The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	0	9036	5944658		Bacillus_thuringiensis_phage(50.0%)	6	NA	NA
WP_004127091.1|3024_3657_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_049131453.1|4241_4748_+	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_004132876.1|4936_6310_+	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_004127096.1|6346_6457_-	YshB family small membrane protein	NA	NA	NA	NA	NA
WP_004107350.1|6568_7978_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.3	4.8e-06
WP_004127098.1|7986_9036_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	25.7	2.2e-08
>prophage 2
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	21672	24444	5944658		Staphylococcus_phage(50.0%)	3	NA	NA
WP_064342032.1|21672_22563_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	94.6	2.7e-63
WP_064342033.1|22728_23625_+	sugar kinase	NA	NA	NA	NA	NA
WP_064342034.1|23658_24444_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.6	1.7e-24
>prophage 3
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	27464	28382	5944658		Pandoravirus(100.0%)	1	NA	NA
WP_024360706.1|27464_28382_-	alpha/beta hydrolase	NA	S4W4Z4	Pandoravirus	28.7	5.1e-17
>prophage 4
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	71595	73107	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_049085924.1|71595_73107_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.5	6.7e-14
>prophage 5
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	81365	84892	5944658		Bacillus_thuringiensis_phage(33.33%)	4	NA	NA
WP_004127220.1|81365_81986_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_024360578.1|82057_82732_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004107505.1|82823_84197_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	23.3	4.5e-09
WP_004127228.1|84193_84892_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	4.0e-06
>prophage 6
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	89565	90900	5944658		Erwinia_phage(100.0%)	1	NA	NA
WP_024360576.1|89565_90900_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	30.3	1.1e-44
>prophage 7
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	103297	106008	5944658		Escherichia_phage(50.0%)	3	NA	NA
WP_024360573.1|103297_104047_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	34.6	2.7e-24
WP_024360572.1|104185_105289_-	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_004107558.1|105345_106008_-	fructose-6-phosphate aldolase	NA	M4SLG0	Cyanophage	34.0	3.5e-28
>prophage 8
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	120748	122617	5944658		Acinetobacter_phage(100.0%)	1	NA	NA
WP_029669986.1|120748_122617_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	28.3	1.3e-06
>prophage 9
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	132690	134337	5944658		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_024360643.1|132690_134337_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.8	3.7e-66
>prophage 10
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	143971	150215	5944658		Vibrio_phage(33.33%)	5	NA	NA
WP_049131533.1|143971_144694_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.0	1.6e-21
WP_024360636.1|144796_146815_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.2	2.1e-111
WP_004133298.1|146818_147781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004133297.1|147764_149180_-	cytosine permease	NA	NA	NA	NA	NA
WP_024360633.1|149198_150215_-	ADP-ribosylglycohydrolase family protein	NA	A0A172WZB4	Catopsilia_pomona_nucleopolyhedrovirus	26.1	2.8e-08
>prophage 11
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	155748	157685	5944658		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_024360632.1|155748_157014_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.8	6.3e-42
WP_004097507.1|157355_157685_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	2.5e-14
>prophage 12
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	161735	166013	5944658		Catovirus(33.33%)	4	NA	NA
WP_024360631.1|161735_162866_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.7	4.3e-26
WP_004133284.1|162862_164125_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.6	1.4e-25
WP_064342050.1|164203_164878_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_024360629.1|164882_166013_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	42.5	3.0e-19
>prophage 13
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	174041	175694	5944658		Tetraselmis_virus(100.0%)	1	NA	NA
WP_064342052.1|174041_175694_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.7	1.4e-44
>prophage 14
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	185700	189559	5944658		uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_004133253.1|185700_186603_+	tyrosine recombinase XerC	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.9	1.7e-17
WP_004133252.1|186602_187319_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_004127467.1|187396_189559_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	7.8e-117
>prophage 15
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	193410	195237	5944658		Catovirus(100.0%)	1	NA	NA
WP_004133244.1|193410_195237_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.6	3.7e-83
>prophage 16
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	205896	212074	5944658		Alteromonas_phage(33.33%)	7	NA	NA
WP_024360614.1|205896_207345_+	DNA recombination protein RmuC	NA	R9RFD7	Alteromonas_phage	58.2	1.1e-08
WP_004127530.1|207415_208171_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_004870452.1|208184_208790_+	SCP2 domain-containing protein	NA	NA	NA	NA	NA
WP_064342058.1|208786_210427_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.9	1.5e-40
WP_004127537.1|210503_210755_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_024360611.1|210758_211298_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004097593.1|211300_212074_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.0	1.5e-25
>prophage 17
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	221165	221780	5944658		Streptococcus_phage(100.0%)	1	NA	NA
WP_064342060.1|221165_221780_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	32.1	1.6e-19
>prophage 18
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	231532	254278	5944658		uncultured_Mediterranean_phage(14.29%)	18	NA	NA
WP_004127574.1|231532_232483_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	31.6	3.9e-28
WP_004097636.1|233483_234668_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
WP_004097638.1|234900_235284_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_002438628.1|235285_235831_+	transcription termination/antitermination protein NusG	NA	A0A291AUS6	Sinorhizobium_phage	29.1	3.1e-14
WP_004097640.1|235984_236413_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_004097642.1|236416_237121_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_004097644.1|237415_237913_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_004097645.1|237979_238345_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_024360687.1|238670_242699_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	30.2	1.1e-23
WP_004127580.1|242775_246999_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.2	2.9e-67
WP_004870490.1|247408_248749_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_004870492.1|248786_249104_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_004097653.1|249107_249413_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_049132039.1|249585_251118_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.0	2.0e-10
WP_024360690.1|251436_252570_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_049087536.1|252566_253337_-	thiazole synthase	NA	NA	NA	NA	NA
WP_004870502.1|253338_253539_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_064342061.1|253522_254278_-	molybdopterin-synthase adenylyltransferase MoeB	NA	A0A1V0SCZ9	Indivirus	28.1	9.4e-09
>prophage 19
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	259535	268301	5944658		Klosneuvirus(25.0%)	9	NA	NA
WP_024360693.1|259535_260207_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	31.8	3.6e-20
WP_004097673.1|260249_260840_+	YjaG family protein	NA	NA	NA	NA	NA
WP_004097675.1|261026_261299_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	56.7	1.2e-19
WP_004870522.1|261311_262004_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_024360694.1|262016_262439_-	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_004870525.1|262690_264079_+	two-component system sensor histidine kinase ZraS	NA	NA	NA	NA	NA
WP_004870527.1|264075_265407_+	sigma-54-dependent response regulator transcription factor ZraR	NA	Q6XM27	Feldmannia_irregularis_virus	31.6	1.4e-07
WP_024360696.1|265403_266696_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_024360697.1|266711_268301_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.1	3.2e-67
>prophage 20
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	282037	285721	5944658		Dickeya_phage(100.0%)	1	NA	NA
WP_024360170.1|282037_285721_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	4.9e-26
>prophage 21
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	301901	302690	5944658		Pseudomonas_phage(100.0%)	1	NA	NA
WP_064343370.1|301901_302690_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	46.3	3.3e-49
>prophage 22
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	312457	313567	5944658		Mycoplasma_phage(100.0%)	1	NA	NA
WP_004097762.1|312457_313567_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 23
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	320702	321311	5944658		Lactococcus_phage(100.0%)	1	NA	NA
WP_004097774.1|320702_321311_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	40.7	7.8e-14
>prophage 24
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	327039	329680	5944658		Escherichia_phage(50.0%)	2	NA	NA
WP_024360186.1|327039_328455_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	3.7e-200
WP_049131411.1|328600_329680_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.3	1.5e-28
>prophage 25
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	333484	338733	5944658		uncultured_Mediterranean_phage(33.33%)	3	NA	NA
WP_004097797.1|333484_336310_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.6	0.0e+00
WP_004097799.1|336556_337084_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	96.4	3.5e-55
WP_049131408.1|337170_338733_-	lytic transglycosylase F	NA	A0A0H3V0Q1	Geobacillus_virus	40.4	1.0e-09
>prophage 26
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	350546	351896	5944658		Moraxella_phage(100.0%)	1	NA	NA
WP_024360196.1|350546_351896_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	71.4	1.5e-158
>prophage 27
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	369468	376223	5944658		Staphylococcus_phage(50.0%)	4	NA	NA
WP_004137496.1|369468_371427_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	41.7	1.6e-92
WP_004109428.1|371838_373152_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_024360207.1|373188_373872_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_077598917.1|374075_376223_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.4	1.4e-33
>prophage 28
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	383308	384289	5944658	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019445.1|383308_384289_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 29
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	387513	389046	5944658		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_004137476.1|387513_389046_-	D-allose ABC transporter ATP-binding protein AlsA	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.3	2.0e-10
>prophage 30
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	394712	396536	5944658		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_004137464.1|394712_395399_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.4	1.6e-07
WP_064342078.1|395777_396536_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.4	6.1e-16
>prophage 31
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	401872	408436	5944658		Burkholderia_virus(25.0%)	8	NA	NA
WP_024360222.1|401872_403375_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.7	1.1e-56
WP_004097873.1|403496_403802_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_049087484.1|403801_404722_-	curved DNA-binding protein	NA	A0A1V0SCV5	Indivirus	43.8	9.7e-08
WP_024360224.1|404871_405552_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	45.4	2.4e-32
WP_064342081.1|405776_406559_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_049089195.1|406595_407192_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064342082.1|407307_407895_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_064342083.1|408040_408436_+	hypothetical protein	NA	E5AGC9	Erwinia_phage	37.0	2.9e-17
>prophage 32
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	422192	427761	5944658		Cronobacter_phage(33.33%)	5	NA	NA
WP_003855929.1|422192_422486_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	2.1e-12
WP_004871165.1|422529_424176_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	69.1	5.8e-189
WP_004871163.1|424310_424664_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_004871160.1|424750_425614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049099393.1|425637_427761_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.8	2.9e-31
>prophage 33
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	438510	443728	5944658		Morganella_phage(33.33%)	6	NA	NA
WP_024360245.1|438510_439041_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.8	6.1e-47
WP_004871139.1|439181_439541_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_004871138.1|439551_439947_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_004097940.1|439957_440692_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_049086631.1|440684_442475_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	27.5	4.5e-17
WP_004117360.1|442750_443728_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	4.0e-28
>prophage 34
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	449410	449956	5944658		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_004097954.1|449410_449956_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	7.7e-29
>prophage 35
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	454595	457839	5944658		Vibrio_phage(50.0%)	2	NA	NA
WP_004871121.1|454595_455933_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	4.4e-17
WP_064342090.1|455943_457839_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.2e-59
>prophage 36
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	463740	468101	5944658		Pithovirus(50.0%)	3	NA	NA
WP_004097979.1|463740_465039_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	1.7e-66
WP_004097980.1|465190_465616_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_004871099.1|465653_468101_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.3	1.6e-65
>prophage 37
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	508141	514764	5944658		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_004098041.1|508141_508669_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	7.1e-56
WP_004098043.1|509072_510029_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024360277.1|510209_511712_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.2	7.6e-10
WP_049087211.1|511722_512748_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004128182.1|512734_513721_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_004098053.1|513765_514764_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 38
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	535495	540092	5944658		uncultured_Caudovirales_phage(33.33%)	3	NA	NA
WP_064343371.1|535495_537214_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	34.5	4.1e-20
WP_049131684.1|537231_537696_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.7	5.0e-53
WP_004128226.1|537953_540092_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	6.9e-267
>prophage 39
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	548000	554012	5944658		Enterobacteria_phage(33.33%)	5	NA	NA
WP_049088877.1|548000_548948_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	23.3	3.5e-13
WP_049131478.1|549327_552036_+	magnesium-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	26.8	5.3e-46
WP_004137191.1|552103_552490_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_004137189.1|552602_553064_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_049087203.1|553076_554012_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.5	1.0e-52
>prophage 40
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	558121	567022	5944658	tRNA	Klosneuvirus(33.33%)	6	NA	NA
WP_064342108.1|558121_560977_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.9	1.3e-140
WP_004098129.1|560976_561420_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_004136151.1|561518_563030_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.4	1.6e-47
WP_004128284.1|563297_564395_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_004136150.1|564394_565477_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_064343372.1|565519_567022_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.0	6.7e-83
