The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014034	Vibrio fluvialis strain FDAARGOS_104 chromosome 1, complete sequence	1671895	527167	561794	1671895	head,integrase,tail,portal,terminase,capsid,plate	Vibrio_phage(20.0%)	47	525134:525176	561892:561934
525134:525176	attL	TTTGCTAGGTATGGCGGGAATAAAAAACCCGCCATTGGGCGGG	NA	NA	NA	NA
WP_075990070.1|527167_527275_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_061055509.1|527310_527598_-|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	40.4	1.6e-06
WP_061055510.1|527581_528277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061055511.1|528287_528653_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_061055512.1|528656_529790_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	38.7	6.9e-48
WP_020432118.1|529786_529969_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_061055513.1|529969_530509_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_061055514.1|530505_530970_-|tail	phage tail protein	tail	A0A1S5NPS3	Burkholderia_phage	28.6	5.0e-05
WP_055452435.1|530969_531419_-|head	head completion/stabilization protein	head	NA	NA	NA	NA
WP_061055515.1|531527_532565_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	41.1	2.4e-63
WP_061055516.1|532607_533420_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	36.0	5.3e-18
WP_172465306.1|533554_535315_+|terminase	terminase	terminase	A0A1S6KZW3	Salmonella_phage	40.8	1.2e-112
WP_061055517.1|535325_536291_+|portal	phage portal protein	portal	A0A0M3LS06	Mannheimia_phage	42.1	4.8e-58
WP_061055518.1|536771_537536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081094692.1|537695_538643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061055519.1|538876_539494_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	58.7	3.5e-22
WP_161624193.1|539509_539716_-	ash family protein	NA	NA	NA	NA	NA
WP_061055520.1|540085_541096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061055521.1|541092_541632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004726819.1|541775_542027_-	hypothetical protein	NA	A0A1D9C9R8	Salinivibrio_phage	45.2	1.2e-08
WP_020329260.1|542017_542248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061055522.1|542258_542675_-	glycoside hydrolase family protein	NA	A0A1Q1PW74	Pseudoalteromonas_phage	50.7	4.2e-27
WP_061055523.1|542818_543295_-	hypothetical protein	NA	A0A1D9C9S5	Salinivibrio_phage	38.0	3.1e-18
WP_061055524.1|544640_545120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061055525.1|545101_546148_-|plate	baseplate J/gp47 family protein	plate	S5FM68	Shigella_phage	24.5	1.0e-13
WP_061055526.1|546144_546531_-	phage GP46 family protein	NA	NA	NA	NA	NA
WP_061055527.1|546527_547103_-|plate	phage baseplate assembly protein V	plate	B5TK73	Pseudomonas_phage	32.4	1.5e-11
WP_061055528.1|547095_548034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061055529.1|548030_549221_-	DNA circularization N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_038151570.1|550006_550366_-	hypothetical protein	NA	A0A1S6KZW3	Salmonella_phage	37.0	1.5e-12
WP_004726797.1|550611_550863_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_061055531.1|550872_553503_-	replication endonuclease	NA	A0A166YHE2	Vibrio_phage	59.1	6.1e-297
WP_061055532.1|553546_553855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061055533.1|554044_554281_-	hypothetical protein	NA	R9TPY7	Vibrio_phage	84.6	2.9e-33
WP_061055534.1|554262_554730_-	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	38.6	8.9e-10
WP_044362472.1|554726_555023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004726788.1|555095_555428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061055535.1|555437_555977_-	phage regulatory CII family protein	NA	A0A2I7RNI1	Vibrio_phage	57.5	6.8e-54
WP_004726785.1|556034_556493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047462994.1|556640_557366_+	phage repressor protein	NA	M4MB93	Vibrio_phage	29.2	1.2e-24
WP_061055536.1|557430_557823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_192943941.1|557860_557953_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_061055537.1|557973_558561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162268965.1|558658_559510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081094695.1|559473_559566_-	DUF3265 domain-containing protein	NA	NA	NA	NA	NA
