The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014026	Morganella morganii strain FDAARGOS_172 chromosome, complete genome	3908080	405875	413930	3908080	tRNA	Mycobacterium_phage(33.33%)	8	NA	NA
WP_004235572.1|405875_407081_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.5	5.5e-27
WP_004235573.1|407686_408649_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	73.4	2.2e-135
WP_004235574.1|408673_410794_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	52.6	3.6e-207
WP_004235579.1|410824_411241_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	40.4	1.4e-11
WP_004235580.1|411262_411481_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	51.4	2.3e-16
WP_004235581.1|411789_412872_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004235582.1|413053_413521_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004235583.1|413720_413930_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	4.5e-22
>prophage 2
NZ_CP014026	Morganella morganii strain FDAARGOS_172 chromosome, complete genome	3908080	598267	608110	3908080	tRNA,protease	Planktothrix_phage(16.67%)	8	NA	NA
WP_004235797.1|598267_600214_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.9	1.2e-36
WP_004235798.1|600300_600531_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	56.7	2.6e-15
WP_015422570.1|600789_601110_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	46.7	2.6e-16
WP_004235801.1|601143_603429_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	43.5	2.8e-173
WP_002211347.1|603505_603724_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004235802.1|603874_604594_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004235803.1|604571_606338_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.9	5.8e-17
WP_015422571.1|606340_608110_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.6	2.2e-24
>prophage 3
NZ_CP014026	Morganella morganii strain FDAARGOS_172 chromosome, complete genome	3908080	776858	854665	3908080	terminase,tail,tRNA,protease,portal,lysis,plate,holin	Enterobacteria_phage(31.43%)	74	NA	NA
WP_061057308.1|776858_777539_-	hypothetical protein	NA	U5P0T5	Shigella_phage	43.7	1.2e-44
WP_061057309.1|777823_778771_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	50.5	1.0e-92
WP_061057310.1|778770_779529_+	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	44.9	8.7e-55
WP_105212817.1|779591_780158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081093762.1|780419_781430_+	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	71.6	1.5e-142
WP_061057313.1|781430_781850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071888181.1|781956_782148_+|holin	phage holin family protein	holin	A0A1W6JNY9	Morganella_phage	69.4	2.8e-18
WP_081093763.1|782206_782614_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	85.0	2.7e-63
WP_168731325.1|782595_782754_+	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	83.3	1.0e-05
WP_061057315.1|782750_783203_+|lysis	lysis protein	lysis	A0A1W6JP00	Morganella_phage	43.2	1.3e-13
WP_125460922.1|783251_783734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057316.1|784227_784731_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	54.3	8.1e-41
WP_061057317.1|784727_786842_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	1.3e-294
WP_004242389.1|786838_787057_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	58.6	1.1e-15
WP_061057318.1|787053_788529_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	66.6	4.9e-187
WP_061057319.1|788500_790537_+|protease	Clp protease ClpP	protease	K7PKX4	Enterobacterial_phage	65.1	2.4e-253
WP_061057321.1|790867_794692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057322.1|794872_795178_-	putative addiction module antidote protein	NA	NA	NA	NA	NA
WP_061057629.1|795181_795499_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	45.0	6.5e-12
WP_061057323.1|795996_796278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057324.1|796270_796453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057325.1|796758_797079_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_061057326.1|797247_797508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057327.1|797650_797896_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_061057328.1|797892_798249_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q708N9	Streptococcus_phage	55.8	1.9e-12
WP_061057630.1|798375_798723_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	50.0	7.8e-19
WP_071888183.1|798715_798994_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	43.7	7.9e-14
WP_061057330.1|798995_799559_+|tail	phage tail protein	tail	K7PMB7	Enterobacterial_phage	54.0	1.0e-44
WP_061057331.1|799555_799954_+|tail	phage tail protein	tail	K7PHM6	Enterobacterial_phage	61.7	1.7e-41
WP_081093764.1|799963_800491_+|tail	phage tail protein	tail	M9NYX0	Enterobacteria_phage	76.2	4.9e-65
WP_061057332.1|800494_800893_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	35.0	1.4e-08
WP_061057333.1|800916_801243_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	49.5	1.7e-20
WP_061057334.1|801205_804130_+|tail	phage tail tape measure protein	tail	E4WL33	Enterobacteria_phage	30.7	1.3e-103
WP_061057335.1|804132_804462_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	50.0	2.4e-25
WP_061057336.1|804627_805368_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_061057337.1|805651_806467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057631.1|806741_807437_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	50.0	2.0e-61
WP_061057338.1|807451_808180_+	C40 family peptidase	NA	S5MQI8	Escherichia_phage	64.0	4.0e-89
WP_061057339.1|808083_808728_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	44.0	3.4e-44
WP_061057340.1|808739_812183_+	DUF1983 domain-containing protein	NA	A0A0P0ZEQ8	Stx2-converting_phage	49.1	6.0e-252
WP_061057341.1|812179_812503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057342.1|812505_813174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057343.1|813288_816153_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_061057344.1|816182_816632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004236979.1|817140_817560_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_004236978.1|817604_817985_-	VOC family protein	NA	NA	NA	NA	NA
