2919083_+|portal	phage portal protein	portal	A4JWV0	Burkholderia_virus	62.4	1.4e-127
WP_146074703.1|2919165_2919453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054417193.1|2921064_2921829_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
2920831:2920850	attR	TTAACTACGGCGAGACGGGC	NA	NA	NA	NA
WP_054417194.1|2921825_2923448_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_054417195.1|2923444_2924395_+	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_054417220.1|2924483_2925017_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054417196.1|2925107_2925842_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_054417197.1|2925838_2927035_+	CoA transferase	NA	NA	NA	NA	NA
WP_054417198.1|2927106_2928078_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_049075417.1|2928231_2928486_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054417199.1|2928485_2928911_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_054417200.1|2928992_2929946_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_054417201.1|2930158_2931358_+	MFS transporter	NA	NA	NA	NA	NA
WP_167352779.1|2931374_2931536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054495639.1|2931620_2934284_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_054417202.1|2934287_2937845_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_104010707.1|2938150_2939281_+|transposase	IS481 family transposase	transposase	S5WIU1	Leptospira_phage	32.2	3.8e-14
>prophage 5
NZ_CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	3146439	3175048	6547320	capsid,tail,terminase	Pseudomonas_phage(45.83%)	37	NA	NA
WP_104010730.1|3146439_3147294_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	52.3	3.1e-77
WP_104010731.1|3147290_3148454_+	YdaU family protein	NA	H2BD69	Pseudomonas_phage	49.2	3.2e-40
WP_104010732.1|3148450_3148675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010733.1|3148671_3149169_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	51.3	1.4e-29
WP_104010734.1|3149158_3149788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146074706.1|3149829_3150489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104010735.1|3150648_3151440_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	78.2	4.4e-126
WP_104010736.1|3151449_3152058_+	hypothetical protein	NA	A0A125RNL5	Pseudomonas_phage	61.1	1.2e-67
WP_104011029.1|3152054_3152495_-	DUF4145 domain-containing protein	NA	M1PSB6	Streptococcus_phage	47.8	9.6e-30
WP_104010737.1|3152777_3153251_+	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	59.6	5.1e-37
WP_185762533.1|3153201_3154785_+|terminase	phage terminase large subunit	terminase	A0A291LBL3	Klebsiella_phage	47.5	1.6e-111
WP_104011030.1|3156103_3156847_+|capsid	minor capsid protein	capsid	I3PGT9	Xanthomonas_phage	39.4	7.5e-35
WP_104010739.1|3156857_3157940_+	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	40.1	8.0e-54
WP_104010740.1|3157939_3158395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010741.1|3158458_3159418_+	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	37.7	5.3e-57
WP_104010742.1|3159417_3159780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010743.1|3159782_3160157_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_104010744.1|3160146_3160599_+	hypothetical protein	NA	A0A2I7R2V2	Vibrio_phage	33.1	1.4e-07
WP_104010745.1|3160602_3160971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104011031.1|3161143_3161668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010746.1|3161813_3162311_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	41.1	5.7e-23
WP_104010747.1|3162378_3163737_+	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	40.0	5.7e-81
WP_104010748.1|3163747_3164176_+	DUF3277 family protein	NA	NA	NA	NA	NA
WP_104010749.1|3164175_3164661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010750.1|3164803_3167107_+	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	29.3	1.4e-23
WP_104010751.1|3167118_3167724_+	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	26.4	2.0e-06