>prophage 41
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	580598	589057	5944658	integrase	Planktothrix_phage(33.33%)	8	582429:582443	594280:594294
WP_049131474.1|580598_581672_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.2	4.3e-23
WP_064342112.1|581677_582502_-	phosphodiesterase	NA	NA	NA	NA	NA
582429:582443	attL	TTGACGTCAATAAAG	NA	NA	NA	NA
WP_004136134.1|582512_583400_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_049082550.1|583389_584262_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004128305.1|584452_585472_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	32.3	2.6e-46
WP_064342113.1|585601_586180_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_064342114.1|586179_587193_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_042944162.1|587785_589057_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.1	9.1e-81
594280:594294	attR	CTTTATTGACGTCAA	NA	NA	NA	NA
>prophage 42
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	597937	602653	5944658	transposase	Staphylococcus_phage(50.0%)	4	NA	NA
WP_042946163.1|597937_598507_-	hypothetical protein	NA	A0A1Q1PW40	Staphylococcus_phage	28.1	2.8e-05
WP_134899011.1|598833_598995_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_000227969.1|599526_600603_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001189111.1|601144_602653_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
>prophage 43
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	609315	612134	5944658		Staphylococcus_phage(100.0%)	2	NA	NA
WP_053086595.1|609315_610527_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	29.7	2.5e-32
WP_042944181.1|610526_612134_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	55.0	8.3e-156
>prophage 44
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	618485	618728	5944658		Vibrio_phage(100.0%)	1	NA	NA
WP_071830629.1|618485_618728_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	41.7	2.1e-07
>prophage 45
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	622941	624543	5944658		Yersinia_phage(50.0%)	3	NA	NA
WP_042944188.1|622941_623766_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	36.5	2.4e-42
WP_049100007.1|623771_624020_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_042944189.1|624099_624543_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	27.3	6.1e-08
>prophage 46
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	640961	642326	5944658		Burkholderia_virus(100.0%)	1	NA	NA
WP_004133468.1|640961_642326_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.4	7.8e-46
>prophage 47
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	655061	660784	5944658		Staphylococcus_phage(50.0%)	3	NA	NA
WP_049087256.1|655061_657791_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.6e-21
WP_024360454.1|657787_658855_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_064342125.1|659386_660784_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.9	2.0e-20
>prophage 48
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	669058	672445	5944658	holin	Serratia_phage(100.0%)	1	NA	NA
WP_064342127.1|669058_672445_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
>prophage 49
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	678181	678766	5944658		Moraxella_phage(100.0%)	1	NA	NA
WP_004133049.1|678181_678766_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.3	6.6e-10
>prophage 50
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	695100	696938	5944658		Streptococcus_phage(50.0%)	2	NA	NA
WP_004133194.1|695100_696312_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	32.9	2.7e-58
WP_004133192.1|696311_696938_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.3	1.9e-55
>prophage 51
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	720689	721670	5944658	transposase	Thermus_phage(100.0%)	1	NA	NA
WP_049130515.1|720689_721670_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	6.0e-24
>prophage 52
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	733091	734114	5944658		Tupanvirus(100.0%)	1	NA	NA
WP_004134210.1|733091_734114_+	zinc-binding alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	27.1	8.5e-13
>prophage 53
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	741117	744274	5944658	transposase	Paramecium_bursaria_Chlorella_virus(50.0%)	3	NA	NA
WP_064342139.1|741117_742179_+	SIS domain-containing protein	NA	M1I2B0	Paramecium_bursaria_Chlorella_virus	23.4	1.5e-07
WP_004134216.1|742197_743208_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_162685346.1|743341_744274_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.9	9.0e-70
>prophage 54
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	747436	748716	5944658		Shigella_phage(50.0%)	2	NA	NA
WP_014227813.1|747436_748174_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.2	1.3e-63
WP_004134226.1|748176_748716_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	59.6	2.1e-26
>prophage 55
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	762026	764730	5944658		Streptococcus_phage(50.0%)	3	NA	NA
WP_004128689.1|762026_763616_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.3	1.8e-30
WP_064342143.1|763833_764445_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_003856556.1|764568_764730_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	69.8	3.0e-13
>prophage 56
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	769394	770717	5944658		Geobacillus_virus(100.0%)	1	NA	NA
WP_064342145.1|769394_770717_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	41.1	4.0e-79
>prophage 57
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	777026	782236	5944658		Enterococcus_phage(33.33%)	3	NA	NA
WP_004132285.1|777026_778259_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	43.8	3.1e-86
WP_014227837.1|778357_780025_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.6	1.4e-41
WP_049086192.1|780298_782236_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.5	3.6e-12
>prophage 58
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	786200	787625	5944658		Bacillus_phage(100.0%)	1	NA	NA
WP_064342146.1|786200_787625_+	two-component system sensor histidine kinase CreC	NA	W8CYF6	Bacillus_phage	25.9	6.7e-16
>prophage 59
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	798706	799660	5944658		Cyanophage(100.0%)	1	NA	NA
WP_004098458.1|798706_799660_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	2.8e-10
>prophage 60
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	804046	818736	5944658	tRNA	Chrysochromulina_ericina_virus(20.0%)	13	NA	NA
WP_004128758.1|804046_805963_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.6	6.4e-147
WP_024360381.1|806050_807187_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	36.0	4.7e-28
WP_004872314.1|807818_807965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024360379.1|808199_809375_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	49.6	1.4e-88
WP_004872310.1|809428_810328_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_003018940.1|810438_810702_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_049086831.1|811032_811971_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_004872303.1|812015_814832_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	25.9	5.1e-76
WP_024360376.1|814831_815332_+	signal peptidase II	NA	NA	NA	NA	NA
WP_004872298.1|815386_815836_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_049086835.1|815837_816788_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_064342150.1|816853_817768_+	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_064342151.1|817797_818736_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.5	5.2e-09
>prophage 61
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	824661	825630	5944658	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_077265736.1|824661_825630_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.9e-172
>prophage 62
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	842578	843727	5944658		Halovirus(100.0%)	1	NA	NA
WP_004128821.1|842578_843727_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	31.9	6.3e-49
>prophage 63
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	852903	854272	5944658		Bacillus_phage(50.0%)	2	NA	NA
WP_004098524.1|852903_853383_+	type 3 dihydrofolate reductase	NA	A0A076GDN3	Bacillus_phage	40.9	6.7e-29
WP_049085644.1|853423_854272_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	49.3	1.2e-07
>prophage 64
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	866815	872267	5944658		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_064342159.1|866815_869722_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	36.6	2.9e-21
WP_049085645.1|869909_872267_-	DNA polymerase II	NA	D0FZR7	Heterocapsa_circularisquama_DNA_virus	37.1	8.0e-06
>prophage 65
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	878538	879240	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_004872215.1|878538_879240_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	35.7	6.2e-23
>prophage 66
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	899929	901654	5944658		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_064342167.1|899929_901654_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.3	1.0e-34
>prophage 67
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	925405	928825	5944658		Rhizoctonia_fumigata_mycovirus(50.0%)	5	NA	NA
WP_024360316.1|925405_925813_+	8-oxo-dGTP diphosphatase MutT	NA	A0A0B5CYJ3	Rhizoctonia_fumigata_mycovirus	29.9	9.8e-05
WP_004872170.1|925865_926060_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_024360317.1|926069_926813_-	cell division protein ZapD	NA	NA	NA	NA	NA
WP_004872162.1|926812_927433_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_049087180.1|927781_928825_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.3	5.0e-101
>prophage 68
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	933148	933700	5944658		Thiobacimonas_phage(100.0%)	1	NA	NA
WP_004872150.1|933148_933700_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	35.9	1.3e-12
>prophage 69
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	944825	946250	5944658		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_004098637.1|944825_946250_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.9	4.6e-41
>prophage 70
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	957370	963912	5944658		Mamastrovirus(33.33%)	5	NA	NA
WP_064342177.1|957370_958954_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	47.5	1.9e-19
WP_004872116.1|959034_961425_-	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_014227950.1|961628_962165_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.8	2.7e-18
WP_049130713.1|962215_962878_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_004872112.1|962985_963912_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.8e-22
>prophage 71
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	969279	977265	5944658	tRNA,transposase	unidentified_phage(33.33%)	7	NA	NA
WP_071830632.1|969279_970677_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.3	8.3e-27
WP_024360333.1|970728_971610_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_004098689.1|971671_972127_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_024360334.1|972291_973008_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_024360335.1|973007_973544_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_064342181.1|973616_976046_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.6	1.1e-37
WP_064343375.1|976284_977265_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.8	9.3e-25
>prophage 72
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	999594	1000392	5944658		Planktothrix_phage(100.0%)	1	NA	NA
WP_049131652.1|999594_1000392_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	4.6e-14
>prophage 73
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1006340	1006685	5944658		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_004098733.1|1006340_1006685_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	1.6e-27
>prophage 74
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1010800	1012240	5944658	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_004098740.1|1010800_1012240_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.5	1.8e-24
>prophage 75
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1023904	1024663	5944658		Flavobacterium_phage(100.0%)	1	NA	NA
WP_004129109.1|1023904_1024663_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	2.7e-24
>prophage 76
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1033497	1037615	5944658		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_064342195.1|1033497_1034094_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.2e-27
WP_004137985.1|1034132_1037615_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.3	9.4e-205
>prophage 77
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1049853	1050885	5944658		Planktothrix_phage(100.0%)	1	NA	NA
WP_004129149.1|1049853_1050885_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.3	1.2e-35
>prophage 78
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1057377	1058181	5944658		Indivirus(100.0%)	1	NA	NA
WP_049131521.1|1057377_1058181_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	37.8	1.7e-40
>prophage 79
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1062222	1066433	5944658		Lactobacillus_phage(33.33%)	5	NA	NA
WP_024359140.1|1062222_1063590_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	30.1	4.8e-11
WP_024359139.1|1063661_1064417_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004133856.1|1064449_1065172_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004129160.1|1065168_1065636_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	59.7	3.8e-53
WP_004133854.1|1065701_1066433_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	37.6	1.0e-36
>prophage 80
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1070522	1071104	5944658		Caulobacter_phage(100.0%)	1	NA	NA
WP_004133848.1|1070522_1071104_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	29.6	1.1e-12
>prophage 81
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1099257	1100238	5944658	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000019445.1|1099257_1100238_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 82
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1106668	1108144	5944658		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_064342204.1|1106668_1108144_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	30.8	2.2e-46
>prophage 83
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1143264	1144782	5944658		Vibrio_phage(100.0%)	1	NA	NA
WP_064342219.1|1143264_1144782_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	48.0	5.3e-11
>prophage 84
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1155645	1215440	5944658	head,tail,plate,integrase,transposase	Vibrio_phage(60.0%)	63	1147514:1147528	1223961:1223975
1147514:1147528	attL	GCAACCTGGTCATTA	NA	NA	NA	NA
WP_071830634.1|1155645_1156551_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	58.0	9.3e-104
WP_049085721.1|1156939_1158193_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.6	1.3e-95
WP_004099297.1|1158203_1159307_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.2	1.8e-61
WP_004129421.1|1159597_1160650_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.2	1.3e-112
WP_004099299.1|1160703_1161267_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_004132534.1|1161597_1162542_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049099227.1|1162538_1163606_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024359104.1|1163828_1165397_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004132530.1|1165393_1166137_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.3	5.9e-32
WP_004132528.1|1166160_1167948_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_024359103.1|1167955_1168753_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_064342227.1|1168853_1169663_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_004132522.1|1169877_1170540_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004132520.1|1170684_1171566_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004132516.1|1171562_1172435_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_029669800.1|1172504_1173446_-	phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024359099.1|1173469_1174312_-	phosphonate ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.0	2.0e-12
WP_004133765.1|1175238_1175781_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004133763.1|1175933_1176521_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_004133761.1|1176581_1177250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052626757.1|1179896_1180532_-	helix-turn-helix domain-containing protein	NA	A0A2I7S9A5	Vibrio_phage	35.9	1.1e-05
WP_023301751.1|1180713_1180938_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	57.1	1.5e-15
WP_064342228.1|1180940_1183019_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	45.8	1.6e-167
WP_064342229.1|1183055_1184003_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	78.8	3.2e-139
