bac_id	spacer_id	hit_phage_id	hit_phage_def	spacer_sequence	hit_phage_region	hit_phage_sequence	mismatch	coverage	hmm_mismatch
NZ_CP014034	2.4|860065|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	MH460463	Dickeya phage vB_DsoM_AD1, complete genome	TTTCAATCACCGTCACCACTTCTTTTGATTGC	98992-99023	TGATTTGCACCGTGGCCACTTCTTTTGATTTC	2	0.71875	9
NZ_CP014034	2.5|860125|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP017104	Rhizobium gallicum strain IE4872 plasmid pRgalIE4872c, complete sequence	CATTGGGTTTTGATGTAGTCCTGCAGGTATTT	255721-255752	GGTTGGGTTTTGAGGTATTCCTGCAGGAAGCG	2	0.78125	8
NZ_CP014034	2.7|860245|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	CP007642	Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence	TCGGTCGCAGGCTTGCTCCCTTATCCCTGCGG	374479-374510	AGAGGTCGCGGCTTGCTCCCTTCTCCCCGCGG	2	0.71875	5
NZ_CP014034	2.8|860305|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP023068	Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence	AAACGAATCAAGTCCGTCGCCAGCGACGAAAA	1177209-1177240	AGTTCGCCGCCGGCGACGGACTTGAAGGCACC	2	0.71875	11
NZ_CP014034	2.8|860305|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP040452	Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence	AAACGAATCAAGTCCGTCGCCAGCGACGAAAA	1287163-1287194	GCAAGAATCAACTCCATCGCCAGCGACATCCG	2	0.71875	10
NZ_CP014034	2.10|860425|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP020471	Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence	ATCGATACGCTTGGCAACCGTTATGTTGGGCT	124612-124643	GCTGAGACATAAAGGTTGCCAAGCGCATCGGC	2	0.75	10
NZ_CP014034	2.10|860425|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	MN034288	Leviviridae sp. isolate H4_Bulk_47_scaffold_485 RNA-dependent RNA polymerase (H4Bulk47485_000001) and hypothetical protein (H4Bulk47485_000002) genes, complete cds; and hypothetical protein (H4Bulk47485_000003) gene, partial cds	ATCGATACGCTTGGCAACCGTTATGTTGGGCT	2903-2934	GGAGTAAACTAGCGGTTGCCAACCGTATCGAT	2	0.71875	8
NZ_CP014034	2.14|860665|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP015744	Shinella sp. HZN7 plasmid pShin-08, complete sequence	TCGTAATCCGGTTCACGTCGTTCGACTTCATA	43071-43102	CTATGTCGAGAACGACGTGAACCTGATGACGA	2	0.71875	6
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	JN545746	Vibrio phage CTX strain 03/09-TRG RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	952-983	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	JN545746	Vibrio phage CTX strain 03/09-TRG RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3677-3708	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	JN545746	Vibrio phage CTX strain 03/09-TRG RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	6402-6433	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664577	Vibrio phage CTX transgenic isolate recombinant pCTX1 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), and Kan (kan) genes, complete cds; and CtxB (ctxB) gene, partial sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	890-921	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	FJ434666	Vibrio phage CTX RstC (rstC) gene, partial cds; and RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	607-638	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664574	Vibrio phage CTX transgenic isolate CTX-RS1 Kan Zot (zot) gene, partial cds; Kan (kan) gene, complete cds; and CtxB (ctxB) gene, partial sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	2198-2229	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ466611	Vibrio phage CTX strain IB1617 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), and RstR (rstR) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	877-908	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ466611	Vibrio phage CTX strain IB1617 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), and RstR (rstR) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7800-7831	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KJ540271	Vibrio phage CTX plasmid pCTX-5 Kan, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	589-620	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GU942563	Vibrio phage CTX chromosome I prophage, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	689-720	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GU942563	Vibrio phage CTX chromosome I prophage, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3414-3445	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GU942563	Vibrio phage CTX chromosome I prophage, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	6261-6292	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GU942563	Vibrio phage CTX chromosome I prophage, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	11726-11757	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485654	Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	882-913	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485654	Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3607-3638	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	AB428550	Vibrio phage CTX ctxB, hp1, rstR, rstA, and rstB genes for cholera toxin B subunit, hypothetical protein, transcriptional repressor RstR, RstA and RstB proteins, partial and complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	577-608	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KM352500	Vibrio phage CTX strain 81, partial genome	CAAACACTGGCGCGCTACGCTTGCGAATACAA	993-1024	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NC_015209	Vibrio phage CTX chromosome I, complete genome	CAAACACTGGCGCGCTACGCTTGCGAATACAA	892-923	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NC_015209	Vibrio phage CTX chromosome I, complete genome	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3617-3648	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485650	Vibrio phage CTX strain IB4322 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	898-929	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485650	Vibrio phage CTX strain IB4322 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3623-3654	