WP_104010752.1|3167720_3168053_+	hypothetical protein	NA	A0A0N9SG14	Pseudomonas_phage	38.7	2.7e-13
WP_104010753.1|3168039_3168957_+	hypothetical protein	NA	E5AGC0	Erwinia_phage	32.9	9.6e-40
WP_104010754.1|3168953_3169655_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	28.8	3.1e-14
WP_104010755.1|3169654_3170023_+	hypothetical protein	NA	A0A2K9V3L8	Faecalibacterium_phage	38.0	4.9e-11
WP_104010756.1|3170048_3171500_+	hypothetical protein	NA	A0A0N9SH53	Pseudomonas_phage	37.7	1.0e-75
WP_104010757.1|3171499_3172165_+	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	36.2	7.2e-29
WP_104010758.1|3172165_3173452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010759.1|3173464_3173887_+|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	43.6	1.4e-25
WP_104010760.1|3173932_3174241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010761.1|3174242_3174521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104010762.1|3174517_3175048_+	hypothetical protein	NA	C8ZKR3	Pseudomonas_phage	48.1	1.0e-30
>prophage 6
NZ_CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	4720090	4727958	6547320	tRNA	Moraxella_phage(33.33%)	9	NA	NA
WP_054417513.1|4720090_4720678_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.6	1.2e-19
WP_049073455.1|4720710_4721085_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	26.8	7.1e-10
WP_049073456.1|4721276_4722299_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054417514.1|4722624_4722981_+	VOC family protein	NA	NA	NA	NA	NA
WP_049073458.1|4723065_4724358_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	7.1e-65
WP_054417515.1|4724466_4725498_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.4	7.1e-92
WP_049073460.1|4725570_4726212_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_049073461.1|4726390_4727149_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	1.2e-67
WP_171905038.1|4727193_4727958_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.8	3.6e-32
>prophage 7
NZ_CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	5936502	5969328	6547320	capsid,terminase,holin,integrase,tRNA	Pseudomonas_phage(28.57%)	41	5930926:5930942	5962811:5962827
5930926:5930942	attL	GCGCCAGCCTGGCCGGC	NA	NA	NA	NA
WP_054518880.1|5936502_5936994_-	hypothetical protein	NA	I6NSS1	Burkholderia_phage	58.6	2.2e-43
WP_054508221.1|5936993_5937293_-|holin	phage holin family protein	holin	E5E3W3	Burkholderia_phage	40.7	6.3e-09
WP_054508222.1|5937294_5937639_-	hypothetical protein	NA	A4JWU2	Burkholderia_virus	57.9	1.5e-22
WP_054482832.1|5937727_5938750_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	32.3	8.2e-24
WP_054518879.1|5938752_5939109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054518878.1|5940357_5941692_-	hypothetical protein	NA	A0A0A8J8U5	Ralstonia_phage	35.3	3.8e-29
WP_054518877.1|5941691_5942357_-	DUF2612 domain-containing protein	NA	A0A0N9SSD8	Pseudomonas_phage	36.8	1.7e-30
WP_054518876.1|5942356_5943808_-	hypothetical protein	NA	A0A0N9SH53	Pseudomonas_phage	37.1	5.3e-77
WP_054432394.1|5943832_5944201_-	hypothetical protein	NA	A0A0N7GFC5	Pseudomonas_phage	45.5	2.7e-17
WP_054518875.1|5944200_5944899_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	31.1	1.3e-12
WP_054518874.1|5944895_5945813_-	hypothetical protein	NA	E5AGC0	Erwinia_phage	30.9	1.3e-36
WP_054518873.1|5945799_5946132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054432397.1|5946128_5946749_-	hypothetical protein	NA	I3PGV3	Xanthomonas_phage	29.4	3.2e-07
WP_054518872.1|5946757_5949229_-	tape measure protein	NA	A0A0P0ZCJ4	Stx2-converting_phage	29.1	1.5e-23
WP_054518871.1|5949374_5949854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054432400.1|5949853_5950282_-	DUF3277 family protein	NA	A0A2H4P8K8	Pseudomonas_phage	31.0	2.1e-13
WP_054518870.1|5950297_5951656_-	DUF3383 family protein	NA	A0A0N9SJA3	Pseudomonas_phage	39.7	5.7e-81
WP_054418237.1|5951722_5952247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104010950.1|5952372_5952786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054418242.1|5952790_5953243_-	hypothetical protein	NA	E5AGB1	Erwinia_phage	35.4	1.6e-08