WP_004114539.1|1184007_1184247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047720501.1|1184249_1184537_+	hypothetical protein	NA	C9DGL7	Escherichia_phage	53.9	4.9e-19
WP_064342230.1|1184552_1185170_+	DUF3164 family protein	NA	A0A2I7S9B0	Vibrio_phage	60.4	2.6e-65
WP_064342231.1|1185250_1185748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342232.1|1186165_1186720_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	45.0	1.9e-35
WP_064342233.1|1186716_1187109_+	transcriptional regulator	NA	A0A0C4UR27	Shigella_phage	64.1	1.7e-38
WP_064342234.1|1187114_1187438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342235.1|1187541_1188120_+	N-acetylmuramidase	NA	A0A2I7S9B9	Vibrio_phage	46.0	1.9e-38
WP_064342237.1|1188333_1188738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342238.1|1188725_1189337_+	hypothetical protein	NA	M4MB79	Vibrio_phage	39.2	8.3e-24
WP_071830635.1|1189333_1189564_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016807466.1|1189544_1189847_+	DUF2730 domain-containing protein	NA	M1Q558	Vibrio_phage	42.6	4.3e-13
WP_064342239.1|1189856_1190144_+	hypothetical protein	NA	A0A2I7S9D8	Vibrio_phage	64.5	3.2e-26
WP_064342240.1|1190146_1190422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342241.1|1190411_1190990_+	DUF3486 family protein	NA	M4MCR3	Vibrio_phage	58.7	4.4e-51
WP_064342242.1|1190986_1192576_+	hypothetical protein	NA	M4MHG0	Vibrio_phage	70.0	9.3e-200
WP_064342243.1|1192575_1194147_+	DUF935 domain-containing protein	NA	A0A2I7S9K0	Vibrio_phage	55.8	1.3e-158
WP_064342244.1|1194139_1194982_+	hypothetical protein	NA	M1PVV7	Vibrio_phage	56.9	3.5e-89
WP_171840891.1|1195214_1196186_+	peptidase	NA	M1Q578	Vibrio_phage	48.7	2.4e-73
WP_064342246.1|1196188_1197091_+|head	Mu-like prophage major head subunit gpT family protein	head	M4MB71	Vibrio_phage	61.3	2.3e-102
WP_077265740.1|1197166_1197775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342247.1|1197774_1198215_+	DUF1320 domain-containing protein	NA	A0A2I7S9E9	Vibrio_phage	47.9	8.4e-34
WP_064342248.1|1198214_1198757_+	phage virion morphogenesis protein	NA	A0A2I7S9D7	Vibrio_phage	63.1	1.9e-59
WP_064342249.1|1198753_1199365_+	hypothetical protein	NA	M1PJ94	Vibrio_phage	39.8	1.0e-37
WP_044348609.1|1199367_1199556_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_044348611.1|1199557_1201036_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1Q565	Vibrio_phage	58.2	1.0e-160
WP_016807451.1|1201045_1201399_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_044348613.1|1201402_1201786_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	44.9	1.2e-12
WP_064342250.1|1201884_1203681_+|tail	phage tail protein	tail	M4MHE6	Vibrio_phage	31.2	6.0e-62
WP_064342251.1|1203680_1204937_+	DNA circularization N-terminal domain-containing protein	NA	A0A2I7S9E8	Vibrio_phage	42.0	6.4e-87
WP_064342252.1|1204929_1206009_+|tail	phage tail protein	tail	M4M9L5	Vibrio_phage	50.6	1.2e-94
WP_064342253.1|1205999_1206539_+|plate	phage baseplate assembly protein	plate	A0A2I7S9F6	Vibrio_phage	46.2	4.3e-32
WP_019704449.1|1206535_1206988_+	phage GP46 family protein	NA	A0A2I7S9F0	Vibrio_phage	43.4	6.6e-26
WP_064342254.1|1206974_1208051_+|plate	baseplate J/gp47 family protein	plate	A0A2I7S9E5	Vibrio_phage	52.8	7.1e-103
WP_016807443.1|1208035_1208620_+	YmfQ family protein	NA	M4M9M8	Vibrio_phage	48.2	2.2e-45
WP_064342255.1|1208622_1209435_+|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	57.8	5.0e-32
WP_064342256.1|1209434_1210310_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	33.7	2.0e-23
WP_064342257.1|1212432_1212702_+	hypothetical protein	NA	H2DE47	Erwinia_phage	36.8	1.5e-06
WP_001189111.1|1213931_1215440_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
1223961:1223975	attR	TAATGACCAGGTTGC	NA	NA	NA	NA
>prophage 85
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1219260	1222976	5944658		Brazilian_cedratvirus(66.67%)	5	NA	NA
WP_049130850.1|1219260_1220079_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.2	7.8e-17
WP_004099328.1|1220092_1220902_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004129481.1|1221215_1221398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004129484.1|1221505_1222201_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.9	8.1e-07
WP_024359093.1|1222193_1222976_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	23.7	5.1e-10
>prophage 86
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1234322	1235369	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_004133729.1|1234322_1235369_-	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.3	5.8e-33
>prophage 87
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1243342	1244110	5944658		Planktothrix_phage(100.0%)	1	NA	NA
WP_064342262.1|1243342_1244110_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	38.6	1.1e-25
>prophage 88
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1267990	1277215	5944658		Bacillus_phage(60.0%)	7	NA	NA
WP_004129627.1|1267990_1268902_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	9.3e-104
WP_024359072.1|1268992_1269898_+	fructokinase	NA	NA	NA	NA	NA
WP_064342267.1|1269935_1270298_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_064342268.1|1270586_1273721_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.4	1.4e-10
WP_024359069.1|1273717_1274920_-	exonuclease subunit SbcD	NA	A0A0A0PQ58	Bacillus_phage	24.9	7.4e-08
WP_004099401.1|1275214_1275904_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	3.3e-37
WP_049087372.1|1275925_1277215_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	29.2	3.4e-27
>prophage 89
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1293607	1297947	5944658	tRNA	uncultured_Mediterranean_phage(100.0%)	4	NA	NA
WP_004129667.1|1293607_1294735_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.6	1.5e-90
WP_004133958.1|1294757_1295090_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	34.1	1.3e-10
WP_004133955.1|1295117_1296965_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_004133953.1|1296975_1297947_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.8	2.7e-45
>prophage 90
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1303104	1304772	5944658		Indivirus(50.0%)	2	NA	NA
WP_024359059.1|1303104_1304208_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.0	3.2e-50
WP_004129690.1|1304301_1304772_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	46.7	1.7e-29
>prophage 91
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1323931	1325608	5944658		Lactobacillus_phage(100.0%)	1	NA	NA
WP_064342279.1|1323931_1325608_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	26.8	4.9e-26
>prophage 92
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1337960	1343010	5944658	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_003021624.1|1337960_1338584_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_004099538.1|1338716_1339991_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.1	2.8e-130
WP_064342280.1|1340174_1342529_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.1	1.0e-223
WP_002444653.1|1342737_1343010_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	61.8	8.5e-21
>prophage 93
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1346372	1348322	5944658	transposase	Thermus_phage(50.0%)	2	NA	NA
WP_064343375.1|1346372_1347353_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.8	9.3e-25
WP_024359042.1|1347626_1348322_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	69.7	1.9e-88
>prophage 94
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1352750	1356294	5944658		Bacillus_phage(100.0%)	2	NA	NA
WP_024359038.1|1352750_1354523_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.8	3.7e-48
WP_004135998.1|1354515_1356294_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	3.7e-40
>prophage 95
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1371124	1372234	5944658		Planktothrix_phage(100.0%)	1	NA	NA
WP_004099610.1|1371124_1372234_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.1	1.0e-24
>prophage 96
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1379407	1390759	5944658		Vibrio_phage(25.0%)	12	NA	NA
WP_049131898.1|1379407_1379722_+	PTS transporter subunit EIIB	NA	A0A2I7SAJ6	Vibrio_phage	47.6	5.6e-08
WP_014228201.1|1379845_1381117_-	maltoporin	NA	NA	NA	NA	NA
WP_024359025.1|1381386_1382460_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	44.1	5.9e-73
WP_004129897.1|1382571_1382835_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_003859006.1|1382834_1382975_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_064342287.1|1382971_1383670_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024359024.1|1383770_1385225_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.5	1.5e-18
WP_004136048.1|1385199_1385670_-	sigma factor YlaC	NA	NA	NA	NA	NA
WP_004136050.1|1385796_1386363_-	maltose O-acetyltransferase	NA	NA	NA	NA	NA
WP_004099646.1|1386524_1386743_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004129911.1|1386769_1387144_-	Hha toxicity modulator TomB	NA	NA	NA	NA	NA
WP_004848339.1|1387612_1390759_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.6e-49
>prophage 97
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1396276	1403700	5944658	transposase	Sodalis_phage(25.0%)	9	NA	NA
WP_024359022.1|1396276_1396795_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.1	1.5e-21
WP_004136059.1|1396861_1397035_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_004136061.1|1397049_1397577_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_024359021.1|1397646_1398024_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_024359020.1|1398174_1398726_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	3.9e-28
WP_024359019.1|1398817_1400719_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	1.7e-43
WP_004129943.1|1400776_1401109_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004129946.1|1401108_1401714_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_024359018.1|1401825_1403700_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.0	9.5e-111
>prophage 98
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1417965	1424500	5944658		Pteropox_virus(33.33%)	6	NA	NA
WP_049088814.1|1417965_1419216_+	phospholipase	NA	A0A1B1MR92	Pteropox_virus	22.4	1.2e-24
WP_064342290.1|1419290_1421792_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.1	3.2e-114
WP_004129970.1|1421897_1422308_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_049085213.1|1422304_1422769_-	NfeD family protein	NA	NA	NA	NA	NA
WP_024359008.1|1422765_1423683_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_024359007.1|1423819_1424500_+	iron ABC transporter ATP-binding protein FetA	NA	F2Y165	Organic_Lake_phycodnavirus	31.3	2.1e-15
>prophage 99
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1427674	1428361	5944658		Planktothrix_phage(100.0%)	1	NA	NA
WP_024359143.1|1427674_1428361_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.5	5.9e-34
>prophage 100
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1436499	1438281	5944658		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_064342292.1|1436499_1438281_+	glyoxylate carboligase	NA	A0A0P0CRC5	Ostreococcus_lucimarinus_virus	27.7	6.0e-38
>prophage 101
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1445863	1447009	5944658		Streptococcus_phage(100.0%)	1	NA	NA
WP_024358998.1|1445863_1447009_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.2	7.0e-48
>prophage 102
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1458877	1461481	5944658	tRNA	Moumouvirus(50.0%)	3	NA	NA
WP_024358988.1|1458877_1460263_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	9.3e-47
WP_064342300.1|1460400_1460613_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004137856.1|1460614_1461481_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.5	1.1e-29
>prophage 103
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1472260	1472974	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_004137852.1|1472260_1472974_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	34.8	9.1e-14
>prophage 104
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1479301	1480177	5944658		Burkholderia_virus(100.0%)	1	NA	NA
WP_004137847.1|1479301_1480177_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.8	3.0e-19
>prophage 105
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1486956	1491810	5944658	tRNA	Acinetobacter_phage(33.33%)	4	NA	NA
WP_024358909.1|1486956_1488441_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.5	3.8e-46
WP_024358908.1|1488708_1490226_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	4.2e-85
WP_004130120.1|1490374_1490788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063864557.1|1490937_1491810_-	class A extended-spectrum beta-lactamase OXY-6-2	NA	A0A1B0VBP7	Salmonella_phage	74.5	8.9e-112
>prophage 106
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1496568	1498053	5944658		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_004130130.1|1496568_1498053_+	sugar ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	21.7	3.4e-10
>prophage 107
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1502062	1506707	5944658		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_064342312.1|1502062_1502782_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.3	1.7e-07
WP_064342313.1|1502774_1503542_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.2	1.7e-13
WP_004135278.1|1503538_1504645_-	ABC transporter	NA	NA	NA	NA	NA
WP_064342314.1|1504655_1505606_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004135280.1|1505777_1506707_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	26.5	4.5e-13
>prophage 108
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1513942	1515367	5944658		Bacillus_phage(100.0%)	1	NA	NA
WP_064342316.1|1513942_1515367_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	23.4	8.2e-14
>prophage 109
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1521231	1522212	5944658	transposase	Thermus_phage(100.0%)	1	NA	NA
WP_049130515.1|1521231_1522212_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	6.0e-24
>prophage 110
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1533994	1534744	5944658		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_004135321.1|1533994_1534744_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	2.0e-19
>prophage 111
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1557940	1560664	5944658		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_049088992.1|1557940_1560664_+	cation-transporting P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	27.3	1.9e-67
>prophage 112
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1570840	1572884	5944658		Bacillus_virus(50.0%)	2	NA	NA
WP_004132154.1|1570840_1571884_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	6.0e-14
WP_024358866.1|1571873_1572884_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.4	7.3e-17
>prophage 113
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1579121	1583799	5944658		Streptococcus_phage(50.0%)	5	NA	NA
WP_064342328.1|1579121_1580588_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	22.0	1.6e-17
WP_004132430.1|1580822_1581674_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004132432.1|1581723_1582365_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004132434.1|1582379_1583045_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_024358860.1|1583037_1583799_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.6e-19
>prophage 114
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1587511	1593429	5944658	holin	Catovirus(50.0%)	4	NA	NA
WP_049087077.1|1587511_1589176_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	5.2e-60
WP_004132232.1|1589190_1590663_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004132233.1|1590673_1591267_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_049131322.1|1591395_1593429_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	28.1	7.6e-21
>prophage 115
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1596913	1598458	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_004135476.1|1596913_1598458_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.5	3.1e-14
>prophage 116
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1609855	1614623	5944658		Tupanvirus(50.0%)	2	NA	NA
WP_064342331.1|1609855_1613743_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	28.8	2.8e-56
WP_049089655.1|1613828_1614623_-	iron-enterobactin ABC transporter ATP-binding protein	NA	M1HRF1	Paramecium_bursaria_Chlorella_virus	26.1	1.2e-09
>prophage 117
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1624524	1631903	5944658	transposase	Thermus_phage(33.33%)	6	NA	NA
WP_049130515.1|1624524_1625505_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	6.0e-24
WP_004135432.1|1625929_1628035_+	carbon starvation protein CstA	NA	NA	NA	NA	NA
WP_004130340.1|1628090_1628288_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_004135430.1|1628284_1628689_-	helix-turn-helix transcriptional regulator	NA	A0A1S5NNJ5	Burkholderia_phage	35.7	4.2e-08
WP_064342336.1|1629151_1630240_-	oxidoreductase	NA	NA	NA	NA	NA
WP_064342337.1|1630400_1631903_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	3.2e-16
>prophage 118
