The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP014252	Listeria monocytogenes strain CFSAN023459, complete genome	3039887	125863	132390	3039887	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003728215.1|125863_126316_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|126321_126657_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_009927883.1|126873_127302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731177.1|127313_127730_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	37.9	6.5e-20
WP_003728212.1|128009_128399_+	DUF5072 domain-containing protein	NA	NA	NA	NA	NA
WP_003721744.1|128411_128924_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|128971_129274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003740367.1|129315_129720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928420.1|129706_131575_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	4.5e-20
WP_003734720.1|131571_132390_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
NZ_CP014252	Listeria monocytogenes strain CFSAN023459, complete genome	3039887	689742	745229	3039887	holin,integrase,portal,head,capsid,transposase,terminase,tail,protease	Listeria_phage(48.39%)	64	682448:682465	742977:742994
682448:682465	attL	AGCCTTCTAAATCATTTT	NA	NA	NA	NA
WP_012951296.1|689742_690894_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	46.3	3.4e-87
WP_031641924.1|690915_691629_-	lipoprotein	NA	NA	NA	NA	NA
WP_031641923.1|691683_692184_-	hypothetical protein	NA	A0A1S7FYX8	Listeria_phage	31.1	7.1e-13
WP_031641922.1|692184_692535_-	helix-turn-helix domain-containing protein	NA	A0A059T669	Listeria_phage	49.0	2.3e-18
WP_031641921.1|692688_692886_+	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	52.3	7.5e-11
WP_031641920.1|692908_693235_+	DUF771 domain-containing protein	NA	A0A2H4J474	uncultured_Caudovirales_phage	41.5	4.9e-15
WP_031641918.1|694447_694804_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060868931.1|695404_695929_+	hypothetical protein	NA	A0A059T5F9	Listeria_phage	94.8	2.3e-94
WP_003731843.1|696120_696336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060868932.1|696414_697008_+	pentapeptide repeat-containing protein	NA	A8ATE4	Listeria_phage	88.1	1.9e-41
WP_009932913.1|697050_697152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003731837.1|697135_697744_+	hypothetical protein	NA	A8ATU1	Listeria_phage	49.5	1.4e-55
WP_014601398.1|698318_698780_+	hypothetical protein	NA	D9J0I6	Brochothrix_phage	29.9	5.5e-12
WP_149806097.1|698937_699237_+	hypothetical protein	NA	R4IBL7	Listeria_phage	91.1	3.6e-20
WP_012951314.1|699237_699717_+	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	77.5	2.9e-64
WP_012951315.1|699770_699962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951316.1|700021_700540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951317.1|700536_701079_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	53.3	4.3e-48
WP_012951318.1|701360_701588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_102578311.1|701613_701889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049961585.1|701885_702248_+	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	44.1	3.5e-14
WP_012951321.1|702342_702870_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	46.7	6.1e-31
WP_012951322.1|702838_704590_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	50.7	4.1e-156
WP_023552290.1|704596_704797_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_012951323.1|704799_706035_+|portal	phage portal protein	portal	A0A2H4JAR2	uncultured_Caudovirales_phage	42.1	3.6e-82
WP_012951324.1|706031_706598_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1D6Z2A7	Staphylococcus_phage	52.2	1.0e-44
WP_102135612.1|706655_707831_+|capsid	phage major capsid protein	capsid	A0A060AI54	Enterococcus_phage	38.1	2.2e-44
WP_012951326.1|707879_708218_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	37.8	8.1e-13
WP_012951327.1|708187_708508_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_012951328.1|708501_708867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951329.1|708869_709268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031641752.1|709288_709864_+|tail	phage major tail protein	tail	M1PRQ7	Streptococcus_phage	42.9	9.2e-33