WP_004236976.1|818546_818885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004236975.1|819032_819575_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004241939.1|819681_820581_+	DMT family transporter	NA	NA	NA	NA	NA
WP_004236972.1|821197_821410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004236969.1|822810_823824_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004241949.1|823941_824148_+	ParD-like family protein	NA	NA	NA	NA	NA
WP_004236966.1|824140_824917_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_004236965.1|824985_825579_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061057345.1|825723_827202_+	MFS transporter	NA	S4TR35	Salmonella_phage	25.1	6.1e-12
WP_004236962.1|827300_827939_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004236960.1|828046_828532_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_004236959.1|828532_829972_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_015422608.1|830233_834121_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.5	6.5e-130
WP_004236956.1|834494_836846_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_004236954.1|836896_838582_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_061057346.1|838578_841377_+	insulinase family protein	NA	M1NN74	Moumouvirus	26.2	1.8e-12
WP_004236952.1|841380_842094_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_004236951.1|842726_844157_+	sensory histidine kinase	NA	W8CYF6	Bacillus_phage	28.1	3.8e-19
WP_015422610.1|844178_844973_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_004236949.1|844980_846321_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	35.2	8.0e-11
WP_004236948.1|846428_848051_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.9	5.2e-89
WP_004236946.1|848063_848402_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_015422611.1|848496_848766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004236944.1|848911_850093_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_004236943.1|850463_851717_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.8	6.6e-100
WP_004236942.1|851797_852949_+	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_004236941.1|853004_853808_-	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_004236940.1|853927_854665_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP014026	Morganella morganii strain FDAARGOS_172 chromosome, complete genome	3908080	1029029	1053226	3908080	holin,integrase	Morganella_phage(72.0%)	34	1026306:1026320	1047701:1047715
1026306:1026320	attL	CATCATTGAAATTAT	NA	NA	NA	NA
WP_061057357.1|1029029_1030181_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	66.3	1.6e-148
WP_061057359.1|1030615_1031215_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	61.6	3.1e-63
WP_061057360.1|1031394_1031751_-	DUF2591 family protein	NA	E9NID9	Enterobacter_phage	47.2	2.3e-18
WP_061057361.1|1032114_1032480_-	hypothetical protein	NA	Q76H37	Enterobacteria_phage	46.6	2.4e-18
WP_061057362.1|1032472_1032754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057363.1|1032772_1033057_-	hypothetical protein	NA	A0A1P8DTG9	Proteus_phage	63.4	1.5e-28
WP_192575764.1|1033059_1034040_-	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	63.8	2.2e-119
WP_061057365.1|1034093_1034558_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	68.2	3.8e-53
WP_061057366.1|1034558_1035173_-	ERF family protein	NA	A0A1W6JP21	Morganella_phage	96.6	2.3e-106
WP_015422640.1|1035175_1035538_-	hypothetical protein	NA	A0A1W6JNZ2	Morganella_phage	85.8	6.4e-56
WP_004240098.1|1035695_1035872_-	hypothetical protein	NA	A0A1W6JNY7	Morganella_phage	100.0	6.3e-25
WP_049240425.1|1036626_1036908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004240099.1|1037262_1037472_+	hypothetical protein	NA	A0A1W6JP23	Morganella_phage	100.0	5.9e-30
WP_061057632.1|1037500_1037809_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	98.0	1.1e-48
WP_061057367.1|1038169_1039051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057368.1|1039037_1039799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057369.1|1039862_1040204_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	98.2	3.1e-60
WP_036414490.1|1040242_1040890_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNY2	Morganella_phage	100.0	4.0e-117
WP_061057370.1|1040989_1041199_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW6	Morganella_phage	91.3	1.6e-14
WP_061057371.1|1041329_1041656_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	98.1	1.0e-52
WP_061057633.1|1041797_1042589_+	replication protein	NA	A0A1W6JNY0	Morganella_phage	98.9	1.3e-133
WP_061057372.1|1042588_1043317_+	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	99.6	5.8e-133
WP_024473812.1|1044636_1045080_-	universal stress protein	NA	NA	NA	NA	NA
WP_036420965.1|1045189_1045819_+	recombination protein NinG	NA	A0A1W6JNX3	Morganella_phage	97.1	2.7e-102
WP_036424737.1|1046108_1046546_+	antitermination protein	NA	A0A1W6JNX1	Morganella_phage	97.2	9.4e-78
WP_004242341.1|1046921_1047134_+	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	100.0	2.0e-33
WP_004242343.1|1047360_1048290_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	98.5	1.4e-147
1047701:1047715	attR	ATAATTTCAATGATG	NA	NA	NA	NA
WP_081093765.1|1048361_1049123_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_036414577.1|1049451_1049892_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	54.0	4.0e-28
WP_004242347.1|1050198_1050657_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_036418457.1|1051235_1051475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057376.1|1051982_1052258_-	DUF4282 domain-containing protein	NA	NA	NA	NA	NA
WP_036418393.1|1052565_1052757_+|holin	phage holin family protein	holin	A0A1W6JNY9	Morganella_phage	88.9	8.6e-28
WP_061057377.1|1052749_1053226_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	91.7	1.3e-80
>prophage 5
NZ_CP014026	Morganella morganii strain FDAARGOS_172 chromosome, complete genome	3908080	1069470	1080482	3908080	plate,tail	Burkholderia_phage(22.22%)	12	NA	NA
WP_004237450.1|1069470_1070958_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.3	9.6e-82
WP_004237449.1|1070973_1071426_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	37.8	8.3e-21
WP_004237448.1|1071467_1071926_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	49.3	1.3e-26
WP_004237447.1|1072008_1073979_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	22.6	4.9e-17