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1648924	1667455	5944658		Cedratvirus(14.29%)	15	NA	NA
WP_064342342.1|1648924_1649953_+	2-hydroxyacid dehydrogenase	NA	A0A2R8FCS0	Cedratvirus	34.1	5.9e-30
WP_064342343.1|1649991_1650936_-	sugar kinase	NA	NA	NA	NA	NA
WP_004135403.1|1650947_1651949_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_049089683.1|1651948_1652935_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024358824.1|1652931_1654437_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	7.8e-15
WP_064342344.1|1655874_1658184_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	33.2	1.3e-80
WP_004130392.1|1658341_1658884_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_064342345.1|1658880_1659570_-	acireductone synthase	NA	NA	NA	NA	NA
WP_171840907.1|1659758_1660904_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_064342347.1|1660904_1661534_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.8	1.5e-52
WP_024358821.1|1661518_1662742_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.3	6.9e-62
WP_049130972.1|1662845_1663757_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004130404.1|1664579_1665143_+	alkyl hydroperoxide reductase subunit C	NA	NA	NA	NA	NA
WP_024358819.1|1665384_1666950_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	1.4e-43
WP_004100140.1|1667026_1667455_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	40.7	2.5e-19
>prophage 119
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1671541	1673072	5944658		Morganella_phage(33.33%)	3	NA	NA
WP_004100146.1|1671541_1671751_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.6	4.5e-22
WP_024358815.1|1671808_1672192_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	50.0	1.2e-23
WP_024358814.1|1672283_1673072_+	deaminated glutathione amidase	NA	M1HKP1	Paramecium_bursaria_Chlorella_virus	23.4	4.9e-08
>prophage 120
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1676974	1679417	5944658		Stx2-converting_phage(50.0%)	2	NA	NA
WP_004134186.1|1676974_1678174_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.5	1.4e-104
WP_004134184.1|1678316_1679417_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	51.6	1.0e-08
>prophage 121
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1686433	1694494	5944658	tRNA	Staphylococcus_phage(33.33%)	5	NA	NA
WP_024358809.1|1686433_1689016_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.1	1.6e-188
WP_004134173.1|1689242_1689725_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_064342350.1|1689862_1691656_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	37.1	7.1e-31
WP_064342351.1|1691720_1693391_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_004100186.1|1693768_1694494_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	1.7e-28
>prophage 122
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1700341	1701388	5944658		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004134159.1|1700341_1701388_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.4e-48
>prophage 123
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1705457	1707119	5944658		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_004130452.1|1705457_1707119_-	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	38.8	1.8e-84
>prophage 124
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1716435	1726384	5944658	tRNA	Vibrio_phage(25.0%)	7	NA	NA
WP_004134146.1|1716435_1718388_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	3.2e-08
WP_004134144.1|1718566_1720234_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	92.6	6.1e-311
WP_024358798.1|1720671_1722075_+	chitoporin	NA	NA	NA	NA	NA
WP_004134140.1|1722121_1722454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049131921.1|1722506_1723802_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.9	8.1e-61
WP_049088750.1|1723854_1724994_-	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_004134134.1|1724980_1726384_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	A0A2P0ZL82	Lactobacillus_phage	26.1	7.8e-09
>prophage 125
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1729388	1730162	5944658		Mycobacterium_phage(100.0%)	1	NA	NA
WP_049086768.1|1729388_1730162_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	37.5	1.1e-07
>prophage 126
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1736608	1738093	5944658		Staphylococcus_phage(100.0%)	1	NA	NA
WP_049086600.1|1736608_1738093_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.8	3.2e-21
>prophage 127
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1746357	1753807	5944658		Paramecium_bursaria_Chlorella_virus(33.33%)	6	NA	NA
WP_064342355.1|1746357_1748406_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.9	8.4e-28
WP_064342356.1|1748427_1750107_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_049250631.1|1750106_1750196_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_162626030.1|1750502_1750712_+	DUF2517 family protein	NA	NA	NA	NA	NA
WP_064342357.1|1750914_1752357_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	33.1	8.8e-56
WP_004132624.1|1752325_1753807_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.4	1.7e-46
>prophage 128
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1759604	1760396	5944658		Kaumoebavirus(100.0%)	1	NA	NA
WP_004133438.1|1759604_1760396_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	26.4	9.8e-09
>prophage 129
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1798610	1802129	5944658		Vibriophage(33.33%)	4	NA	NA
WP_049086250.1|1798610_1799330_+	nicotinamide riboside transporter PnuC	NA	I6W764	Vibriophage	32.2	1.9e-22
WP_004135002.1|1799326_1800271_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.5	4.4e-24
WP_064342367.1|1800389_1800761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004134998.1|1801076_1802129_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	48.6	1.0e-82
>prophage 130
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1806523	1813047	5944658		Tupanvirus(33.33%)	7	NA	NA
WP_024360162.1|1806523_1807540_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	45.4	9.8e-78
WP_064342369.1|1807745_1809221_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A2R8FG22	Brazilian_cedratvirus	27.5	6.7e-11
WP_064342370.1|1809288_1810077_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_004134988.1|1810230_1810380_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_064342371.1|1810523_1811297_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004134985.1|1811296_1811986_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004130616.1|1811988_1813047_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	33.2	4.5e-17
>prophage 131
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1820212	1820944	5944658		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004134962.1|1820212_1820944_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	51.3	1.1e-51
>prophage 132
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1828577	1833519	5944658		Catovirus(50.0%)	4	NA	NA
WP_024360149.1|1828577_1830101_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.8	1.1e-80
WP_064342374.1|1830201_1831584_+	amino acid permease	NA	NA	NA	NA	NA
WP_004132457.1|1831683_1832160_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_064343381.1|1832229_1833519_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.8	4.5e-19
>prophage 133
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1837194	1837917	5944658		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004135264.1|1837194_1837917_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.0	1.1e-09
>prophage 134
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1844460	1845366	5944658		Streptococcus_phage(100.0%)	1	NA	NA
WP_004135255.1|1844460_1845366_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.2	4.1e-27
>prophage 135
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1855175	1856915	5944658		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_024360137.1|1855175_1856915_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	32.0	3.3e-17
>prophage 136
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1862056	1870504	5944658		Micromonas_pusilla_virus(20.0%)	8	NA	NA
WP_049087278.1|1862056_1862902_+	transketolase	NA	G9E5U1	Micromonas_pusilla_virus	32.9	3.4e-07
WP_064342382.1|1862901_1863894_+	transketolase family protein	NA	NA	NA	NA	NA
WP_049087280.1|1864112_1865465_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.5	1.3e-45
WP_024360130.1|1865667_1867812_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.3	7.4e-43
WP_024360129.1|1867854_1868823_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_004130722.1|1868945_1869206_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004130731.1|1869491_1869758_-	DksA/TraR family C4-type zinc finger protein	NA	A0A0A0PZH0	Pectobacterium_bacteriophage	57.3	9.5e-17
WP_064342383.1|1869826_1870504_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.6	3.8e-17
>prophage 137
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1877073	1882183	5944658		Planktothrix_phage(33.33%)	6	NA	NA
WP_004849106.1|1877073_1877796_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	1.5e-35
WP_004100490.1|1877792_1878452_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_004135178.1|1878586_1879333_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_004130751.1|1879706_1880210_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	24.6	1.9e-05
WP_004130753.1|1880431_1881319_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_004130755.1|1881670_1882183_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	31.3	2.3e-14
>prophage 138
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1886092	1893149	5944658		Klosneuvirus(33.33%)	6	NA	NA
WP_004135173.1|1886092_1887133_+	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	35.0	7.8e-06
WP_064342384.1|1887284_1888661_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	24.8	5.5e-23
WP_004135171.1|1888731_1889448_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004130773.1|1889491_1890406_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_024360119.1|1890596_1891379_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_004135166.1|1891556_1893149_+	ABC-F family ATPase	NA	A0A2K9L3Z8	Tupanvirus	29.4	6.5e-60
>prophage 139
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1900793	1903226	5944658		Citrobacter_phage(100.0%)	1	NA	NA
WP_049131729.1|1900793_1903226_-	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A076YHZ7	Citrobacter_phage	42.0	1.0e-08
>prophage 140
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1907404	1909258	5944658		Planktothrix_phage(100.0%)	1	NA	NA
WP_024360112.1|1907404_1909258_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	6.9e-13
>prophage 141
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1918988	1941856	5944658	holin,terminase	Escherichia_phage(26.32%)	35	NA	NA
WP_064342388.1|1918988_1920275_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	54.2	6.3e-122
WP_004111685.1|1920274_1920490_-	excisionase family protein	NA	NA	NA	NA	NA
WP_064342389.1|1920551_1921058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049250967.1|1921054_1921279_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	58.1	4.0e-16
WP_148719871.1|1921321_1921555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009653813.1|1921620_1921914_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_025108070.1|1922504_1922909_-	helix-turn-helix domain-containing protein	NA	B1B6L9	Salmonella_phage	54.9	1.2e-13
WP_009653783.1|1922988_1923216_+	transcriptional regulator	NA	K7PHK4	Enterobacteria_phage	44.3	1.4e-08
WP_009653775.1|1923199_1923625_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_071830645.1|1923638_1923893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342390.1|1923889_1924966_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	42.6	4.7e-30
WP_025108069.1|1924978_1925272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004849236.1|1925268_1925481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025108068.1|1925473_1926298_+	ParB N-terminal domain-containing protein	NA	K7PKM7	Enterobacterial_phage	68.5	1.0e-96
WP_004111726.1|1927833_1928127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014837900.1|1928906_1929089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342392.1|1929255_1929849_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	6.0e-43
WP_064342393.1|1929845_1930487_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	76.1	2.5e-87
WP_032694882.1|1930483_1930624_+	YlcG family protein	NA	NA	NA	NA	NA
WP_064342394.1|1930620_1931220_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	62.4	9.2e-68
WP_031280382.1|1931934_1932234_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_004849279.1|1932230_1932773_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	76.4	2.0e-77
WP_014837905.1|1932769_1933114_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	82.5	4.5e-43
WP_014837906.1|1933110_1933386_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	35.6	3.0e-05
WP_014837907.1|1933621_1933906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014837908.1|1934044_1934338_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	73.2	4.0e-32
WP_014228564.1|1934462_1934648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042934307.1|1934938_1935310_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	76.3	2.4e-50
WP_014837910.1|1935313_1936285_+|terminase	terminase small subunit	terminase	Q6J1S5	Burkholderia_virus	38.5	5.6e-30
WP_014837911.1|1936286_1937879_+|terminase	phage terminase	terminase	Q775B9	Bordetella_phage	40.4	8.7e-97
WP_014837912.1|1937879_1938101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113705927.1|1938097_1939714_+	hypothetical protein	NA	A0A1B1ITN4	uncultured_Mediterranean_phage	29.0	5.8e-56
WP_064342395.1|1939710_1939917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042928472.1|1941316_1941622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009654380.1|1941703_1941856_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	77.6	6.9e-12
>prophage 142
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1944884	1950859	5944658		Erwinia_phage(20.0%)	5	NA	NA
WP_064342398.1|1944884_1945154_-	hypothetical protein	NA	H2DE47	Erwinia_phage	35.6	7.7e-06
WP_064342399.1|1947072_1947624_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	89.4	3.7e-87
WP_042934048.1|1947993_1948410_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	48.4	1.2e-26
WP_029669928.1|1948869_1950072_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.2	1.2e-95
WP_004135121.1|1950100_1950859_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	27.2	2.6e-11
>prophage 143
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1958389	1969915	5944658		Bacillus_phage(33.33%)	13	NA	NA
WP_004100567.1|1958389_1958653_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	71.8	1.6e-27
WP_004134601.1|1958857_1959148_+	YbjC family protein	NA	NA	NA	NA	NA
WP_004134599.1|1959131_1959854_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_004134597.1|1959957_1960860_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	34.5	1.6e-34
WP_004130838.1|1960949_1961429_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_004134594.1|1961777_1962890_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_004134592.1|1962992_1964126_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	7.7e-31
WP_004134590.1|1964136_1965090_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_024360104.1|1965086_1965932_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_004134587.1|1965989_1966478_+	YbjO family protein	NA	NA	NA	NA	NA
WP_064342400.1|1966520_1967651_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.4	1.2e-28
WP_004134579.1|1967729_1968446_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.5	5.5e-35
WP_024360102.1|1968442_1969915_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	33.2	1.4e-24
>prophage 144
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1973179	1975919	5944658		Planktothrix_phage(50.0%)	4	NA	NA
WP_024360099.1|1973179_1973908_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	3.5e-29
WP_004849391.1|1974135_1974651_-	lipoprotein	NA	NA	NA	NA	NA
WP_004100606.1|1974768_1975092_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_049087316.1|1975088_1975919_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.1	9.6e-07
>prophage 145
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	1989794	2012889	5944658	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_064342402.1|1989794_1991741_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	39.2	2.1e-36
WP_004100627.1|1991809_1992040_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.4e-16
WP_004130898.1|1992364_1992682_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.4e-13
WP_032711149.1|1992712_1994995_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	4.8e-165
WP_002211347.1|1995133_1995352_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_024360089.1|1995631_1996336_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_024360088.1|1996374_1998096_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.7	1.5e-17