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664572	Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	681-712	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	FJ449748	Vibrio phage CTX strain E1781 RstR (rstR) gene, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	667-698	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664580	Vibrio phage CTX transgenic plasmid pCTX-1-1kan, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	467-498	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664575	Vibrio phage CTX transgenic isolate recombinant CTX1 Kan Zot (zot) gene, partial cds; Kan (kan) gene, complete cds; and CtxB (ctxB) gene, partial sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	2527-2558	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ466609	Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	678-709	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ466609	Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7719-7750	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ466610	Vibrio phage CTX strain IB1627 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	879-910	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ466610	Vibrio phage CTX strain IB1627 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7920-7951	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	JN545745	Vibrio phage CTX strain 27/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	952-983	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	JN545745	Vibrio phage CTX strain 27/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3677-3708	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	JN545745	Vibrio phage CTX strain 27/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	6402-6433	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ499847	Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), Ace (ace), ZOT (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds; and unknown gene	CAAACACTGGCGCGCTACGCTTGCGAATACAA	853-884	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	DQ012295	Vibrio phage CTX CtxB (ctxB) gene, partial cds; RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	952-983	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485644	Vibrio phage CTX strain B33 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	881-912	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485644	Vibrio phage CTX strain B33 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7929-7960	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	FJ449741	Vibrio phage CTX strain 07.95vp CtxB (ctxB) gene, complete cds; and RstR (rstR) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	1127-1158	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664567	Vibrio phage CTX plasmid pCTX-2 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	671-702	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664567	Vibrio phage CTX plasmid pCTX-2 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7718-7749	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	FJ449743	Vibrio phage CTX strain MG116926 RstR (rstR) gene, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	667-698	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KJ619459	Vibrio phage CTX, complete genome	CAAACACTGGCGCGCTACGCTTGCGAATACAA	8-39	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	FJ449744	Vibrio phage CTX strain MG116926 CtxB (ctxB) gene, complete cds; and RstR (rstR) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	1127-1158	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485653	Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	734-765	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485653	Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3459-3490	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664568	Vibrio phage CTX isolate recombinant CTX-RS1 plasmid pCTX-1 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	891-922	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664568	Vibrio phage CTX isolate recombinant CTX-RS1 plasmid pCTX-1 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7807-7838	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ466612	Vibrio phage CTX strain IB1482 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	678-709	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ466612	Vibrio phage CTX strain IB1482 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7726-7757	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485649	Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	667-698	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485649	Vibrio phage CTX strain E1781 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7708-7739	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KJ540270	Vibrio phage CTX plasmid pCTX-3 Kan, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	589-620	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485646	Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	667-698	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485646	Vibrio phage CTX strain MG116926 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7715-7746	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	JN545744	Vibrio phage CTX strain 03/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	952-983	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	JN545744	Vibrio phage CTX strain 03/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3677-3708	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	JN545744	Vibrio phage CTX strain 03/09-KB RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), and RstB (rstB) genes, complete cds; and Cep (cep) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	6401-6432	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	MF155889	Vibrio virus CTXphi, complete genome	CAAACACTGGCGCGCTACGCTTGCGAATACAA	26-57	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664579	Vibrio phage CTX transgenic plasmid pCTX-1kan, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	