WP_004237446.1|1073975_1074515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237445.1|1074511_1074805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237444.1|1074797_1075613_+	hypothetical protein	NA	B5M9T8	Pseudomonas_phage	27.5	2.9e-16
WP_004237442.1|1075629_1076322_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	42.0	4.8e-36
WP_004237440.1|1076318_1076663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237439.1|1076655_1077843_+|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	38.9	2.4e-75
WP_004237438.1|1077839_1078502_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	38.3	7.1e-37
WP_061057383.1|1079855_1080482_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	33.0	9.1e-26
>prophage 6
NZ_CP014026	Morganella morganii strain FDAARGOS_172 chromosome, complete genome	3908080	1551967	1634161	3908080	head,tail,tRNA,terminase,integrase,portal,plate,holin,capsid	Morganella_phage(15.56%)	104	1545859:1545874	1637179:1637194
1545859:1545874	attL	GATTGCCGTGGCACTG	NA	NA	NA	NA
WP_004235488.1|1551967_1553242_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	3.3e-83
WP_004235487.1|1553377_1554028_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_004235485.1|1554082_1555201_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_004235484.1|1555519_1555987_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_015422751.1|1556046_1556481_-	transcriptional regulator SlyA	NA	NA	NA	NA	NA
WP_004235482.1|1556996_1557233_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_004235481.1|1557385_1557793_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_004235480.1|1557902_1558550_+	ribonuclease T	NA	NA	NA	NA	NA
WP_004235479.1|1558617_1559298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004235478.1|1559436_1559778_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_004235477.1|1560061_1560682_+	homoserine/homoserine lactone efflux protein	NA	NA	NA	NA	NA
WP_015422752.1|1560745_1561204_-	Putative inner membrane protein	NA	NA	NA	NA	NA
WP_032098093.1|1561345_1562044_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.6	4.8e-07
WP_004235472.1|1562067_1562607_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_004239103.1|1562676_1562985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004235459.1|1563384_1563963_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_123805126.1|1564047_1564143_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_004235455.1|1564408_1565434_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.5	2.4e-31
WP_004235453.1|1565437_1566340_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004239098.1|1566461_1567673_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.3	2.6e-16
WP_004235450.1|1567938_1569102_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.5	1.0e-83
WP_004235447.1|1569184_1569850_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	36.8	1.4e-24
WP_004239095.1|1570062_1571436_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_004235443.1|1572153_1573566_+	pyruvate kinase PykF	NA	NA	NA	NA	NA
WP_004239093.1|1573891_1574128_+	major outer membrane lipoprotein	NA	NA	NA	NA	NA
WP_004235440.1|1574268_1575351_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_004235438.1|1575449_1575869_-	cysteine desulfuration protein SufE	NA	NA	NA	NA	NA
WP_004235437.1|1575877_1577116_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.5	2.0e-85
WP_061057404.1|1577115_1578420_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_004235432.1|1578394_1579141_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	28.8	4.9e-10
WP_004235427.1|1579192_1580677_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_004235425.1|1580692_1581073_-	Fe-S cluster assembly scaffold SufA	NA	A0A218MM00	uncultured_virus	35.9	1.4e-13
WP_015422754.1|1581411_1581837_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_015422755.1|1581871_1584940_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_015422756.1|1585149_1586265_+	AI-2E family transporter YdiK	NA	NA	NA	NA	NA
WP_004239083.1|1586739_1589118_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.3	3.4e-174
WP_004235416.1|1589336_1590200_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_004235412.1|1590346_1591396_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0B5IW14	Pandoravirus	46.6	1.2e-78
WP_061057406.1|1591914_1592199_+	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	88.8	1.9e-39
WP_061057407.1|1592278_1592560_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061057408.1|1592595_1593150_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	73.3	2.7e-69
WP_061057409.1|1593139_1593841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046024302.1|1593837_1594200_+|tail	tail fiber assembly protein	tail	E7EKV7	Edwardsiella_phage	39.1	1.6e-14
WP_061057410.1|1594171_1594525_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	45.5	3.0e-10
WP_061057411.1|1594521_1595421_-	hypothetical protein	NA	A0A1C9II52	Salmonella_phage	37.5	2.9e-09
WP_061057412.1|1595471_1596065_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_061057413.1|1596061_1597201_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	33.3	1.3e-38
WP_061057414.1|1597201_1597639_-	phage GP46 family protein	NA	B5TK74	Pseudomonas_phage	55.2	1.4e-17
WP_061057415.1|1597638_1598223_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_061057416.1|1598225_1599296_-|tail	phage tail protein	tail	A0A2I7S9G1	Vibrio_phage	30.3	2.7e-38
WP_061057417.1|1599292_1600693_-	DNA circularization protein	NA	NA	NA	NA	NA
WP_061057418.1|1601170_1601725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057419.1|1601725_1602184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057420.1|1602299_1604189_-	hypothetical protein	NA	A0A0E3GMJ2	Enterobacteria_phage	33.6	1.3e-11
WP_105212820.1|1604331_1604598_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_004904816.1|1604597_1604966_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_061057421.1|1604975_1606457_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	45.1	4.7e-105
WP_004904824.1|1606453_1606621_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	54.8	4.7e-06