WP_024360087.1|1998096_1999863_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	A0A2H4UU96	Bodo_saltans_virus	31.1	1.7e-16
WP_004871710.1|1999977_2000946_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.3	1.4e-60
WP_002439523.1|2001477_2001972_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_064342403.1|2002107_2006154_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	49.2	4.9e-88
WP_004130911.1|2006275_2006887_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004871703.1|2006895_2008239_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	42.0	3.5e-83
WP_004871699.1|2008329_2009622_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	2.1e-93
WP_064342404.1|2009822_2012261_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	4.7e-219
WP_049090034.1|2012271_2012889_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	5.8e-73
>prophage 146
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2020012	2023239	5944658		Tetraselmis_virus(100.0%)	2	NA	NA
WP_004871674.1|2020012_2020753_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	1.8e-20
WP_024360081.1|2020956_2023239_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	2.5e-161
>prophage 147
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2027284	2028373	5944658		Streptococcus_phage(100.0%)	1	NA	NA
WP_024360078.1|2027284_2028373_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.3e-80
>prophage 148
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2033460	2038013	5944658		Bacillus_phage(100.0%)	3	NA	NA
WP_004100704.1|2033460_2033748_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	5.5e-10
WP_064342407.1|2033963_2036219_+	ComEC family protein	NA	NA	NA	NA	NA
WP_024360073.1|2036264_2038013_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.3	2.3e-58
>prophage 149
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2055323	2063691	5944658	tRNA	Enterobacteria_phage(20.0%)	5	NA	NA
WP_064342411.1|2055323_2056409_-	porin	NA	Q1MVN1	Enterobacteria_phage	53.2	3.9e-101
WP_004130975.1|2057000_2058401_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.3e-80
WP_004871590.1|2058704_2059907_-	nicotinate phosphoribosyltransferase	NA	A0A2L0UZQ6	Agrobacterium_phage	31.4	8.4e-44
WP_064342412.1|2060235_2062851_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.4	1.7e-20
WP_024360061.1|2062917_2063691_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.0	8.1e-32
>prophage 150
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2070403	2072311	5944658		Tupanvirus(100.0%)	1	NA	NA
WP_024360058.1|2070403_2072311_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.3	5.6e-50
>prophage 151
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2085081	2087136	5944658		Bacillus_phage(100.0%)	1	NA	NA
WP_064342416.1|2085081_2087136_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.9	7.9e-18
>prophage 152
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2102480	2104628	5944658		Bacillus_phage(100.0%)	1	NA	NA
WP_004871548.1|2102480_2104628_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	25.1	1.2e-24
>prophage 153
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2114099	2114759	5944658	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004100829.1|2114099_2114759_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	53.9	3.8e-46
>prophage 154
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2134900	2135641	5944658		Planktothrix_phage(100.0%)	1	NA	NA
WP_004871519.1|2134900_2135641_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.7	5.5e-30
>prophage 155
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2152088	2152868	5944658		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_004871478.1|2152088_2152868_-	amino acid ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.1	7.4e-17
>prophage 156
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2157134	2158236	5944658		Morganella_phage(100.0%)	2	NA	NA
WP_004131139.1|2157134_2157347_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	78.6	2.9e-24
WP_004871463.1|2158014_2158236_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	58.8	6.7e-16
>prophage 157
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2170398	2171427	5944658		Bacillus_phage(100.0%)	1	NA	NA
WP_049099658.1|2170398_2171427_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.4	1.2e-17
>prophage 158
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2176196	2177579	5944658		Enterobacteria_phage(100.0%)	1	NA	NA
WP_049130222.1|2176196_2177579_+	purine permease	NA	Q9KX94	Enterobacteria_phage	26.2	1.3e-19
>prophage 159
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2190997	2191738	5944658		Planktothrix_phage(100.0%)	1	NA	NA
WP_004131222.1|2190997_2191738_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.4	1.5e-35
>prophage 160
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2202013	2202916	5944658		Bacillus_phage(100.0%)	1	NA	NA
WP_004871366.1|2202013_2202916_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.1	8.0e-15
>prophage 161
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2206093	2212670	5944658		Serratia_phage(50.0%)	4	NA	NA
WP_064342448.1|2206093_2208391_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	44.2	5.0e-05
WP_004100938.1|2208442_2208763_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_004131253.1|2208783_2209860_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_049130914.1|2210168_2212670_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	27.4	4.6e-12
>prophage 162
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2226076	2228347	5944658		Enterobacteria_phage(100.0%)	3	NA	NA
WP_004131287.1|2226076_2226250_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	88.9	3.2e-05
WP_004131289.1|2226508_2227831_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	87.4	2.0e-200
WP_049131426.1|2227852_2228347_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	77.1	5.7e-39
>prophage 163
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2245217	2248112	5944658		Cronobacter_phage(50.0%)	4	NA	NA
WP_004871266.1|2245217_2246006_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	77.6	1.4e-92
WP_004871263.1|2246056_2246350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064342452.1|2246505_2247294_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_004871257.1|2247416_2248112_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	7.0e-27
>prophage 164
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2257116	2258097	5944658	transposase	Thermus_phage(100.0%)	1	NA	NA
WP_049130515.1|2257116_2258097_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	6.0e-24
>prophage 165
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2262251	2262806	5944658		Infectious_spleen_and_kidney_necrosis_virus(100.0%)	1	NA	NA
WP_064342456.1|2262251_2262806_+	O-acetyl-ADP-ribose deacetylase	NA	A0A140G0J9	Infectious_spleen_and_kidney_necrosis_virus	46.2	1.1e-27
>prophage 166
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2271153	2272074	5944658		Morganella_phage(100.0%)	1	NA	NA
WP_004137234.1|2271153_2272074_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	42.4	1.0e-57
>prophage 167
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2275303	2275549	5944658		Salmonella_phage(100.0%)	1	NA	NA
WP_004101040.1|2275303_2275549_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	47.4	7.7e-13
>prophage 168
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2296627	2297809	5944658		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_004131399.1|2296627_2297362_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	2.9e-15
WP_000103754.1|2297572_2297809_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 169
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2301107	2301749	5944658		Pseudomonas_phage(100.0%)	1	NA	NA
WP_004132353.1|2301107_2301749_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	38.2	3.4e-28
>prophage 170
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2317502	2317760	5944658		Erwinia_phage(100.0%)	1	NA	NA
WP_024359536.1|2317502_2317760_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	38.6	3.6e-05
>prophage 171
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2324049	2327815	5944658		Planktothrix_phage(50.0%)	4	NA	NA
WP_004138368.1|2324049_2324751_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	41.3	1.2e-34
WP_024359532.1|2324750_2325995_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_024359531.1|2326043_2326955_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_024359530.1|2326969_2327815_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	32.5	3.1e-21
>prophage 172
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2331161	2332298	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_004138358.1|2331161_2332298_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.1	5.0e-30
>prophage 173
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2340501	2341872	5944658		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_004131470.1|2340501_2341872_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	9.4e-108
>prophage 174
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2345105	2355386	5944658		Phage_21(25.0%)	10	NA	NA
WP_004131480.1|2345105_2346356_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	4.4e-19
WP_004138337.1|2346512_2346899_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_024359522.1|2346904_2347207_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_049130902.1|2347307_2348192_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_049130901.1|2348263_2350048_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.2	2.4e-18
WP_064342468.1|2350123_2351311_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_024359518.1|2351589_2352633_+	type II asparaginase	NA	NA	NA	NA	NA
WP_064342469.1|2352669_2353437_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	26.7	5.2e-15
WP_064342470.1|2353437_2354391_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_064342471.1|2354387_2355386_-	iron-dicitrate ABC transporter permease FecC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	24.8	2.7e-11
>prophage 175
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2361120	2362035	5944658		Morganella_phage(100.0%)	1	NA	NA
WP_004138325.1|2361120_2362035_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	51.2	4.5e-74
>prophage 176
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2370167	2374520	5944658		Bacillus_phage(100.0%)	3	NA	NA
WP_064342479.1|2370167_2371670_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.8	4.2e-08
WP_064342480.1|2372031_2373189_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_004138302.1|2373236_2374520_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	28.6	2.2e-10
>prophage 177
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2377850	2378705	5944658		Indivirus(100.0%)	1	NA	NA
WP_064342482.1|2377850_2378705_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	24.9	4.2e-13
>prophage 178
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2382352	2383606	5944658		Tupanvirus(100.0%)	1	NA	NA
WP_064342483.1|2382352_2383606_-	glycoside hydrolase family 18 protein	NA	A0A2K9L3D4	Tupanvirus	28.3	9.1e-25
>prophage 179
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2389294	2393443	5944658		Staphylococcus_phage(50.0%)	4	NA	NA
WP_064342488.1|2389294_2390278_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.6	8.2e-05
WP_004138274.1|2390414_2391173_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_064342489.1|2391315_2392671_+	MFS transporter	NA	NA	NA	NA	NA
WP_064342490.1|2392801_2393443_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L6K4	Tupanvirus	38.5	1.5e-20
>prophage 180
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2399322	2401278	5944658		Streptococcus_phage(100.0%)	1	NA	NA
WP_004121401.1|2399322_2401278_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	30.7	4.4e-42
>prophage 181
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2412160	2413381	5944658		Klosneuvirus(100.0%)	1	NA	NA
WP_049086182.1|2412160_2413381_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.0	5.5e-27
>prophage 182
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2422813	2423641	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_024359442.1|2422813_2423641_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	53.5	4.2e-71
>prophage 183
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2429856	2435595	5944658		Tupanvirus(50.0%)	5	NA	NA
WP_049131821.1|2429856_2432115_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	49.7	2.1e-144
WP_074168736.1|2432212_2432551_+	cell division activator CedA	NA	NA	NA	NA	NA
WP_004138198.1|2432625_2434017_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_004138197.1|2434151_2434742_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_064342500.1|2434833_2435595_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	6.8e-15
>prophage 184
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2450513	2453471	5944658		Acinetobacter_phage(100.0%)	2	NA	NA
WP_049085461.1|2450513_2451872_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	2.8e-35
WP_024359433.1|2451875_2453471_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	36.7	2.8e-47
>prophage 185
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2468171	2470769	5944658		Tupanvirus(100.0%)	1	NA	NA
WP_024359426.1|2468171_2470769_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	34.7	1.8e-88
>prophage 186
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2475609	2476200	5944658		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004139521.1|2475609_2476200_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	3.5e-43
>prophage 187
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2481766	2488486	5944658		Bodo_saltans_virus(33.33%)	6	NA	NA
WP_064342509.1|2481766_2483701_-	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	24.3	4.8e-09
WP_064342510.1|2483782_2484940_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_004139494.1|2485122_2485911_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_064342511.1|2486121_2486664_-	HutD family protein	NA	NA	NA	NA	NA
WP_004139492.1|2486682_2487492_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	27.0	2.7e-14
WP_004121219.1|2487493_2488486_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	26.7	2.1e-08
>prophage 188
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2511357	2577117	5944658	plate,terminase,integrase,holin,transposase	Klebsiella_phage(36.17%)	72	2510618:2510632	2513234:2513248
2510618:2510632	attL	ACCGCAGCAATTCGG	NA	NA	NA	NA
WP_064342518.1|2511357_2512539_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	1.3e-201
WP_025714666.1|2512519_2512711_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	78.7	2.3e-20
WP_032419897.1|2512721_2512868_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	72.9	5.8e-16
WP_025714667.1|2512864_2513089_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	55.4	2.8e-17
WP_064343388.1|2514211_2514730_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	80.2	1.2e-76
2513234:2513248	attR	CCGAATTGCTGCGGT	NA	NA	NA	NA
WP_064342519.1|2514773_2515214_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	78.3	1.2e-56
WP_142370427.1|2515210_2515429_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	94.4	5.6e-31
WP_049090017.1|2515400_2515655_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	88.1	1.5e-35
WP_004152158.1|2515647_2516013_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152159.1|2516182_2516371_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2516363_2516678_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2516848_2517517_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2517614_2517836_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_075207237.1|2518413_2520060_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	81.0	1.7e-273
WP_071830651.1|2520061_2521024_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	96.6	2.2e-180
WP_049090019.1|2521105_2521453_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.7	1.8e-55
WP_023302586.1|2521492_2522485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304962.1|2522484_2523570_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_031280382.1|2524264_2524564_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_049089475.1|2524560_2525103_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	77.5	2.6e-77
WP_049089473.1|2525099_2525444_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	86.0	7.0e-44
WP_004849284.1|2525440_2525716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049089470.1|2525857_2526151_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	73.2	2.6e-31
WP_064342520.1|2526542_2527307_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	75.6	1.2e-11
WP_064342521.1|2527257_2528658_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	3.6e-187
WP_001272054.1|2528899_2530303_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|2530331_2530964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039108763.1|2531178_2532630_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	7.2e-191
WP_064342522.1|2532685_2533234_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.9	6.1e-50