467-498	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KJ540269	Vibrio phage CTX plasmid pCTX1*Kan, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	589-620	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485652	Vibrio phage CTX strain 01.07vp RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	898-929	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485652	Vibrio phage CTX strain 01.07vp RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3623-3654	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	FJ449738	Vibrio phage CTX strain 07.95vp RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	858-889	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485648	Vibrio phage CTX strain 07.95vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	667-698	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485648	Vibrio phage CTX strain 07.95vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7715-7746	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	FJ449752	Vibrio phage CTX strain IB4642 RstC (rstC) gene, partial cds; RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	557-588	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664578	Vibrio phage CTX transgenic plasmid pCTX3 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfU), Ace (ace), Zot (zot), and Kan (kan) genes, complete cds; and CtxB (ctxB) gene, partial sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	1012-1043	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664581	Vibrio phage CTX transgenic plasmid pCTX-3kan, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	589-620	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	FJ449751	Vibrio phage CTX strain IB4642 RstR (rstR) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	870-901	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	FJ449747	Vibrio phage CTX strain E1781 RstC (rstC) gene, partial cds; and RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	607-638	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	FJ449749	Vibrio phage CTX strain E1781 CtxB (ctxB) gene, complete cds; and RstR (rstR) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	1107-1138	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664566	Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	898-929	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664566	Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3623-3654	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664566	Vibrio phage CTX RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), OrfU (orfu), Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	10539-10570	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KJ540272	Vibrio phage CTX plasmid pCTX-6 Kan, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	589-620	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485651	Vibrio phage CTX strain IB4642 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	898-929	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485651	Vibrio phage CTX strain IB4642 RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3623-3654	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KT728931	Vibrio phage pre-CTX, complete genome	CAAACACTGGCGCGCTACGCTTGCGAATACAA	558-589	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	HQ224500	Vibrio phage CTX, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	892-923	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	HQ224500	Vibrio phage CTX, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3617-3648	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485645	Vibrio phage CTX strain MJ1236 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	881-912	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485645	Vibrio phage CTX strain MJ1236 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7929-7960	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	FJ449746	Vibrio phage CTX strain E1781 RstR (rstR) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	734-765	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ466608	Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	879-910	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ466608	Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7920-7951	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ466608	Vibrio phage CTX strain IB1346 RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), RstC (rstC), RstR (rstR), RstA (rstA), RstB (rstB), and RstC (rstC) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	10879-10910	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485647	Vibrio phage CTX strain 12.02vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	667-698	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	GQ485647	Vibrio phage CTX strain 12.02vp RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), CtxB (ctxB), RstR (rstR), RstA (rstA), RstB (rstB), Cep (cep), hypothetical protein, Ace (ace), Zot (zot), CtxA (ctxA), and CtxB (ctxB) genes, complete cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7715-7746	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	FJ434665	Vibrio phage CTX RstR (rstR) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	882-913	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	KF664573	Vibrio phage CTX transgenic isolate recombinant PM7 Kan Zot (zot) gene, partial cds; Kan (kan) gene, complete cds; and CtxB (ctxB) gene, partial sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	2198-2229	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	AY145126	Vibrio phage CTX RstR (rstR) gene, complete cds; and RstA (rstA) gene, partial cds	CAAACACTGGCGCGCTACGCTTGCGAATACAA	21-52	TTGTATTCGCAAGCGTAGCGCGCCAGTGTTTG	0	1.0	0
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	MN200778	Vibrio phage VAI1, complete genome	CAAACACTGGCGCGCTACGCTTGCGAATACAA	5459-5490	CAAACACTGGCGCGCTACGCTTGCGAATACAC	0	0.96875	1
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	MN200777	Vibrio phage VAI2, complete genome	CAAACACTGGCGCGCTACGCTTGCGAATACAA	5459-5490	CAAACACTGGCGCGCTACGCTTGCGAATACAC	0	0.96875	1