WP_061057422.1|1606623_1607172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049246046.1|1607171_1607510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057423.1|1607499_1607871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057424.1|1607884_1608931_-|capsid	major capsid protein	capsid	V5Q8X6	Xylella_phage	33.8	3.7e-48
WP_061057425.1|1609003_1609396_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	34.6	8.3e-09
WP_061057426.1|1609395_1610007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057427.1|1610009_1610864_-	S49 family peptidase	NA	A0A1I9KF73	Aeromonas_phage	38.0	1.2e-49
WP_105212821.1|1610860_1612513_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.6	1.3e-92
WP_061057428.1|1612512_1612764_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_061057429.1|1612773_1614747_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	47.0	1.4e-144
WP_071888210.1|1614721_1615294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057431.1|1616324_1616984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036424849.1|1617232_1617457_-	hypothetical protein	NA	A0A2I7QSR3	Vibrio_phage	48.4	6.8e-08
WP_081093771.1|1617456_1617708_-	hypothetical protein	NA	A0A1W6JNV7	Morganella_phage	75.0	1.3e-15
WP_061057432.1|1617595_1617973_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	75.0	9.0e-45
WP_192575765.1|1617969_1618128_-	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	95.6	5.1e-18
WP_061057433.1|1618109_1618586_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	66.0	3.5e-54
WP_036422679.1|1618578_1618800_-|holin	class II holin family protein	holin	H9C183	Pectobacterium_phage	67.7	1.4e-18
WP_061057434.1|1619123_1619711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057435.1|1619823_1620876_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	91.0	9.2e-172
WP_061057436.1|1621014_1621209_-	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	98.4	2.3e-28
WP_061057437.1|1621421_1622201_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	38.9	5.2e-47
WP_061057438.1|1622200_1623187_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	59.9	4.1e-113
WP_061057439.1|1623183_1624761_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	66.6	2.0e-210
WP_061057440.1|1625025_1625304_-	hypothetical protein	NA	A0A0N7BYT1	Escherichia_phage	47.8	6.5e-16
WP_071888194.1|1625272_1625485_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	43.9	2.1e-06
WP_061057441.1|1625591_1626272_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	43.8	1.9e-48
WP_081093772.1|1626363_1626825_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PJ00	Moraxella_phage	51.5	4.5e-06
WP_061057443.1|1626846_1627035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057444.1|1627036_1627225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004242323.1|1627226_1627400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057445.1|1627392_1627788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057446.1|1627790_1628090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057447.1|1628278_1628698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057448.1|1628772_1629120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057449.1|1629106_1629313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057450.1|1629312_1629528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081093786.1|1629764_1630232_+	hypothetical protein	NA	A0A286S260	Klebsiella_phage	56.4	8.9e-34
WP_004240824.1|1630426_1630654_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_061057453.1|1630656_1631226_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	39.2	3.1e-33
WP_004240826.1|1631238_1631460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036421283.1|1631456_1631708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057454.1|1631697_1632474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036425739.1|1632460_1632778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004239999.1|1632774_1632981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057455.1|1632937_1634161_-|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	49.9	1.3e-113
1637179:1637194	attR	GATTGCCGTGGCACTG	NA	NA	NA	NA
>prophage 7
NZ_CP014026	Morganella morganii strain FDAARGOS_172 chromosome, complete genome	3908080	1838028	1904252	3908080	head,tail,terminase,tRNA,integrase,protease,portal,holin,capsid	Morganella_phage(71.93%)	86	1887102:1887116	1899349:1899363
WP_036417780.1|1838028_1838226_-	hypothetical protein	NA	A0A1W6JP52	Morganella_phage	67.9	1.1e-12
WP_004235070.1|1838197_1838575_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	38.4	7.7e-12
WP_004239826.1|1838571_1838730_-	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	67.4	1.8e-10
WP_004235069.1|1838711_1839188_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	77.7	6.2e-67
WP_004235068.1|1839177_1839372_-|holin	phage holin family protein	holin	A0A1W6JNY9	Morganella_phage	73.0	2.6e-24
WP_004235065.1|1839444_1839882_-	hypothetical protein	NA	A0A1W6JNY5	Morganella_phage	47.5	5.2e-28
WP_004235063.1|1840247_1840955_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	56.1	4.4e-69
WP_004235059.1|1841321_1841573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024473388.1|1841992_1842808_+	lipoprotein NlpA	NA	NA	NA	NA	NA
WP_004235054.1|1842848_1843523_-	CerR family C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_160312183.1|1844857_1845004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004235050.1|1845134_1845305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004235049.1|1845550_1845769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036417816.1|1846133_1846940_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_004235045.1|1847116_1847302_-	YegP family protein	NA	NA	NA	NA	NA
WP_015422796.1|1847420_1847909_-	acetyltransferase	NA	NA	NA	NA	NA
WP_004239807.1|1847977_1848199_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004235037.1|1848352_1848619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004239806.1|1849176_1849485_-	DUF3088 family protein	NA	NA	NA	NA	NA
WP_015422798.1|1849815_1850388_-	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_004235032.1|1850489_1851203_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004235031.1|1851202_1852249_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004235029.1|1852539_1852896_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_080654119.1|1853125_1853401_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JNW5	Morganella_phage	97.8	4.7e-43