WP_064342523.1|2533285_2534488_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	53.4	1.7e-105
WP_000528476.1|2534491_2534986_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_064342524.1|2534997_2535939_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	4.6e-138
WP_064342525.1|2535978_2536260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342526.1|2536228_2536648_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	5.7e-40
WP_021312707.1|2536644_2537151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009652660.1|2537150_2537555_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	71.5	1.1e-43
WP_064342527.1|2537547_2538099_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	2.0e-40
WP_064342528.1|2538100_2539252_+	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.2	6.1e-177
WP_064342529.1|2539262_2539703_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	78.1	6.1e-61
WP_064342530.1|2539706_2540156_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	55.3	8.2e-37
WP_016244729.1|2540197_2540350_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_064342531.1|2540339_2542343_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	62.6	1.9e-242
WP_004152567.1|2542342_2542942_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_171840908.1|2543017_2543245_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	54.7	3.0e-19
WP_004152569.1|2543247_2544270_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2544269_2544611_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004199301.1|2544660_2544843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152571.1|2544885_2545452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2545505_2546159_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_064342533.1|2546160_2546514_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	81.2	4.6e-51
WP_064342534.1|2546513_2547713_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	70.9	1.7e-153
WP_064342535.1|2547709_2548486_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	56.9	2.3e-79
WP_071830652.1|2548485_2549391_+	hypothetical protein	NA	A0A1I9SEW2	Klebsiella_phage	58.3	1.6e-47
WP_064342536.1|2549390_2549573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342398.1|2551949_2552219_+	hypothetical protein	NA	H2DE47	Erwinia_phage	35.6	7.7e-06
WP_064342397.1|2552248_2552506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064342538.1|2554369_2554939_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	92.2	3.4e-88
WP_019705237.1|2555247_2555496_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_064342539.1|2556500_2556992_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_064343389.1|2557032_2558568_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_064342540.1|2558585_2559935_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_049130595.1|2559931_2560621_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_064342541.1|2560620_2562300_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001007312.1|2562302_2562794_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_171840909.1|2564123_2565635_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_064342543.1|2565635_2566520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342544.1|2566509_2567070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342545.1|2569759_2570548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171840893.1|2570480_2572094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171840910.1|2572307_2573297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342548.1|2575258_2575648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342550.1|2576667_2577117_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 189
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2591268	2591997	5944658		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004139240.1|2591268_2591997_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.9	3.5e-45
>prophage 190
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2604769	2608332	5944658		Cronobacter_phage(33.33%)	4	NA	NA
WP_004139203.1|2604769_2605192_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	51.8	1.8e-33
WP_004139201.1|2605191_2606457_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	67.3	8.8e-161
WP_004139200.1|2606504_2607596_-	oxidoreductase	NA	NA	NA	NA	NA
WP_064342564.1|2607588_2608332_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.5	3.9e-15
>prophage 191
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2611368	2615947	5944658	tRNA	Diachasmimorpha_longicaudata_entomopoxvirus(25.0%)	5	NA	NA
WP_004139192.1|2611368_2612742_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.1	2.4e-50
WP_004139190.1|2612785_2613721_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	93.4	1.6e-138
WP_004121089.1|2613914_2614349_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	51.4	9.4e-30
WP_004139189.1|2614431_2614644_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004139187.1|2614798_2615947_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	56.6	5.8e-111
>prophage 192
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2620289	2626523	5944658	holin	Enterobacterial_phage(33.33%)	9	NA	NA
WP_049090298.1|2620289_2620991_+	helix-turn-helix transcriptional regulator	NA	K7PKK1	Enterobacteria_phage	40.0	5.6e-32
WP_004139179.1|2621418_2621781_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	55.8	1.0e-29
WP_064342567.1|2621857_2622250_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	70.0	1.1e-40
WP_024358358.1|2622239_2622512_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	54.0	1.7e-16
WP_064342568.1|2622519_2623062_+	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	64.4	1.2e-66
WP_024358354.1|2624012_2624285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024358353.1|2624698_2624971_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_004139159.1|2624967_2625408_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_004139156.1|2625533_2626523_-	2-hydroxyacid dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	46.0	3.9e-71
>prophage 193
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2641288	2642809	5944658		Indivirus(100.0%)	1	NA	NA
WP_024358339.1|2641288_2642809_-	amino acid ABC transporter permease/ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.3	6.9e-11
>prophage 194
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2689574	2690645	5944658		Synechococcus_phage(100.0%)	1	NA	NA
WP_064342586.1|2689574_2690645_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	38.8	7.0e-10
>prophage 195
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2699655	2704266	5944658		Klosneuvirus(50.0%)	2	NA	NA
WP_064342591.1|2699655_2703558_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_024358296.1|2703606_2704266_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	49.6	3.8e-30
>prophage 196
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2711047	2714631	5944658	head,tail	Vibrio_phage(33.33%)	3	NA	NA
WP_064342593.1|2711047_2712871_-|tail	phage tail tape measure protein	tail	M4MHE6	Vibrio_phage	31.7	9.1e-66
WP_064342594.1|2712920_2713820_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0A1IWZ9	Pseudomonas_phage	38.9	1.2e-63
WP_064176009.1|2713812_2714631_-	hypothetical protein	NA	A0A2P9JZJ0	Alteromonadaceae_phage	42.1	5.7e-36
>prophage 197
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2723239	2727858	5944658		Bacillus_phage(20.0%)	8	NA	NA
WP_024358288.1|2723239_2724211_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	29.4	8.1e-13
WP_049131770.1|2724277_2724481_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	53.7	4.6e-11
WP_004138981.1|2724760_2724958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004138979.1|2725090_2725255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004120890.1|2725276_2725519_-	DinI family protein	NA	Q6UAW0	Klebsiella_phage	82.3	1.6e-31
WP_024358287.1|2725744_2726272_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	45.8	5.3e-19
WP_064342603.1|2726441_2726717_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_024358286.1|2726739_2727858_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	29.8	3.6e-33
>prophage 198
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2735104	2736613	5944658		Moumouvirus(100.0%)	1	NA	NA
WP_064342607.1|2735104_2736613_+	carboxylesterase/lipase family protein	NA	M1PNU1	Moumouvirus	34.9	1.0e-30
>prophage 199
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2751213	2753178	5944658		Phage_TP(100.0%)	1	NA	NA
WP_064342612.1|2751213_2753178_+	U32 family peptidase	NA	Q6DW11	Phage_TP	26.6	3.9e-22
>prophage 200
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2759393	2760404	5944658		Mycoplasma_phage(100.0%)	1	NA	NA
WP_064342614.1|2759393_2760404_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	56.2	1.2e-24
>prophage 201
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2775726	2777838	5944658		Salmonella_phage(100.0%)	1	NA	NA
WP_064342622.1|2775726_2777838_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	69.1	3.8e-140
>prophage 202
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2788032	2788812	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_004138168.1|2788032_2788812_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.9	4.9e-21
>prophage 203
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2801667	2802372	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_171840913.1|2801667_2802372_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.5e-29
>prophage 204
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2807572	2809117	5944658		Escherichia_phage(100.0%)	1	NA	NA
WP_049090359.1|2807572_2809117_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.0	3.7e-20
>prophage 205
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2815224	2818897	5944658		Mycobacterium_phage(50.0%)	3	NA	NA
WP_049085248.1|2815224_2816715_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	29.1	1.1e-32
WP_024358239.1|2816719_2817517_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171820844.1|2817730_2818897_+	muconate cycloisomerase family protein	NA	Q6A202	Oenococcus_phage	23.2	2.0e-05
>prophage 206
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2823205	2823979	5944658		Bacillus_phage(100.0%)	1	NA	NA
WP_064342637.1|2823205_2823979_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	W8CYX9	Bacillus_phage	48.5	2.9e-05
>prophage 207
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2833826	2835431	5944658		Planktothrix_phage(100.0%)	1	NA	NA
WP_024358224.1|2833826_2835431_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	1.5e-19
>prophage 208
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2839236	2844009	5944658		Tupanvirus(66.67%)	4	NA	NA
WP_064342639.1|2839236_2840247_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.6	3.3e-25
WP_004138078.1|2840502_2841102_+	inorganic diphosphatase	NA	A0A1B1ISK6	uncultured_Mediterranean_phage	39.9	1.5e-22
WP_064342640.1|2841302_2842259_+	bifunctional helix-turn-helix transcriptional regulator/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_064342641.1|2842296_2844009_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	24.4	7.3e-33
>prophage 209
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2864076	2867646	5944658		Bacillus_virus(50.0%)	2	NA	NA
WP_004138035.1|2864076_2864772_+	MgtC family protein	NA	G3MA03	Bacillus_virus	43.1	4.0e-14
WP_049132019.1|2864913_2867646_+	magnesium-translocating P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	26.0	2.3e-36
>prophage 210
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2875897	2877486	5944658		Bacillus_virus(50.0%)	2	NA	NA
WP_024358200.1|2875897_2876713_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	21.3	1.2e-06
WP_004138010.1|2876709_2877486_+	ABC transporter ATP-binding protein	NA	A0A140XAK6	Dickeya_phage	48.4	3.3e-17
>prophage 211
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2890589	2894708	5944658		Klosneuvirus(50.0%)	4	NA	NA
WP_024358191.1|2890589_2891975_-	diaminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.5	2.2e-27
WP_064342656.1|2892282_2893218_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032711032.1|2893242_2893983_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024358188.1|2893979_2894708_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	34.1	3.7e-18
>prophage 212
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2911768	2912653	5944658		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_024358172.1|2911768_2912653_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	56.5	7.4e-82
>prophage 213
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2919346	2920744	5944658		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_049090398.1|2919346_2920744_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.7	1.1e-42
>prophage 214
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2929565	2964000	5944658	head,plate,terminase,integrase,transposase	Erwinia_phage(37.5%)	43	2927483:2927501	2962467:2962485
2927483:2927501	attL	ATTTAACATAATATACATT	NA	NA	NA	NA
WP_064342670.1|2929565_2930234_+	hypothetical protein	NA	K7PJQ4	Enterobacteria_phage	80.5	3.4e-47
WP_064342671.1|2930233_2930614_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	94.4	2.3e-64
WP_071830657.1|2930678_2931023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342672.1|2931009_2931369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342673.1|2931371_2932250_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_064342674.1|2932253_2932511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342675.1|2933587_2934541_+	hypothetical protein	NA	A0A1D8EQC7	Escherichia_phage	26.4	1.1e-09
WP_064342676.1|2934537_2935248_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_064342677.1|2935257_2935635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004113032.1|2935849_2936197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342679.1|2936183_2937593_+|plate	baseplate J/gp47 family protein	plate	B8QTW4	Erwinia_phage	25.5	3.4e-12
WP_064342680.1|2937592_2938348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004113037.1|2938340_2938574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342681.1|2938570_2938807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342682.1|2938806_2939439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342683.1|2939803_2940067_-	hypothetical protein	NA	H2DE47	Erwinia_phage	34.5	2.2e-05
WP_071830659.1|2942313_2942829_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	60.9	7.5e-34
WP_064342685.1|2942846_2944457_-	ERF family protein	NA	NA	NA	NA	NA
WP_064342686.1|2944756_2945026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100290036.1|2945217_2945373_+	Hok/Gef family protein	NA	NA	NA	NA	NA
WP_064342687.1|2945693_2946239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342688.1|2946225_2947635_+|terminase	PBSX family phage terminase large subunit	terminase	Q716H3	Shigella_phage	32.4	1.3e-56
WP_064342689.1|2947631_2949005_+	DUF1073 domain-containing protein	NA	NA	NA	NA	NA
WP_064342690.1|2948991_2950353_+|head	phage head morphogenesis protein	head	E5AGA5	Erwinia_phage	29.1	9.9e-17
WP_064342691.1|2950324_2951338_+	DUF2213 domain-containing protein	NA	A0A291LCH5	Klebsiella_phage	35.0	2.6e-14
WP_064342692.1|2951337_2952129_+	Ig domain-containing protein	NA	A0A1S5R5Y7	Pseudomonas_phage	56.5	2.5e-12
WP_049091758.1|2952146_2953085_+	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	30.4	1.9e-27
WP_064342693.1|2953088_2953343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342694.1|2953352_2953712_+	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_064342695.1|2953708_2954188_+	hypothetical protein	NA	E5AGB1	Erwinia_phage	32.5	6.3e-11
WP_016808975.1|2954283_2954538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342697.1|2954537_2955323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342698.1|2955323_2956682_+	DUF3383 family protein	NA	E5AGB4	Erwinia_phage	27.8	1.6e-35
WP_016808972.1|2956684_2957107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342699.1|2957106_2957592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342700.1|2957719_2959651_+	tape measure protein	NA	NA	NA	NA	NA
WP_016808969.1|2959661_2959928_+	DUF4282 domain-containing protein	NA	A0A077KGV8	Edwardsiella_phage	41.6	8.4e-05
WP_064342701.1|2960009_2960606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342702.1|2960606_2960945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171840915.1|2961005_2961224_+	diacylglyceryl transferase	NA	I6R0S9	Salmonella_phage	54.2	1.2e-09
WP_064343392.1|2961243_2961744_+	lysozyme	NA	Q7Y3V3	Yersinia_phage	75.9	1.8e-72
WP_064342703.1|2961740_2962274_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_001272054.1|2962596_2964000_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
2962467:2962485	attR	ATTTAACATAATATACATT	NA	NA	NA	NA
>prophage 215
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2985923	2986670	5944658		Staphylococcus_phage(100.0%)	1	NA	NA
WP_024358147.1|2985923_2986670_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.4	8.6e-15
>prophage 216