WP_012951331.1|709953_710301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951333.1|710497_714697_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	33.0	1.2e-12
WP_012951334.1|714689_716933_+	minor structural protein GP75	NA	A0A059T682	Listeria_phage	29.4	1.6e-56
WP_031641434.1|716938_719230_+	phage minor structural protein	NA	A0A059T7Y6	Listeria_phage	38.1	3.4e-134
WP_031641433.1|719222_720284_+	hypothetical protein	NA	A8ATW1	Listeria_phage	68.6	1.6e-94
WP_003722523.1|720322_720688_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722522.1|720700_720982_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_012951337.1|720981_721827_+	peptidase M15	NA	A0A059T7Y8	Listeria_phage	93.3	4.8e-139
WP_003724378.1|722679_723351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724379.1|723380_723566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724380.1|724106_724640_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_014929420.1|724703_725621_+	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_021496183.1|725886_727767_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.1	8.3e-107
WP_003724383.1|727861_728590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003724384.1|728729_729380_+	TalA family protein	NA	M4SLG0	Cyanophage	29.3	1.7e-14
WP_003740476.1|729422_731243_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	28.7	7.7e-49
WP_060868934.1|731477_732869_+	amino acid permease	NA	NA	NA	NA	NA
WP_009928457.1|732958_733798_+	VOC family protein	NA	NA	NA	NA	NA
WP_003721764.1|733880_734165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003724388.1|734262_735213_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_003724389.1|735236_735878_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003727229.1|735920_738611_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_003731019.1|738656_739304_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003731020.1|739313_739850_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003740477.1|739836_740829_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_003721771.1|741019_741229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727224.1|741296_742004_+	serine/threonine protein phosphatase	NA	A0A249Y183	Enterococcus_phage	28.2	1.3e-20
WP_060868935.1|742049_742613_-	DUF420 domain-containing protein	NA	NA	NA	NA	NA
WP_003724397.1|742732_743149_+	hypothetical protein	NA	NA	NA	NA	NA
742977:742994	attR	AAAATGATTTAGAAGGCT	NA	NA	NA	NA
WP_009928463.1|743191_743821_+	endonuclease III domain-containing protein	NA	NA	NA	NA	NA
WP_023550362.1|743817_744714_-	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003724400.1|744947_745229_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP014252	Listeria monocytogenes strain CFSAN023459, complete genome	3039887	1161132	1168555	3039887		Hokovirus(33.33%)	8	NA	NA
WP_003730941.1|1161132_1161516_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003727002.1|1161537_1162521_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	33.8	2.0e-11
WP_026747136.1|1162535_1163549_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	1.8e-10
WP_003721509.1|1163757_1165248_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_023550416.1|1165259_1166084_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.2	1.3e-67
WP_009929872.1|1166096_1166405_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_009929871.1|1166465_1166870_+	PTS lactose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_023550418.1|1166998_1168555_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	29.2	6.0e-18
>prophage 4
NZ_CP014252	Listeria monocytogenes strain CFSAN023459, complete genome	3039887	1290165	1334286	3039887	tRNA,protease,integrase	Streptococcus_phage(18.18%)	45	1290128:1290148	1291788:1291808
1290128:1290148	attL	ATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_075356968.1|1290165_1290267_-|integrase	integrase	integrase	A0A059T688	Listeria_phage	63.6	7.0e-05