WP_032098665.1|1853878_1854727_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004239793.1|1854816_1855197_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_105212831.1|1855333_1855729_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	69.0	1.4e-43
WP_015422801.1|1855721_1856375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004235019.1|1856376_1857447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004235018.1|1857600_1857765_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	7.9e-22
WP_061057464.1|1858019_1859282_-	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	96.7	2.4e-235
WP_061057465.1|1859281_1859698_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	93.5	3.5e-66
WP_061057466.1|1859899_1860448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004238651.1|1861344_1863078_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.7	6.5e-13
WP_080654114.1|1863333_1863873_-	hypothetical protein	NA	A0A1W6JNW0	Morganella_phage	95.6	8.8e-86
WP_004238648.1|1865295_1865982_-	hypothetical protein	NA	A0A1W6JNU1	Morganella_phage	98.2	1.3e-134
WP_004238646.1|1865978_1866299_-	hypothetical protein	NA	A0A1W6JNW9	Morganella_phage	99.1	6.9e-62
WP_061057467.1|1866300_1869477_-	host specificity protein J	NA	A0A1W6JNZ7	Morganella_phage	94.6	0.0e+00
WP_061057634.1|1869509_1870112_-|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	91.5	2.7e-99
WP_015422650.1|1870144_1870846_-	C40 family peptidase	NA	A0A1W6JP31	Morganella_phage	95.6	1.2e-135
WP_061057468.1|1870848_1871607_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	94.4	5.9e-144
WP_015422807.1|1871603_1871939_-|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	94.6	6.7e-60
WP_061057469.1|1871935_1875193_-|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	98.5	0.0e+00
WP_024474647.1|1875217_1875502_-	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	98.9	3.6e-46
WP_036412064.1|1875513_1875897_-|tail	phage tail protein	tail	A0A1W6JP08	Morganella_phage	94.5	6.3e-62
WP_024474649.1|1875900_1876368_-	hypothetical protein	NA	A0A1W6JP06	Morganella_phage	93.5	7.7e-78
WP_024474650.1|1876428_1876764_-	DUF3168 domain-containing protein	NA	A0A1W6JP05	Morganella_phage	94.6	3.1e-57
WP_061057470.1|1876760_1877210_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	93.3	9.6e-70
WP_024474652.1|1877202_1877529_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	83.3	4.6e-45
WP_024474653.1|1877539_1877833_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	39.8	8.1e-09
WP_061057471.1|1877874_1879086_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	62.1	1.1e-139
WP_172455770.1|1879095_1879746_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	76.9	9.6e-95
WP_061057473.1|1879735_1880956_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	73.8	3.8e-177
WP_004238661.1|1880955_1881135_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	62.5	4.4e-10
WP_061057474.1|1881144_1882875_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	92.4	0.0e+00
WP_061057475.1|1882878_1883349_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	89.7	7.7e-78
WP_024474659.1|1883495_1883849_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	94.0	2.2e-61
WP_061057477.1|1884338_1884716_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	76.6	5.3e-45
WP_163656456.1|1884712_1884871_-	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	95.6	5.6e-17
WP_024474665.1|1884852_1885329_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	91.7	1.3e-80
WP_024474664.1|1885321_1885513_-|holin	phage holin family protein	holin	A0A1W6JP85	Morganella_phage	100.0	4.9e-31
WP_061057478.1|1885874_1886792_+	hypothetical protein	NA	A0A1B5FPB0	Escherichia_phage	53.8	6.9e-30
WP_061057635.1|1886915_1887695_-	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	38.7	1.4e-39
1887102:1887116	attL	GCGAGGGCAATCTTT	NA	NA	NA	NA
WP_061057479.1|1887724_1888741_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	94.7	1.2e-192
WP_061057480.1|1888740_1889529_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	98.1	1.1e-142
WP_161800848.1|1889587_1889752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057481.1|1889954_1890152_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_061057482.1|1890148_1890559_-	hypothetical protein	NA	A0A1W6JP58	Morganella_phage	97.0	9.4e-64
WP_061057483.1|1890558_1891098_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	93.9	1.5e-96
WP_061057484.1|1891097_1891346_-	hypothetical protein	NA	A0A1W6JP32	Morganella_phage	92.5	2.7e-37
WP_061057485.1|1891342_1892227_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	85.7	4.3e-130
WP_061057486.1|1892223_1892418_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	81.2	1.3e-23
WP_125460925.1|1892410_1892611_-	hypothetical protein	NA	A0A1W6JP45	Morganella_phage	69.7	5.7e-22
WP_004238678.1|1892674_1893139_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	48.7	2.7e-35
WP_061057487.1|1893168_1893369_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP24	Morganella_phage	70.8	1.2e-19
WP_004240616.1|1893466_1894126_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	60.7	1.7e-70
WP_061057488.1|1894255_1894468_+	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	77.1	4.2e-23
WP_061057489.1|1894723_1895185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422824.1|1895672_1895900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071888196.1|1895962_1896205_+	excisionase	NA	NA	NA	NA	NA
WP_061057490.1|1896185_1897313_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	60.1	7.2e-122
WP_105212823.1|1897451_1900205_-	ABC transporter	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	24.9	2.3e-28
1899349:1899363	attR	AAAGATTGCCCTCGC	NA	NA	NA	NA
WP_004238119.1|1900481_1901735_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	94.4	8.0e-21
WP_004238117.1|1901879_1902560_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_046025126.1|1902513_1902978_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004238115.1|1903148_1904252_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP014026	Morganella morganii strain FDAARGOS_172 chromosome, complete genome	3908080	2307945	2362246	3908080	head,tail,terminase,tRNA,integrase,protease,portal,holin,capsid	Morganella_phage(68.09%)	64	2307743:2307789	2349967:2350013