WP_054418244.1|5953220_5953607_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_054418246.1|5953609_5953993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054461068.1|5953992_5954952_-	DUF2184 domain-containing protein	NA	A0A0N9SG07	Pseudomonas_phage	38.8	3.7e-58
WP_054418250.1|5955013_5955469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054418252.1|5955468_5956551_-	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	39.2	1.2e-54
WP_054418254.1|5956560_5957400_-|capsid	minor capsid protein	capsid	I3PGT9	Xanthomonas_phage	36.5	4.5e-36
WP_054418256.1|5957341_5958622_-	DUF1073 domain-containing protein	NA	A0A2H4PGN2	Escherichia_phage	30.4	5.4e-33
WP_054518868.1|5958621_5960205_-|terminase	phage terminase large subunit	terminase	A0A291LBL3	Klebsiella_phage	47.7	1.0e-110
WP_054418260.1|5960155_5960629_-	DUF2280 domain-containing protein	NA	A0A125RNL6	Pseudomonas_phage	55.9	3.1e-34
WP_181952972.1|5960650_5961208_-	hypothetical protein	NA	A0A1B0VRJ1	Pseudomonas_phage	65.2	1.8e-65
WP_054418263.1|5961301_5961922_-|tRNA	methionyl-tRNA formyltransferase	tRNA	A4JWM2	Burkholderia_virus	65.8	1.2e-73
WP_054518867.1|5961912_5963034_-	ABC transporter ATP-binding protein	NA	A4JWM1	Burkholderia_virus	76.6	5.6e-167
5962811:5962827	attR	GCCGGCCAGGCTGGCGC	NA	NA	NA	NA
WP_165601359.1|5963030_5963207_-	hypothetical protein	NA	A4JWM0	Burkholderia_virus	57.8	1.3e-09
WP_082381503.1|5963166_5963391_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_146074736.1|5963671_5963989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054461089.1|5964030_5964660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054518866.1|5964649_5965144_-	RusA family crossover junction endodeoxyribonuclease	NA	A9YWY9	Burkholderia_phage	52.0	6.3e-30
WP_054518865.1|5965140_5965371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054518864.1|5965367_5966447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104011084.1|5966443_5967295_-	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	52.7	1.5e-76
WP_054518862.1|5967294_5969328_-	DNA cytosine methyltransferase	NA	L7TH64	Pseudomonas_virus	51.1	2.8e-164
>prophage 8
NZ_CP014065	Achromobacter xylosoxidans strain FDAARGOS_162 chromosome, complete genome	6547320	5987501	5999938	6547320	tail	Burkholderia_phage(40.0%)	17	NA	NA
WP_054417652.1|5987501_5988032_-	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	54.9	3.2e-40
WP_049072550.1|5988021_5988483_-	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	36.5	1.3e-13
WP_063589448.1|5988674_5989124_-|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	61.8	8.3e-13
WP_054417651.1|5989135_5990167_-|tail	tail fiber protein	tail	A0A1W6JT73	Escherichia_phage	38.5	5.9e-14
WP_054417650.1|5990181_5990847_-	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	59.7	1.1e-72
WP_054417649.1|5990848_5992030_-	hypothetical protein	NA	A9YX12	Burkholderia_phage	63.4	3.1e-131
WP_054417648.1|5992026_5992380_-	hypothetical protein	NA	A9YX11	Burkholderia_phage	65.0	1.3e-34
WP_054417647.1|5992388_5993132_-	hypothetical protein	NA	A9YX06	Burkholderia_phage	63.5	6.7e-84
WP_054417675.1|5993166_5994177_-	hypothetical protein	NA	A9YX04	Burkholderia_phage	51.3	4.8e-77
WP_049072539.1|5994196_5994496_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	44.0	4.1e-16
WP_054417646.1|5994505_5995105_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	34.3	2.5e-20
WP_054417645.1|5995097_5996774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006393814.1|5996766_5996925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104010956.1|5996951_5997401_-	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	36.5	2.9e-18
WP_006388470.1|5997404_5997845_-	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	54.1	3.1e-36
WP_054417643.1|5997858_5999334_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	48.5	3.6e-113
WP_049072533.1|5999344_5999938_-	hypothetical protein	NA	A9YX29	Burkholderia_phage	47.2	2.6e-46