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	2991305	2993300	5944658		Acinetobacter_phage(100.0%)	1	NA	NA
WP_148719875.1|2991305_2993300_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	29.5	1.1e-08
>prophage 217
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3023741	3024578	5944658		Mycobacterium_phage(100.0%)	1	NA	NA
WP_049130297.1|3023741_3024578_-	alpha/beta hydrolase	NA	A0A1I9SAY0	Mycobacterium_phage	37.7	1.8e-13
>prophage 218
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3033944	3035477	5944658		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004136348.1|3033944_3035477_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	5.0e-17
>prophage 219
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3042472	3046802	5944658		Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_024358109.1|3042472_3043234_+	SDR family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.7	2.5e-09
WP_004136336.1|3043250_3044246_+	2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	33.5	1.5e-22
WP_004136334.1|3044333_3045596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004136332.1|3045716_3046802_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	68.2	2.4e-143
>prophage 220
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3050611	3051421	5944658		Tupanvirus(100.0%)	1	NA	NA
WP_004136324.1|3050611_3051421_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	28.1	3.5e-09
>prophage 221
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3055462	3056920	5944658		Mycoplasma_phage(100.0%)	1	NA	NA
WP_024358103.1|3055462_3056920_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	34.6	1.5e-39
>prophage 222
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3063787	3064528	5944658		Indivirus(100.0%)	1	NA	NA
WP_024358097.1|3063787_3064528_-	amino acid ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.6	9.5e-14
>prophage 223
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3067781	3068573	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_004134108.1|3067781_3068573_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	29.9	1.2e-19
>prophage 224
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3074691	3079059	5944658		Tupanvirus(100.0%)	1	NA	NA
WP_064342732.1|3074691_3079059_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	23.4	1.5e-66
>prophage 225
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3087550	3091049	5944658		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_064342735.1|3087550_3089812_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.7	6.7e-135
WP_049086289.1|3089816_3091049_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.7	3.5e-29
>prophage 226
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3105440	3106853	5944658		Bacillus_phage(100.0%)	1	NA	NA
WP_024358070.1|3105440_3106853_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.0	7.1e-18
>prophage 227
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3112373	3113135	5944658		Escherichia_phage(100.0%)	1	NA	NA
WP_024358066.1|3112373_3113135_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	35.7	7.9e-32
>prophage 228
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3117690	3118452	5944658		Moraxella_phage(100.0%)	1	NA	NA
WP_004132752.1|3117690_3118452_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	45.3	6.5e-42
>prophage 229
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3126011	3126392	5944658		Streptococcus_phage(100.0%)	1	NA	NA
WP_004102351.1|3126011_3126392_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	1.4e-08
>prophage 230
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3129663	3131169	5944658		Staphylococcus_phage(50.0%)	2	NA	NA
WP_014229495.1|3129663_3130362_-	urea ABC transporter ATP-binding subunit UrtE	NA	A0A2H4PQG7	Staphylococcus_phage	25.3	6.2e-15
WP_024358056.1|3130371_3131169_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.8	2.8e-11
>prophage 231
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3155386	3162594	5944658		Escherichia_phage(50.0%)	5	NA	NA
WP_049131964.1|3155386_3156457_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	44.8	6.9e-66
WP_064342751.1|3156666_3159774_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	60.4	0.0e+00
WP_004119781.1|3159829_3161080_+	MFS transporter	NA	NA	NA	NA	NA
WP_064342752.1|3161142_3162231_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	81.8	2.9e-176
WP_004136273.1|3162333_3162594_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	83.5	8.4e-34
>prophage 232
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3166562	3176954	5944658		Klosneuvirus(20.0%)	9	NA	NA
WP_064342753.1|3166562_3168605_-	peptidyl-dipeptidase Dcp	NA	A0A1V0SIU1	Klosneuvirus	20.5	6.9e-14
WP_004119732.1|3168777_3169527_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_004136262.1|3169617_3170304_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004119728.1|3170355_3170787_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	38.6	8.8e-20
WP_004136260.1|3171063_3172527_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.8	2.3e-43
WP_071830661.1|3172750_3174127_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_024358039.1|3174173_3175190_-	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_064342754.1|3175204_3176419_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.7	1.5e-48
WP_024358038.1|3176627_3176954_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.9	9.3e-22
>prophage 233
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3181705	3183832	5944658		Escherichia_phage(100.0%)	3	NA	NA
WP_024358034.1|3181705_3182323_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	57.6	1.5e-73
WP_004135637.1|3182324_3183182_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_064342756.1|3183223_3183832_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.4	3.7e-24
>prophage 234
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3193362	3277650	5944658	head,tail,capsid,plate,protease,terminase,holin,integrase,portal	Enterobacteria_phage(13.16%)	93	3183823:3183839	3244259:3244275
3183823:3183839	attL	CTACCGTTAACCCCTGA	NA	NA	NA	NA
WP_004135618.1|3193362_3194175_+|protease	serine protease	protease	NA	NA	NA	NA
WP_064342757.1|3194179_3196336_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	34.8	4.1e-17
WP_004119685.1|3196441_3196771_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_004135616.1|3196757_3197120_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_004135610.1|3197645_3198680_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_064342758.1|3199235_3200891_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_064342759.1|3200890_3201733_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_004135606.1|3201750_3202050_+	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_024358027.1|3202042_3202876_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_049086383.1|3202875_3203676_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_064342760.1|3203805_3204765_+	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	89.5	6.7e-52
WP_064342761.1|3204767_3205388_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_064342762.1|3205384_3206287_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_004135593.1|3206276_3207203_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064342763.1|3207418_3209074_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_064342764.1|3209360_3210266_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_049088930.1|3210488_3211229_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_064342765.1|3211336_3212233_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064342766.1|3212340_3213960_+	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004119659.1|3213956_3214676_+	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_024358018.1|3214656_3215607_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_064342767.1|3215674_3218452_-	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	30.3	1.5e-64
WP_162685361.1|3219148_3220585_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_064342768.1|3220637_3222293_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_004135574.1|3222376_3222760_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_064342769.1|3222749_3223517_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_064342770.1|3223506_3224859_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_064342771.1|3224868_3226071_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_064342772.1|3226081_3226738_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_024358011.1|3226748_3227435_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004135569.1|3227602_3228409_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004135568.1|3228405_3228969_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_004135566.1|3229070_3229979_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064342773.1|3230145_3231456_+	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_064342774.1|3231455_3232901_+	amidohydrolase	NA	NA	NA	NA	NA
WP_077265745.1|3233012_3234167_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_064342775.1|3234267_3235368_+|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	57.1	1.6e-113
WP_064343396.1|3235423_3235744_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.5	9.4e-19
WP_064342776.1|3236139_3236409_-	hypothetical protein	NA	H2DE47	Erwinia_phage	35.6	1.7e-05
WP_064342777.1|3238811_3239627_-	hypothetical protein	NA	A0A142IE28	Pseudomonas_phage	64.4	6.1e-06
WP_064342778.1|3239697_3240366_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_064342779.1|3240362_3241511_-|plate	baseplate J/gp47 family protein	plate	R9TN81	Rhizobium_phage	24.9	1.5e-18
WP_064342780.1|3241500_3241950_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	44.4	3.5e-19
WP_117254196.1|3241946_3242486_-|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	41.7	2.5e-11
WP_064342781.1|3242521_3243601_-|tail	phage tail protein	tail	Q8SBG7	Shigella_phage	32.2	1.4e-37
WP_064342782.1|3243597_3244998_-	DNA circularization protein	NA	NA	NA	NA	NA
3244259:3244275	attR	CTACCGTTAACCCCTGA	NA	NA	NA	NA
WP_064342783.1|3245069_3245804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049083806.1|3245860_3247696_-	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	40.3	6.4e-19
WP_047723962.1|3247840_3248119_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_047723963.1|3248122_3248491_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_049083808.1|3248494_3250012_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8W623	Enterobacteria_phage	41.4	2.6e-98
WP_048263923.1|3250012_3250192_-	DUF2635 domain-containing protein	NA	A0A2P9JZJ7	Alteromonadaceae_phage	57.1	3.5e-07
WP_049083810.1|3250195_3250741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048263921.1|3250737_3251100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048263920.1|3251105_3251486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048263919.1|3251487_3252537_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	33.4	2.8e-51
WP_048263918.1|3252629_3253034_-|head	head decoration protein	head	NA	NA	NA	NA
WP_048263917.1|3253033_3253612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049083811.1|3253613_3254483_-	S49 family peptidase	NA	K4I1N3	Providencia_phage	39.4	6.0e-52
WP_048263915.1|3254479_3256117_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	35.6	2.3e-89
WP_032735077.1|3256116_3256380_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_048263914.1|3256388_3258512_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	35.6	1.8e-97
WP_049083812.1|3258453_3259017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047934963.1|3259333_3259840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342784.1|3259871_3260510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142908643.1|3260578_3260770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064342785.1|3261270_3261621_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	41.0	8.4e-13
WP_047719218.1|3261826_3262324_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	82.4	4.3e-79
WP_047719096.1|3262301_3262571_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	82.6	7.1e-36
WP_025714744.1|3263575_3263854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025714745.1|3263881_3264379_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	50.3	4.7e-33
WP_025714746.1|3264665_3265448_-	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	88.8	1.8e-132
WP_031592532.1|3265444_3265813_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.3	2.1e-38
WP_025714649.1|3265799_3267179_-	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	64.3	2.0e-158
WP_049100459.1|3267159_3268053_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	63.8	2.5e-85
WP_064342786.1|3268064_3268895_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	69.9	1.4e-85
WP_025714646.1|3269282_3269492_-	hypothetical protein	NA	A0A0U1UNM4	Pseudomonas_phage	51.6	8.9e-10
WP_025714645.1|3269598_3270300_+	helix-turn-helix domain-containing protein	NA	F1C599	Cronobacter_phage	79.3	5.0e-105
WP_025714644.1|3270498_3270798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025714643.1|3270889_3271153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342787.1|3271265_3271475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049100466.1|3271515_3271803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032730702.1|3271795_3272008_+	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	64.1	2.6e-17
WP_049100468.1|3272194_3272626_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	95.0	3.4e-72
WP_064343397.1|3272669_3273188_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	77.3	1.0e-75
WP_064342788.1|3273192_3273894_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	86.4	2.9e-105
WP_064342789.1|3273890_3274457_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	40.0	8.0e-29
WP_064342790.1|3274453_3274579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342791.1|3274575_3274800_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	78.4	2.1e-25
WP_171840916.1|3275381_3275615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171840895.1|3275687_3275834_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	9.8e-16
WP_064343398.1|3275841_3276102_+	pyocin activator PrtN family protein	NA	A0A1D9C9N7	Salinivibrio_phage	48.1	2.1e-16
WP_064342792.1|3277134_3277650_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.5	1.6e-23
>prophage 235
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3292102	3293404	5944658		Bacillus_phage(100.0%)	1	NA	NA
WP_024357998.1|3292102_3293404_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.0	3.6e-16
>prophage 236
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3304989	3305193	5944658		Salmonella_phage(100.0%)	1	NA	NA
WP_004134374.1|3304989_3305193_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	65.7	4.5e-19
>prophage 237
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3310514	3311885	5944658		Pandoravirus(100.0%)	1	NA	NA
WP_064342798.1|3310514_3311885_+	beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	34.7	1.4e-66
>prophage 238
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3323047	3324322	5944658	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_024357979.1|3323047_3324322_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.0	4.2e-86
>prophage 239
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3332959	3334437	5944658		Salmonella_phage(50.0%)	2	NA	NA
WP_049085879.1|3332959_3333481_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.9	4.1e-48
WP_064342803.1|3333540_3334437_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	29.8	5.5e-08
>prophage 240
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3338595	3347302	5944658		Bacillus_phage(20.0%)	9	NA	NA
WP_049130938.1|3338595_3339450_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	38.7	4.7e-17
WP_004119467.1|3339571_3340153_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.5	1.7e-42
WP_024357967.1|3340209_3341376_-	MFS transporter	NA	NA	NA	NA	NA
WP_049082851.1|3341541_3341631_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_004119465.1|3341927_3342953_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.9	3.1e-31
WP_004119464.1|3342971_3343883_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024357966.1|3343994_3345179_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_004136772.1|3345477_3346629_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	6.5e-86
WP_049086300.1|3346660_3347302_-	riboflavin synthase subunit alpha	NA	A0A2I2L4R9	Orpheovirus	34.9	1.7e-22
>prophage 241
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3361839	3365908	5944658		Trichoplusia_ni_ascovirus(50.0%)	5	NA	NA
WP_004136738.1|3361839_3362724_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	55.8	2.8e-81
WP_024357955.1|3362742_3363549_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004136733.1|3363637_3364273_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_024357954.1|3364498_3365128_+	LysE family transporter	NA	NA	NA	NA	NA
WP_004136729.1|3365137_3365908_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	28.7	1.6e-16