WP_061055539.1|559580_560519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061056067.1|560825_561794_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	49.7	6.0e-85
561892:561934	attR	TTTGCTAGGTATGGCGGGAATAAAAAACCCGCCATTGGGCGGG	NA	NA	NA	NA
>prophage 1
NZ_CP014035	Vibrio fluvialis strain FDAARGOS_104 chromosome 2, complete sequence	3155838	320427	326971	3155838		Staphylococcus_phage(66.67%)	7	NA	NA
WP_038157346.1|320427_321561_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	6.2e-65
WP_024373553.1|321572_322823_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	8.9e-97
WP_020331649.1|322925_323375_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_061056200.1|323388_324498_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.7	8.5e-43
WP_020331651.1|324501_325155_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.0	6.0e-36
WP_020431928.1|325196_326306_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	39.0	4.8e-62
WP_004724909.1|326500_326971_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.3	1.9e-31
>prophage 2
NZ_CP014035	Vibrio fluvialis strain FDAARGOS_104 chromosome 2, complete sequence	3155838	1261695	1271212	3155838		Vibrio_phage(90.0%)	11	NA	NA
WP_061057219.1|1261695_1263426_+	response regulator	NA	A0A1V0SGX0	Hokovirus	35.0	1.5e-49
WP_061056518.1|1264431_1264800_-	antirepressor	NA	Q9MCC3	Vibrio_phage	77.7	8.8e-45
WP_061056519.1|1264980_1265544_+	3'-5' exonuclease	NA	W6ASW5	Vibrio_phage	58.9	1.9e-54
WP_061056520.1|1265547_1265805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_055453532.1|1265807_1266008_+	hypothetical protein	NA	C3W4P3	Vibrio_phage	76.9	2.1e-24
WP_055453530.1|1267086_1267425_+	DUF1293 domain-containing protein	NA	Q858R2	Vibrio_phage	74.1	1.5e-43
WP_081035198.1|1267434_1267662_+	hypothetical protein	NA	R9TMT7	Vibrio_phage	57.3	3.4e-15
WP_055453529.1|1267690_1267906_+	hypothetical protein	NA	R9TRU5	Vibrio_phage	63.1	8.8e-13
WP_061056521.1|1268037_1269486_+	hypothetical protein	NA	G8IRU9	Vibrio_phage	45.1	2.3e-24
WP_061056522.1|1269494_1269836_+	DUF2523 domain-containing protein	NA	R9TRT6	Vibrio_phage	74.3	6.9e-44
WP_061056523.1|1269841_1271212_+	toxin	NA	R9TQ09	Vibrio_phage	78.8	1.5e-198
>prophage 3
NZ_CP014035	Vibrio fluvialis strain FDAARGOS_104 chromosome 2, complete sequence	3155838	2052598	2059646	3155838		Megavirus(16.67%)	9	NA	NA
WP_020330651.1|2052598_2053030_-	nucleoside-diphosphate kinase	NA	K7YW26	Megavirus	39.8	2.6e-19
WP_020330650.1|2053099_2054392_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	40.7	4.5e-35
WP_020330649.1|2054568_2054763_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_020330648.1|2054818_2055157_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_061056817.1|2055170_2057024_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.8	3.8e-112
WP_020330646.1|2057045_2057561_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_020330645.1|2057628_2057952_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	54.2	5.5e-27
WP_020330644.1|2058011_2058395_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.4	9.1e-53
WP_020330643.1|2058431_2059646_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.5	1.1e-30
>prophage 4
NZ_CP014035	Vibrio fluvialis strain FDAARGOS_104 chromosome 2, complete sequence	3155838	2270956	2282062	3155838	tRNA	uncultured_Mediterranean_phage(25.0%)	9	NA	NA
WP_020429693.1|2270956_2273539_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	37.0	1.5e-77
WP_061056876.1|2273726_2274185_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_020330433.1|2274254_2275307_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	60.7	4.8e-112
WP_061056877.1|2275479_2275968_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	45.2	4.6e-25
WP_020429690.1|2276052_2278614_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.4	4.4e-34
WP_020429689.1|2278682_2279669_-	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	34.5	1.3e-34
WP_061056878.1|2279740_2280676_-	murein hydrolase activator NlpD	NA	I3PV79	Clostridium_phage	32.8	2.3e-12
WP_020429685.1|2280675_2281302_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	53.3	2.0e-36
WP_020330427.1|2281294_2282062_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.8	9.1e-68