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	AF416590	Vibrio phage CTX core region Cep (cep), OrfU (orfU), Ace (ace), and Zot (zot) genes, complete cds and Vibrio cholerae serogroup 0139, partial sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3686-3717	TTGTATTAGCAAGCGTAGCGCGCCAGTGTTTG	1	1.0	1
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	AF416590	Vibrio phage CTX core region Cep (cep), OrfU (orfU), Ace (ace), and Zot (zot) genes, complete cds and Vibrio cholerae serogroup 0139, partial sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	3807-3838	AGGACTTCGCAATCGTAGCGCGCCAGTGTTTG	1	0.84375	5
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NC_001956	Vibrio phage fs2, complete genome	CAAACACTGGCGCGCTACGCTTGCGAATACAA	90-121	CAAACACTGGCGCGCTACGCTTGCGTTACCCC	0	0.78125	6
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	AB002632	Vibrio phage fs2 DNA, complete genome	CAAACACTGGCGCGCTACGCTTGCGAATACAA	90-121	CAAACACTGGCGCGCTACGCTTGCGTTACCCC	0	0.78125	6
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP028563	Aeromonas hydrophila subsp. hydrophila strain WCHAH045096 plasmid p2_045096, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	7334-7365	AAAAAACTGCCGCGCTACGCTTGCCGCCTCCC	2	0.71875	10
NZ_CP014034	2.17|860845|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP016173	Bordetella flabilis strain AU10664 plasmid unnamed1, complete sequence	CAAACACTGGCGCGCTACGCTTGCGAATACAA	71143-71174	AGGGGCCGACAAGCGGAGCGCGTCAGTGTTTG	2	0.71875	10
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_KY940428	UNVERIFIED: Bacillus sp. (in: Bacteria) strain PUMK-07 plasmid pMK-07, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	192831-192862	ACTTTATTTTTTCCACATATACAAGTAATCAT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NC_014172	Bacillus thuringiensis BMB171 plasmid pBMB171, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	298702-298733	ATGATTACTTGTATATGTGGAAAAAATAAAGT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP009595	Bacillus cereus strain 3a plasmid pBFC_3, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	174313-174344	ATGATTACTTGTATATGTGGAAAAAATAAAGT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP053290	Bacillus cereus strain WPySW2 plasmid unnamed, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	372261-372292	ACTTTATTTTTTCCACATATACAAGTAATCAT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP047086	Bacillus paranthracis strain BC307 plasmid pCE1, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	277182-277213	ATGATTACTTGTATATGTGGAAAAAATAAAGT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP009606	Bacillus cereus strain S2-8 plasmid pBFR_2, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	40548-40579	ATGATTACTTGTATATGTGGAAAAAATAAAGT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP041978	Bacillus pacificus strain NCCP 15909 plasmid unnamed1, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	122224-122255	ACTTTATTTTTTCCACATATACAAGTAATCAT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NC_011655	Bacillus cereus AH187 plasmid pAH187_270, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	173924-173955	ACTTTATTTTTTCCACATATACAAGTAATCAT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NC_010924	Bacillus cereus strain AH187 plasmid pCER270, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	230333-230364	ACTTTATTTTTTCCACATATACAAGTAATCAT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	CP045776	Bacillus paranthracis strain CFSAN068816 plasmid p1CFSAN068816, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	222758-222789	ACTTTATTTTTTCCACATATACAAGTAATCAT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP053994	Bacillus cereus strain FDAARGOS_780 plasmid unnamed1, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	114319-114350	ATGATTACTTGTATATGTGGAAAAAATAAAGT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	CP041980	Bacillus paranthracis strain NCCP 15910 plasmid unnamed, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	105181-105212	ACTTTATTTTTTCCACATATACAAGTAATCAT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NC_016792	Bacillus cereus NC7401 plasmid pNCcld, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	229202-229233	ACTTTATTTTTTCCACATATACAAGTAATCAT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP040343	Bacillus cereus strain DLOU-Weihai plasmid unnamed1, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	338244-338275	ATGATTACTTGTATATGTGGAAAAAATAAAGT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP033789	Bacillus sp. FDAARGOS_527 plasmid unnamed2, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	247748-247779	ATGATTACTTGTATATGTGGAAAAAATAAAGT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	NZ_CP053992	Bacillus cereus strain FDAARGOS_781 plasmid unnamed2, complete sequence	GGCTACGCATGGATATGTGGAAAAAACAAAGT	97335-97366	ATGATTACTTGTATATGTGGAAAAAATAAAGT	2	0.71875	8
NZ_CP014034	2.19|860965|32|NZ_CP014034|CRT,PILER-CR,CRISPRCasFinder	MN693807	Marine virus AFVG_250M375, complete genome	GGCTACGCATGGATATGTGGAAAAAACAAAGT	40833-40864	ACATTGTTTTTTCCACACATCCAAAGAGTTCC	2	0.71875	9
NZ_CP014035	1.1|709975|29|NZ_CP014035|PILER-CR	NZ_CP046854	Vibrio fluvialis strain F8658 plasmid unnamed1, complete sequence	TGGAGCTTTTTTGCCGCAAAACTGGCAGC	34357-34385	GCTGCCAGTTTTGCGGCAAAAAAGCTCCA	0	1.0	0
NZ_CP014035	1.1|709975|29|NZ_CP014035|PILER-CR	MN694290	Marine virus AFVG_250M636, complete genome	TGGAGCTTTTTTGCCGCAAAACTGGCAGC	36357-36385	TTGGGCATTTTTGCCCCAAAACTGGCACC	2	0.7931034482758621	5
NZ_CP014035	1.3|709974|32|NZ_CP014035|CRISPRCasFinder	NZ_CP046854	Vibrio fluvialis strain F8658 plasmid unnamed1, complete sequence	TTGGAGCTTTTTTGCCGCAAAACTGGCAGCTT	34355-34386	AAGCTGCCAGTTTTGCGGCAAAAAAGCTCCAA	0	1.0	0
NZ_CP014035	1.3|709974|32|NZ_CP014035|CRISPRCasFinder	NC_015184	Agrobacterium sp. H13-3 plasmid pAspH13-3a, complete sequence	TTGGAGCTTTTTTGCCGCAAAACTGGCAGCTT	334124-334155	GAGCTACCCGTTTTGCGGCAAAAACGGGGTGC	2	0.71875	10