2307743:2307789	attL	ATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAGG	NA	NA	NA	NA
WP_061057511.1|2307945_2309163_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	30.3	9.4e-35
WP_024474763.1|2309429_2309714_+	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	86.5	1.2e-36
WP_024474762.1|2309793_2310075_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_061057512.1|2313296_2314565_-	tryptophan permease	NA	NA	NA	NA	NA
WP_061057513.1|2314699_2316070_-	tyrosine phenol-lyase	NA	NA	NA	NA	NA
WP_024474641.1|2317730_2321819_-	DUF1983 domain-containing protein	NA	A0A1W6JNZ7	Morganella_phage	67.5	0.0e+00
WP_024474642.1|2321852_2322455_-|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	90.0	2.5e-97
WP_024474643.1|2322487_2323189_-	C40 family peptidase	NA	A0A1W6JP31	Morganella_phage	95.6	1.0e-134
WP_024474644.1|2323191_2323950_-|tail	phage minor tail protein L	tail	A0A1W6JNX9	Morganella_phage	96.4	1.4e-145
WP_024474645.1|2323946_2324282_-|tail	phage tail protein	tail	A0A1W6JP11	Morganella_phage	92.8	7.4e-59
WP_061057514.1|2324278_2327539_-|tail	phage tail tape measure protein	tail	A0A1P8DTH2	Proteus_phage	60.6	0.0e+00
WP_024474647.1|2327563_2327848_-	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	98.9	3.6e-46
WP_036412064.1|2327859_2328243_-|tail	phage tail protein	tail	A0A1W6JP08	Morganella_phage	94.5	6.3e-62
WP_024474649.1|2328246_2328714_-	hypothetical protein	NA	A0A1W6JP06	Morganella_phage	93.5	7.7e-78
WP_024474650.1|2328774_2329110_-	DUF3168 domain-containing protein	NA	A0A1W6JP05	Morganella_phage	94.6	3.1e-57
WP_061057470.1|2329106_2329556_-	HK97 gp10 family phage protein	NA	A0A1W6JP15	Morganella_phage	93.3	9.6e-70
WP_024474652.1|2329548_2329875_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	83.3	4.6e-45
WP_024474653.1|2329885_2330179_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	39.8	8.1e-09
WP_061057471.1|2330220_2331432_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	62.1	1.1e-139
WP_172455770.1|2331441_2332092_-|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	76.9	9.6e-95
WP_061057473.1|2332081_2333302_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	73.8	3.8e-177
WP_004238661.1|2333301_2333481_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	62.5	4.4e-10
WP_061057515.1|2333490_2335221_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	92.9	0.0e+00
WP_024474658.1|2335224_2335695_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	88.5	8.5e-77
WP_024474659.1|2335841_2336195_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	94.0	2.2e-61
WP_061057477.1|2336684_2337062_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	76.6	5.3e-45
WP_163656456.1|2337058_2337217_-	hypothetical protein	NA	A0A1W6JP30	Morganella_phage	95.6	5.6e-17
WP_024474665.1|2337198_2337675_-	lysozyme	NA	A0A1W6JNW4	Morganella_phage	91.7	1.3e-80
WP_024474664.1|2337667_2337859_-|holin	phage holin family protein	holin	A0A1W6JP85	Morganella_phage	100.0	4.9e-31
WP_163628338.1|2338024_2338165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057516.1|2338388_2339444_-	site-specific DNA-methyltransferase	NA	A0A1W6JP25	Morganella_phage	94.3	8.4e-173
WP_061057436.1|2339582_2339777_-	hypothetical protein	NA	A0A1W6JP28	Morganella_phage	98.4	2.3e-28
WP_024475221.1|2340018_2340396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024475220.1|2340426_2341443_-	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	96.4	3.6e-197
WP_024475219.1|2341442_2342231_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	97.7	9.7e-142
WP_024475218.1|2342248_2342650_-	hypothetical protein	NA	A0A1W6JP58	Morganella_phage	42.5	5.1e-14
WP_024475217.1|2342646_2343183_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	93.8	3.2e-96
WP_061057517.1|2343182_2343425_-	hypothetical protein	NA	A0A1W6JP32	Morganella_phage	53.8	7.3e-16
WP_024475215.1|2343421_2344306_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	89.8	6.4e-134
WP_061057518.1|2344302_2344491_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	91.8	1.4e-27
WP_061057519.1|2344487_2344679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024475293.1|2344743_2345241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024475294.1|2345270_2345483_-	cell division protein	NA	A0A1W6JP24	Morganella_phage	44.3	1.3e-08
WP_024475295.1|2345584_2346217_+	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	43.5	1.1e-39
WP_024475296.1|2346317_2346530_+	hypothetical protein	NA	A0A1W6JP89	Morganella_phage	81.4	2.0e-25
WP_025154873.1|2346750_2347113_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	65.5	2.4e-34
WP_024475097.1|2347178_2348006_+	YfdQ family protein	NA	U5P439	Shigella_phage	54.6	9.4e-79
WP_024475096.1|2348104_2348332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024475095.1|2348374_2349097_+	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	94.8	3.2e-91
WP_061057637.1|2349123_2349672_+	3'-5' exoribonuclease	NA	A0A1W6JP74	Morganella_phage	84.5	2.2e-84
WP_024475093.1|2349702_2349891_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004241000.1|2350236_2351100_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	33.2	6.5e-30
2349967:2350013	attR	ATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAGG	NA	NA	NA	NA
WP_004237674.1|2351102_2351315_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004237673.1|2351383_2351917_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	39.3	2.8e-15
WP_004237672.1|2351996_2352386_-	cytochrome b562	NA	NA	NA	NA	NA
WP_004237668.1|2352561_2353950_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L4N2	Tupanvirus	33.3	1.4e-39
WP_004237667.1|2354223_2354718_+	peptidylprolyl isomerase B	NA	A0A076FI46	Aureococcus_anophage	34.0	3.1e-13
WP_004237665.1|2354720_2355443_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_015422943.1|2355591_2356116_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004237663.1|2356115_2357186_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004237662.1|2357274_2358540_+	MFS transporter	NA	NA	NA	NA	NA
WP_004237661.1|2358536_2360969_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004237659.1|2360965_2361652_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	3.9e-30
WP_032099246.1|2361619_2362246_+|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
>prophage 9