WP_003726037.1|1290663_1291137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009928186.1|1291242_1291605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031645846.1|1294781_1296845_+	LapB repeat-containing protein	NA	NA	NA	NA	NA
1291788:1291808	attR	ATGTTTTAGAGATTTTTTTAT	NA	NA	NA	NA
WP_003726042.1|1296967_1298326_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
WP_003726043.1|1298368_1298962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726044.1|1299098_1299506_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_003726045.1|1299670_1300270_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	41.0	1.3e-29
WP_009928848.1|1300301_1300562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023550481.1|1300685_1302098_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	4.9e-51
WP_003726048.1|1302122_1302386_+	DUF3116 domain-containing protein	NA	NA	NA	NA	NA
WP_003727535.1|1302553_1303030_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003726050.1|1303067_1303313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726051.1|1303309_1304515_-	MFS transporter	NA	NA	NA	NA	NA
WP_003726058.1|1304535_1304721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726052.1|1304719_1305379_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003726053.1|1305418_1305613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726054.1|1305679_1306528_-	YitT family protein	NA	NA	NA	NA	NA
WP_003726055.1|1307145_1307859_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_014929571.1|1307889_1309536_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_003727531.1|1309554_1311039_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_003726723.1|1311156_1311618_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|1311656_1312121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003726718.1|1312309_1313224_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023550483.1|1313249_1314497_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.8	7.2e-107
WP_003726720.1|1314480_1315311_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.4	3.6e-46
WP_003734523.1|1315457_1316597_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1316676_1317072_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1317222_1317438_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003727523.1|1317561_1318095_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003731300.1|1318110_1318776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003727521.1|1319037_1319976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1320090_1321374_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1321558_1322818_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003726393.1|1322936_1323503_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003726394.1|1323537_1324107_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003727520.1|1324208_1324751_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003726396.1|1324760_1325624_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003727519.1|1325620_1326406_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.6	6.7e-26
WP_003727518.1|1326539_1327400_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003727517.1|1327672_1329751_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	5.4e-107
WP_003726401.1|1329813_1331118_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_023550485.1|1331400_1332303_+	tyrosine recombinase XerC	NA	A0A142K7N4	Mycobacterium_phage	29.5	1.8e-14
WP_031641425.1|1332323_1332863_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_003727514.1|1332876_1334286_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	7.5e-44
>prophage 5
NZ_CP014252	Listeria monocytogenes strain CFSAN023459, complete genome	3039887	1804341	1837207	3039887	holin,portal,head,capsid,terminase,tail,protease	Erysipelothrix_phage(67.74%)	38	NA	NA
WP_014929970.1|1804341_1805256_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D8ETE4	Propionibacterium_phage	44.0	3.9e-33
WP_025186379.1|1805245_1805659_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	57.0	1.5e-37
WP_003731143.1|1805707_1806127_-	DUF1617 family protein	NA	A0A1S5RCP5	Lactobacillus_phage	26.5	2.4e-06