NZ_CP014026	Morganella morganii strain FDAARGOS_172 chromosome, complete genome	3908080	2450337	2572932	3908080	head,tail,tRNA,terminase,integrase,portal,protease,plate,holin,capsid	Cronobacter_phage(47.83%)	109	2488004:2488021	2577098:2577115
WP_004236438.1|2450337_2451786_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_004236437.1|2451998_2452253_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004236435.1|2452287_2453211_+	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004236434.1|2453268_2455137_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004240411.1|2455206_2456196_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_004240412.1|2456293_2456707_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_004236430.1|2456733_2457204_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	45.0	1.5e-28
WP_048884253.1|2457325_2458435_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.3	5.0e-51
WP_004236428.1|2458440_2458890_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_004240415.1|2459001_2459970_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	41.5	2.2e-47
WP_004240417.1|2459980_2461828_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004236424.1|2461863_2462199_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	31.0	7.3e-06
WP_004240418.1|2462300_2463425_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.4	2.2e-91
WP_004236420.1|2463523_2464600_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_061057525.1|2464710_2465298_+	DUF479 domain-containing protein	NA	NA	NA	NA	NA
WP_004240420.1|2465502_2466105_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_015422964.1|2466217_2467549_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_004240423.1|2467943_2469239_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	32.7	7.7e-27
WP_004236414.1|2469269_2469959_-	phosphate regulon transcriptional regulator PhoB	NA	W8CYM9	Bacillus_phage	39.7	1.1e-37
WP_004236412.1|2470236_2471529_+	exonuclease subunit SbcD	NA	NA	NA	NA	NA
WP_004236411.1|2471525_2475212_+	hypothetical protein	NA	M1U9H5	Synechococcus_phage	31.7	1.4e-09
WP_004236410.1|2475407_2476010_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_004236409.1|2476146_2477055_-	fructokinase	NA	NA	NA	NA	NA
WP_004240426.1|2477234_2478143_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.9	1.1e-96
WP_004236407.1|2478193_2478898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036416646.1|2478985_2479615_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004236405.1|2479650_2479896_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_004236404.1|2479906_2481118_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_170950660.1|2481712_2482723_-	hydrogenase expression/formation protein HypE	NA	NA	NA	NA	NA
WP_061057526.1|2482733_2483864_-	hydrogenase formation protein HypD	NA	NA	NA	NA	NA
WP_015422965.1|2483873_2484971_-	hydrogenase nickel incorporation protein HypB	NA	NA	NA	NA	NA
WP_004236400.1|2485228_2486050_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_004236399.1|2486194_2486548_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_004240442.1|2486656_2487313_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_004236396.1|2487349_2488369_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	1.0e-106
2488004:2488021	attL	TTCCAGCATCGGTGCCAG	NA	NA	NA	NA
WP_004240446.1|2488818_2489034_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_024474555.1|2489145_2490882_+	DNA primase	NA	A0A1S5RG58	Helicobacter_phage	33.8	3.0e-50
WP_004236392.1|2491066_2492917_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.9	4.2e-34
WP_061057527.1|2493837_2495511_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	48.0	1.7e-148
WP_061057528.1|2495516_2496065_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	56.7	2.6e-45
WP_061057638.1|2496018_2496726_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	36.5	1.3e-33
WP_081093777.1|2496770_2497163_-|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	56.1	3.2e-13
WP_061057530.1|2497126_2498761_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	59.9	6.2e-90
WP_061057531.1|2498771_2499428_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	65.2	4.7e-65
WP_061057532.1|2499420_2500602_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	64.4	2.4e-144
WP_061057533.1|2500598_2500925_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	69.4	1.7e-36
WP_061057534.1|2500917_2502999_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	45.1	6.3e-156
WP_061057535.1|2503186_2503456_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	58.8	3.4e-22
WP_061057536.1|2503557_2503947_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	46.4	2.5e-18
WP_048822709.1|2503946_2504285_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	80.2	2.2e-42
WP_048822710.1|2504281_2504575_-|holin	phage holin family protein	holin	Q6K1I2	Salmonella_virus	55.8	3.6e-17
WP_061057537.1|2504591_2505047_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	67.5	1.3e-53
WP_061057538.1|2505046_2506165_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	65.1	1.5e-135
WP_061057539.1|2506187_2506856_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	57.0	6.9e-64
WP_061057540.1|2506852_2507323_-|tail	phage tail protein	tail	Q94MZ1	Haemophilus_virus	32.0	9.3e-15
WP_061057541.1|2507319_2507772_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	59.3	1.5e-41
WP_061057542.1|2507867_2508569_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.4	5.2e-62
WP_061057543.1|2508572_2509589_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	73.2	8.4e-138
WP_061057544.1|2509619_2510402_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	39.8	5.3e-39
WP_061057545.1|2510538_2512317_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	65.0	2.5e-225
WP_061057546.1|2512316_2513345_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	64.9	3.2e-129
WP_087769794.1|2513395_2513662_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	59.1	9.5e-25
WP_061057548.1|2513694_2514570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057549.1|2514571_2514787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081093778.1|2514861_2516964_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	49.2	1.8e-171
WP_061057550.1|2516965_2517772_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	52.8	5.8e-65