WP_003731141.1|1806287_1810352_-	hypothetical protein	NA	A0A1B1P770	Bacillus_phage	41.8	8.7e-85
WP_003731140.1|1810336_1811029_-	hypothetical protein	NA	A0A1L2BYA2	Clostridium_phage	29.0	1.7e-20
WP_003731139.1|1811044_1813606_-	hypothetical protein	NA	A0A2K5B297	Erysipelothrix_phage	74.1	3.9e-83
WP_003731138.1|1813673_1814318_-	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_003731137.1|1814569_1814953_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	64.2	5.4e-37
WP_003731136.1|1814962_1815553_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	72.2	4.1e-76
WP_029645088.1|1815554_1815863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731135.1|1815889_1816321_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	59.4	7.6e-40
WP_003731134.1|1816313_1816652_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	54.7	1.7e-23
WP_003731133.1|1816648_1816960_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	74.0	2.2e-36
WP_003731132.1|1816970_1818188_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	48.0	1.1e-102
WP_095591263.1|1818191_1818944_-|protease	Clp protease ClpP	protease	M1PLE5	Streptococcus_phage	55.7	1.9e-62
WP_014929974.1|1818840_1820202_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	74.0	2.7e-179
WP_100066221.1|1820269_1820530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088518322.1|1820661_1822254_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	84.8	7.2e-269
WP_003731127.1|1822314_1822539_-	hypothetical protein	NA	A0A2K5B284	Erysipelothrix_phage	48.6	2.0e-15
WP_003731126.1|1822528_1822726_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_003731125.1|1822700_1822895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731124.1|1822897_1823287_-	DUF4314 domain-containing protein	NA	E4ZFL7	Streptococcus_phage	71.0	3.1e-16
WP_003731123.1|1823375_1824626_-	site-specific DNA-methyltransferase	NA	A0A2I4R670	Erysipelothrix_phage	62.0	7.4e-144
WP_014929976.1|1824615_1825233_-	HNH endonuclease	NA	A0A0B5HE03	Vibrio_phage	37.6	1.1e-12
WP_014929977.1|1825217_1826000_-	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_031641527.1|1826004_1826583_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	52.8	1.2e-53
WP_031641526.1|1826715_1827081_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	56.9	1.4e-31
WP_003731117.1|1827248_1827677_-	DUF1492 domain-containing protein	NA	A0A2K5B275	Erysipelothrix_phage	45.8	1.5e-27
WP_014929979.1|1827673_1829026_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	69.0	6.8e-159
WP_003731115.1|1829025_1829310_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	60.2	3.5e-25
WP_003731114.1|1829306_1829516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731113.1|1829653_1831897_-	hypothetical protein	NA	A0A1B0RXC5	Streptococcus_phage	49.7	4.8e-210
WP_014929980.1|1831889_1832234_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	51.4	4.1e-28
WP_014929981.1|1832226_1832997_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	50.8	2.7e-64
WP_003731110.1|1833207_1835145_-	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	68.6	7.7e-265
WP_003731109.1|1835205_1835748_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	77.2	8.9e-78
WP_003731108.1|1835749_1836892_-	DUF2800 domain-containing protein	NA	M1Q218	Streptococcus_phage	57.8	1.5e-122
WP_010821424.1|1836892_1837207_-	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	41.5	6.6e-09
>prophage 6
NZ_CP014252	Listeria monocytogenes strain CFSAN023459, complete genome	3039887	1918284	1926570	3039887		Synechococcus_phage(33.33%)	8	NA	NA
WP_003726209.1|1918284_1918851_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.4	8.3e-26
WP_003726210.1|1918847_1919897_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	3.2e-63
WP_003722245.1|1919915_1921343_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_009918191.1|1921327_1923547_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.8	6.5e-159
WP_003726212.1|1923539_1924223_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1924226_1924472_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003726214.1|1924483_1925197_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	2.0e-40
WP_003729814.1|1925277_1926570_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 7
NZ_CP014252	Listeria monocytogenes strain CFSAN023459, complete genome	3039887	2453580	2496851	3039887	holin,integrase,portal,capsid,terminase,tail,plate	Listeria_phage(95.16%)	64	2450871:2450886	2489746:2489761
2450871:2450886	attL	TGCAAAAATCACTTTC	NA	NA	NA	NA
WP_031641268.1|2453580_2453778_-	hypothetical protein	NA	A8ATC6	Listeria_phage	66.7	1.3e-15
WP_012951563.1|2453774_2454008_-	hypothetical protein	NA	A8ATC5	Listeria_phage	98.7	1.6e-36
WP_012951561.1|2454448_2454631_+	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	96.6	2.3e-22
WP_003722520.1|2454904_2455678_+	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_060868954.1|2455718_2456570_-	peptidase M15	NA	A0A059T7Y8	Listeria_phage	90.8	1.5e-140
WP_031643043.1|2456569_2456851_-|holin	holin	holin	R4IDW2	Listeria_phage	95.7	5.3e-42
WP_003722523.1|2456863_2457229_-	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722524.1|2457256_2457415_-	hypothetical protein	NA	Q9T1A1	Listeria_phage	100.0	6.0e-19
WP_003722525.1|2457419_2457737_-	hypothetical protein	NA	Q9T1A2	Listeria_phage	100.0	6.2e-55
WP_003722526.1|2457748_2458822_-|plate	phage baseplate upper protein	plate	Q9T1A3	Listeria_phage	100.0	4.5e-198
WP_014931687.1|2458821_2459850_-	hypothetical protein	NA	Q9T1A4	Listeria_phage	98.8	2.1e-189
WP_031645706.1|2459850_2460876_-	phage minor structural protein	NA	Q9T1A5	Listeria_phage	93.3	3.9e-191
WP_031645707.1|2460884_2461703_-|tail	phage tail family protein	tail	Q9T1A6	Listeria_phage	93.4	3.8e-149
WP_060868955.1|2461704_2467068_-	tape measure protein	NA	Q9T1A7	Listeria_phage	90.7	0.0e+00
WP_031644596.1|2467083_2467683_-	hypothetical protein	NA	A0A0B5CTW0	Listeria_phage	68.0	8.1e-72
WP_031644594.1|2467688_2468111_-	hypothetical protein	NA	Q9T1A9	Listeria_phage	99.3	2.0e-69
WP_031645709.1|2468162_2468495_-	Ig domain-containing protein	NA	Q9T1B0	Listeria_phage	84.5	1.3e-39
WP_010990223.1|2468424_2468862_-	hypothetical protein	NA	A8ASK2	Listeria_phage	99.3	2.5e-78
WP_031645710.1|2468864_2469272_-	hypothetical protein	NA	A0A0B5CU21	Listeria_phage	98.5	1.5e-66
WP_031645711.1|2469271_2469610_-	hypothetical protein	NA	A0A059T7W4	Listeria_phage	97.3	7.0e-57
WP_031645712.1|2469609_2469972_-	hypothetical protein	NA	A0A0B5D151	Listeria_phage	91.7	1.8e-58
WP_031645713.1|2469971_2470367_-	hypothetical protein	NA	A8ASJ8	Listeria_phage	84.0	5.9e-55
WP_077918248.1|2470368_2470527_-	hypothetical protein	NA	Q9T1B6	Listeria_phage	92.3	2.5e-17
WP_031645714.1|2470526_2471426_-|capsid	phage major capsid protein	capsid	Q9T1B7	Listeria_phage	99.7	1.0e-166
WP_031645715.1|2471449_2472019_-	scaffolding protein	NA	Q9T1B8	Listeria_phage	96.8	2.8e-90
WP_031645716.1|2472097_2473237_-	hypothetical protein	NA	A8ASJ4	Listeria_phage	96.0	8.7e-200
WP_031645717.1|2473242_2474733_-|portal	phage portal protein	portal	A0A0B5D0F2	Listeria_phage	98.0	1.2e-278
WP_060868956.1|2474745_2476077_-|terminase	PBSX family phage terminase large subunit	terminase	A8ASJ2	Listeria_phage	98.6	6.0e-261
WP_060868957.1|2476045_2476588_-|terminase	terminase small subunit	terminase	A8ASJ1	Listeria_phage	97.8	3.5e-90
WP_010990212.1|2476645_2476909_-	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	78.2	1.7e-34
WP_009911405.1|2476935_2477235_-	phage protein	NA	A0A2H4JBC0	uncultured_Caudovirales_phage	40.7	3.8e-14
WP_010990210.1|2477629_2478064_-	hypothetical protein	NA	A8AU03	Listeria_phage	94.4	2.6e-72
WP_023548496.1|2478204_2478588_-	DUF2481 domain-containing protein	NA	A8ASP8	Listeria_phage	96.1	4.4e-63
WP_042227941.1|2478591_2478996_-	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	94.8	1.4e-64
WP_003734994.1|2478940_2479132_-	hypothetical protein	NA	A8ASP6	Listeria_phage	100.0	8.0e-26
WP_060868958.1|2479150_2479633_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.1	3.7e-67
WP_031645862.1|2479629_2480214_-	DUF3310 domain-containing protein	NA	A0A059T5J6	Listeria_phage	75.3	1.2e-75
WP_023548489.1|2480229_2480577_-	hypothetical protein	NA	A0A059T8V4	Listeria_phage	87.8	2.1e-56
WP_023548487.1|2480590_2480818_-	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	97.3	8.6e-35