WP_061057551.1|2517773_2517995_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_061057552.1|2517987_2518239_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_061057553.1|2518308_2518656_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	38.0	1.8e-15
WP_061057554.1|2518803_2519301_-	phage regulatory CII family protein	NA	F1BUN6	Cronobacter_phage	45.1	4.7e-33
WP_061057555.1|2519328_2519556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061057639.1|2519702_2520290_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	36.9	4.4e-30
WP_061057556.1|2520291_2521212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061057557.1|2521198_2522218_+|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	61.3	5.7e-118
WP_061057558.1|2522219_2523323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081093780.1|2523775_2528665_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004236388.1|2528727_2531088_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_036416599.1|2531111_2537027_-	alpha-2-macroglobulin	NA	NA	NA	NA	NA
WP_004236386.1|2537221_2538361_-	class C beta-lactamase DHA-1	NA	NA	NA	NA	NA
WP_004236384.1|2538471_2539347_+	LysR family transcriptional regulator AmpR	NA	NA	NA	NA	NA
WP_004193196.1|2539350_2539692_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_004236382.1|2539684_2540176_-	hydrogenase-2 assembly chaperone	NA	NA	NA	NA	NA
WP_004236381.1|2540168_2540663_-	HyaD/HybD family hydrogenase maturation endopeptidase	NA	NA	NA	NA	NA
WP_004236380.1|2540662_2542366_-	hydrogenase 2 large subunit	NA	NA	NA	NA	NA
WP_015422968.1|2542362_2543544_-	Ni/Fe-hydrogenase cytochrome b subunit	NA	NA	NA	NA	NA
WP_015422969.1|2543533_2544517_-	hydrogenase 2 operon protein HybA	NA	NA	NA	NA	NA
WP_004236377.1|2544519_2545653_-	hydrogenase 2 small subunit	NA	NA	NA	NA	NA
WP_004236374.1|2546520_2547837_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_004240468.1|2548211_2549921_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_004236371.1|2550668_2551619_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_004236370.1|2551882_2552563_+	DedA family protein	NA	NA	NA	NA	NA
WP_004236369.1|2552780_2553083_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_004236368.1|2553086_2553500_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004236367.1|2553492_2553795_+	YqjK-like family protein	NA	NA	NA	NA	NA
WP_004240479.1|2553985_2554372_+	DoxX family protein	NA	NA	NA	NA	NA
WP_015422970.1|2554337_2554730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015422972.1|2555147_2556044_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004236363.1|2556150_2556849_+	pirin family protein	NA	NA	NA	NA	NA
WP_036412939.1|2557346_2558219_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	46.0	1.6e-52
WP_004236361.1|2558279_2560034_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_004236359.1|2560101_2560464_+	YraN family protein	NA	NA	NA	NA	NA
WP_004240488.1|2560498_2561089_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.9	1.2e-11
WP_004236357.1|2561098_2561671_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_024474531.1|2561908_2562631_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_004236355.1|2562637_2563288_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_004236354.1|2563529_2565863_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	29.9	6.8e-42
WP_004236351.1|2566479_2570937_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_004236349.1|2570948_2572367_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004240493.1|2572443_2572932_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	56.0	1.4e-26
2577098:2577115	attR	CTGGCACCGATGCTGGAA	NA	NA	NA	NA
>prophage 10
NZ_CP014026	Morganella morganii strain FDAARGOS_172 chromosome, complete genome	3908080	3184353	3193200	3908080		Escherichia_phage(66.67%)	8	NA	NA
WP_004237914.1|3184353_3186309_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.0	5.7e-82
WP_004237912.1|3186677_3187298_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	55.5	3.0e-61
WP_015422349.1|3187386_3188073_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004237910.1|3188200_3188491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004237909.1|3188558_3189170_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	35.2	2.4e-23
WP_004237908.1|3189255_3190116_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.7	1.1e-26
WP_004237907.1|3190117_3190735_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	8.0e-75
WP_061057576.1|3190746_3193200_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.7	2.2e-216
>prophage 11
NZ_CP014026	Morganella morganii strain FDAARGOS_172 chromosome, complete genome	3908080	3282215	3288513	3908080	integrase	Virus_Rctr41k(33.33%)	7	3278456:3278469	3285490:3285503
3278456:3278469	attL	TAAGGATTATTTAG	NA	NA	NA	NA
WP_000704156.1|3282215_3282740_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|3282834_3283308_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000071896.1|3283639_3284176_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|3284290_3284617_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_001353740.1|3284804_3285044_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_004236728.1|3285997_3286981_+	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.4	1.3e-10
3285490:3285503	attR	CTAAATAATCCTTA	NA	NA	NA	NA
WP_004236727.1|3286971_3288513_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.4	4.4e-37
>prophage 12
NZ_CP014026	Morganella morganii strain FDAARGOS_172 chromosome, complete genome	3908080	3577112	3587894	3908080		Escherichia_phage(16.67%)	7	NA	NA
WP_015422419.1|3577112_3578519_+	replicative DNA helicase	NA	O80281	Escherichia_phage	75.0	3.3e-193
WP_004238258.1|3578598_3579678_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	26.7	5.8e-28
WP_015422420.1|3579733_3580930_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_004241544.1|3580981_3581248_-	DksA/TraR family C4-type zinc finger protein	NA	A0A2C9CZU7	Yersinia_phage	55.7	1.2e-16
WP_004238254.1|3581378_3584213_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.6	0.0e+00
WP_004238253.1|3584489_3585011_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	86.0	2.2e-49
WP_004238250.1|3586202_3587894_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	31.2	4.6e-64