WP_060868959.1|2481021_2481732_-	pentapeptide repeat-containing protein	NA	A0A060AFJ6	Listeria_phage	94.6	3.0e-33
WP_060868960.1|2481902_2482424_-	hypothetical protein	NA	A0A059T7V5	Listeria_phage	48.3	1.1e-32
WP_031645727.1|2482420_2482975_-	DUF1642 domain-containing protein	NA	A8ATY9	Listeria_phage	79.0	7.2e-83
WP_031645728.1|2482971_2483652_-	hypothetical protein	NA	A8ATD7	Listeria_phage	96.0	6.9e-120
WP_023548469.1|2483664_2484609_-|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	98.4	1.7e-177
WP_031645729.1|2484619_2485333_-	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	96.2	2.1e-127
WP_031645730.1|2485329_2486241_-	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	92.1	5.2e-139
WP_012582380.1|2486261_2487077_-	recombinase RecT	NA	A0A0B5CTU3	Listeria_phage	99.3	5.9e-150
WP_060868961.1|2487076_2488036_-	YqaJ viral recombinase family protein	NA	A8ATY5	Listeria_phage	97.5	4.8e-175
WP_010989962.1|2488267_2488456_-	hypothetical protein	NA	Q9T175	Listeria_phage	79.0	2.0e-21
WP_010991175.1|2488563_2488779_-	hypothetical protein	NA	Q9T176	Listeria_phage	91.5	2.2e-27
WP_031641947.1|2488775_2489309_-	hypothetical protein	NA	A0A0B5D173	Listeria_phage	86.7	1.1e-77
WP_031644189.1|2489430_2490210_-	antirepressor	NA	A0A059T6E7	Listeria_phage	96.5	7.6e-139
2489746:2489761	attR	TGCAAAAATCACTTTC	NA	NA	NA	NA
WP_025370647.1|2490273_2490516_+	hypothetical protein	NA	A0A059T7Q3	Listeria_phage	98.8	1.5e-37
WP_003769995.1|2490701_2490983_-	hypothetical protein	NA	Q9T180	Listeria_phage	96.8	1.4e-39
WP_003733634.1|2490979_2491216_-	hypothetical protein	NA	A0A059T5E9	Listeria_phage	100.0	3.3e-37
WP_003769996.1|2491255_2491540_-	hypothetical protein	NA	A0A0B5D168	Listeria_phage	98.9	1.6e-46
WP_003735007.1|2491551_2491746_-	hypothetical protein	NA	A0A059T6E5	Listeria_phage	100.0	1.3e-26
WP_014930212.1|2491766_2492000_-	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	97.3	5.4e-32
WP_060868962.1|2492162_2492639_+	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	78.9	4.9e-56
WP_012582373.1|2492795_2492963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003770015.1|2493684_2494560_+	hypothetical protein	NA	A0A0B5D0D1	Listeria_phage	94.5	2.2e-150
WP_060868963.1|2494623_2495982_+	recombinase family protein	NA	Q9T193	Listeria_phage	97.6	9.5e-254
WP_003733645.1|2495972_2496449_+	competence protein ComK	NA	NA	NA	NA	NA
WP_003739618.1|2496503_2496851_-	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	40.7	9.9e-06
>prophage 8
NZ_CP014252	Listeria monocytogenes strain CFSAN023459, complete genome	3039887	2641174	2649016	3039887		Streptococcus_phage(50.0%)	7	NA	NA
WP_003725407.1|2641174_2642146_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003731212.1|2642153_2643122_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.6	1.8e-68
WP_003722606.1|2643123_2643999_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003725409.1|2644106_2645837_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.1	9.5e-174
WP_077915067.1|2645878_2646940_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_009918601.1|2646956_2647940_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	3.1e-52
WP_003722610.1|2648056_2649016_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 1
NZ_CP014254	Listeria monocytogenes strain CFSAN023459 plasmid CFSAN023459_02, complete sequence	52687	9626	16608	52687	integrase,transposase	Streptococcus_phage(66.67%)	6	1811:1829	15856:15874
1811:1829	attL	AAAACTTTGCAACAGAACC	NA	NA	NA	NA
WP_011011045.1|9626_10307_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	69.5	5.5e-93
WP_023558764.1|10366_10870_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.9	6.6e-19
WP_003726381.1|11514_13632_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	62.6	5.3e-235
WP_003726380.1|13628_13988_-	winged helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	48.2	5.4e-23
WP_003725299.1|14261_14861_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	31.8	1.8e-15
WP_003759224.1|15927_16608_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	69.9	1.5e-93
15856:15874	attR	GGTTCTGTTGCAAAGTTTT	NA	NA	NA	NA