>prophage 242
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3370123	3371170	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_049088706.1|3370123_3371170_+	methionine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.0	1.3e-19
>prophage 243
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3374968	3376911	5944658		Planktothrix_phage(50.0%)	2	NA	NA
WP_064342810.1|3374968_3375949_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.4	4.0e-12
WP_064342811.1|3375945_3376911_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SJ29	Klosneuvirus	26.9	1.7e-10
>prophage 244
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3391216	3392287	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_049085105.1|3391216_3392287_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.9	3.7e-27
>prophage 245
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3408402	3412786	5944658		Planktothrix_phage(50.0%)	3	NA	NA
WP_049088721.1|3408402_3409224_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.0	2.1e-14
WP_102136239.1|3409780_3411802_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_004139963.1|3411997_3412786_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	34.8	2.0e-30
>prophage 246
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3424020	3425984	5944658		Micromonas_sp._RCC1109_virus(100.0%)	2	NA	NA
WP_024357910.1|3424020_3425037_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.4	2.3e-42
WP_064342822.1|3425033_3425984_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.9	3.3e-35
>prophage 247
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3440522	3441743	5944658		environmental_halophage(100.0%)	1	NA	NA
WP_064342828.1|3440522_3441743_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	42.6	6.9e-94
>prophage 248
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3459480	3477428	5944658	tRNA	Tupanvirus(25.0%)	18	NA	NA
WP_049088739.1|3459480_3461859_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.0	2.2e-173
WP_004119141.1|3462201_3463035_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_024357889.1|3463189_3464236_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	A0A0B5IW14	Pandoravirus	47.7	2.3e-82
WP_162685329.1|3464401_3464581_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_064342834.1|3464615_3466058_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	34.7	7.4e-55
WP_004134084.1|3466184_3466649_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_049088741.1|3466730_3467480_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	5.1e-07
WP_004134072.1|3467479_3468031_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_004119129.1|3468255_3469056_+	MetQ/NlpA family lipoprotein	NA	NA	NA	NA	NA
WP_004134071.1|3469080_3470067_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_004102960.1|3470163_3470463_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	9.4e-13
WP_064342835.1|3470467_3472855_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004134066.1|3472870_3473854_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	2.9e-34
WP_001386830.1|3474084_3474129_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004102963.1|3474252_3474609_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3474659_3474857_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071830666.1|3474953_3475496_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.7	1.5e-13
WP_064342836.1|3475499_3477428_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	8.8e-128
>prophage 249
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3485250	3488147	5944658		Lactobacillus_phage(33.33%)	3	NA	NA
WP_029669645.1|3485250_3486087_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	42.5	1.8e-08
WP_004121693.1|3486132_3487137_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	28.6	6.8e-15
WP_024357876.1|3487133_3488147_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	3.4e-14
>prophage 250
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3496447	3502722	5944658		Morganella_phage(25.0%)	7	NA	NA
WP_004132199.1|3496447_3497065_-	thymidine kinase	NA	A0A192YC86	Morganella_phage	52.1	3.9e-53
WP_004121719.1|3497621_3498029_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_004121722.1|3498163_3499066_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.6	2.0e-58
WP_024357875.1|3499263_3500277_-	two-component system response regulator RssB	NA	Q6XM27	Feldmannia_irregularis_virus	27.7	2.6e-06
WP_024357874.1|3500366_3501266_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_098065660.1|3501366_3501837_+	YchJ family protein	NA	NA	NA	NA	NA
WP_024357873.1|3501879_3502722_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	5.4e-13
>prophage 251
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3506196	3507732	5944658		Escherichia_phage(100.0%)	1	NA	NA
WP_064342839.1|3506196_3507732_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	3.7e-20
>prophage 252
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3524166	3524955	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_004133385.1|3524166_3524955_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.4	1.0e-29
>prophage 253
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3530316	3536023	5944658		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
WP_004133373.1|3530316_3530547_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	46.7	1.2e-07
WP_024357863.1|3530812_3531913_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_004851877.1|3532002_3532857_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.8	8.9e-48
WP_024357862.1|3532896_3533709_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_064342842.1|3533712_3534105_-	SirB family protein	NA	NA	NA	NA	NA
WP_024357861.1|3534101_3534941_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_004133359.1|3534940_3536023_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	40.0	1.5e-07
>prophage 254
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3539239	3542117	5944658		Tupanvirus(50.0%)	2	NA	NA
WP_004103157.1|3539239_3540187_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	3.0e-44
WP_029669642.1|3540437_3542117_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	1.1e-22
>prophage 255
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3563077	3568028	5944658		Enterobacteria_phage(33.33%)	4	NA	NA
WP_064342849.1|3563077_3564550_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.3	2.2e-25
WP_077625417.1|3564686_3566834_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.4	2.2e-31
WP_004133616.1|3566898_3567504_-	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_024357848.1|3567569_3568028_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	35.9	7.1e-20
>prophage 256
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3574838	3581039	5944658		Morganella_phage(25.0%)	6	NA	NA
WP_004133622.1|3574838_3575366_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	58.9	3.8e-49
WP_024357846.1|3575462_3575948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064342851.1|3576176_3577817_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.0	4.5e-133
WP_004133627.1|3578131_3579025_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024357844.1|3579084_3579771_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	30.5	1.4e-06
WP_024357843.1|3579950_3581039_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.2	5.7e-23
>prophage 257
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3602404	3603016	5944658		Geobacillus_virus(100.0%)	1	NA	NA
WP_009651970.1|3602404_3603016_-	membrane-bound lytic murein transglycosylase EmtA	NA	A0A0H3V0Q1	Geobacillus_virus	40.7	3.0e-05
>prophage 258
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3618511	3626590	5944658	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_004138515.1|3618511_3620197_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	25.3	8.4e-34
WP_024357825.1|3620405_3620990_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_024357824.1|3621033_3621729_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_024357823.1|3621796_3623707_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.8	1.4e-88
WP_004113724.1|3623839_3624184_+	RidA family protein	NA	NA	NA	NA	NA
WP_029669640.1|3624348_3625488_-	alginate lyase family protein	NA	NA	NA	NA	NA
WP_064342861.1|3625495_3626590_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-21
>prophage 259
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3633757	3635113	5944658		Pandoravirus(100.0%)	1	NA	NA
WP_024357819.1|3633757_3635113_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	41.3	6.8e-42
>prophage 260
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3638955	3640515	5944658		Moraxella_phage(100.0%)	1	NA	NA
WP_049114332.1|3638955_3640515_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	6.6e-41
>prophage 261
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3647952	3648162	5944658		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3647952_3648162_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 262
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3653422	3655471	5944658		Moraxella_phage(100.0%)	1	NA	NA
WP_024359858.1|3653422_3655471_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	3.4e-85
>prophage 263
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3662939	3663593	5944658		Escherichia_phage(100.0%)	1	NA	NA
WP_064342865.1|3662939_3663593_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.7	1.4e-56
>prophage 264
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3672842	3673811	5944658		Pectobacterium_phage(50.0%)	2	NA	NA
WP_004103351.1|3672842_3673073_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	58.8	1.3e-14
WP_004134816.1|3673151_3673811_+	exodeoxyribonuclease X	NA	A0A0H4IT92	Pseudoalteromonas_phage	32.8	2.6e-15
>prophage 265
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3681269	3682745	5944658		Cyanophage(100.0%)	1	NA	NA
WP_004122041.1|3681269_3682745_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	36.8	3.7e-78
>prophage 266
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3686695	3693026	5944658		Listeria_phage(25.0%)	7	NA	NA
WP_064342869.1|3686695_3688018_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	36.8	1.2e-14
WP_004122058.1|3688033_3688978_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_024359876.1|3689056_3689809_+	zinc ABC transporter ATP-binding protein ZnuC	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.0	6.0e-16
WP_049086642.1|3689808_3690594_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_024359878.1|3690792_3691803_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	24.6	2.8e-08
WP_004103390.1|3691811_3692423_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_004113791.1|3692504_3693026_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
>prophage 267
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3697123	3751195	5944658	capsid,tRNA,plate,terminase,holin	Escherichia_phage(15.0%)	77	NA	NA
WP_064342870.1|3697123_3698182_-	hypothetical protein	NA	A0A1I9SEW2	Klebsiella_phage	58.7	7.1e-39
WP_064342871.1|3698242_3698566_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	48.1	3.5e-21
WP_064342872.1|3698961_3699231_-	hypothetical protein	NA	H2DE47	Erwinia_phage	34.5	2.9e-05
WP_071830669.1|3701698_3702742_-	hypothetical protein	NA	A0A077KC23	Edwardsiella_phage	39.8	2.2e-16
WP_032693644.1|3702743_3703331_-	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	43.4	5.0e-34
WP_064342874.1|3703323_3704556_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	51.0	1.0e-105
WP_001518114.1|3704563_3704920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064342875.1|3704987_3705941_-	phage antirepressor N-terminal domain-containing protein	NA	A0A0M4REH5	Salmonella_phage	90.9	4.8e-95
WP_042932525.1|3706011_3706173_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_042932523.1|3706260_3706512_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	70.4	5.3e-25
WP_004196825.1|3706512_3706716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042932521.1|3706745_3707099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042932519.1|3707262_3707712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196832.1|3707778_3708366_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	24.6	1.7e-05
WP_004196801.1|3708367_3709222_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	29.4	1.2e-28
WP_004196836.1|3709218_3709524_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	47.5	1.6e-20
WP_064342876.1|3709525_3710368_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	32.1	2.2e-27
WP_064342877.1|3710371_3712297_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	54.4	2.6e-39
WP_001518122.1|3712498_3712975_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	29.8	5.5e-07
WP_064342878.1|3713027_3713282_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	71.4	3.9e-20
WP_048267572.1|3713284_3714040_-	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	51.4	1.4e-60
WP_004196864.1|3714221_3714665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064342879.1|3714664_3716146_-	DUF3383 domain-containing protein	NA	Q2NPD0	Xanthomonas_phage	35.0	9.3e-61
WP_064342880.1|3716149_3716701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029497286.1|3716682_3717051_-	hypothetical protein	NA	Q6UJ26	Burkholderia_virus	29.8	1.2e-06
WP_064342881.1|3717047_3717611_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	33.3	1.0e-20
WP_012542596.1|3717613_3718057_-	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.3	1.8e-12
WP_020804685.1|3718056_3718383_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	41.6	2.8e-10
WP_019724831.1|3718384_3719422_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	50.0	1.9e-84
WP_001518133.1|3719421_3719904_-	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	50.3	4.5e-33
WP_077265748.1|3719905_3721723_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.5	5.3e-58
WP_064342882.1|3721785_3722475_-|capsid	minor capsid protein	capsid	H9C0V1	Aeromonas_phage	51.3	9.6e-61
WP_064342883.1|3722527_3724048_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	45.0	4.8e-105
WP_064342884.1|3724048_3725725_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.6	7.9e-250
WP_023304876.1|3725726_3726359_-|terminase	terminase small subunit	terminase	A0A2I7RHH8	Vibrio_phage	48.5	4.1e-42
WP_167879619.1|3726691_3726868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064342885.1|3726864_3727407_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	78.1	1.1e-78
WP_031280382.1|3727403_3727703_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	99.0	2.9e-46
WP_064342886.1|3728359_3729049_-	antiterminator	NA	I6PDF8	Cronobacter_phage	55.8	2.9e-57
WP_148719879.1|3729045_3729186_-	YlcG family protein	NA	NA	NA	NA	NA
WP_064342887.1|3729182_3729566_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	43.8	7.8e-20
WP_064342888.1|3729562_3730174_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	70.6	3.4e-41
WP_071830670.1|3730166_3730340_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	70.2	2.4e-13
WP_064342889.1|3730320_3730788_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.2	1.1e-31
WP_047935490.1|3731040_3731316_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	39.6	3.9e-05
WP_064342891.1|3731907_3732180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064342892.1|3732154_3732658_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.9	1.3e-70
WP_064342893.1|3732654_3733092_-	hypothetical protein	NA	R9TME7	Aeromonas_phage	34.8	4.1e-09
WP_012542626.1|3733088_3733382_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_012542627.1|3733378_3734248_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	70.1	4.0e-96
WP_064342894.1|3734232_3735354_-	replication protein	NA	K7PGT1	Enterobacteria_phage	38.0	2.0e-55
WP_004141720.1|3735440_3735761_-	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	3.8e-36
WP_001548452.1|3735840_3736032_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	55.4	2.4e-09
WP_025269974.1|3736136_3736847_+	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	71.4	3.7e-92
WP_064342895.1|3737036_3738113_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	2.4e-58
WP_064342896.1|3738192_3738396_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	2.7e-19
WP_074185988.1|3738706_3738832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342897.1|3738824_3739019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064342898.1|3739109_3739394_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	72.3	1.8e-34
WP_064342899.1|3739403_3740318_+	recombinase RecT	NA	G8C7T0	Escherichia_phage	91.4	1.6e-159
WP_064342900.1|3740314_3740797_+	siphovirus Gp157 family protein	NA	G8C7S9	Escherichia_phage	95.0	2.3e-77
WP_046878446.1|3740823_3740982_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	69.2	2.2e-13
WP_064342901.1|3740978_3741635_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	89.0	4.5e-116
WP_064342902.1|3741631_3741853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483862.1|3741849_3742074_+	hypothetical protein	NA	G8C7U9	Escherichia_phage	73.2	9.2e-21
WP_064342903.1|3742070_3742778_+	hypothetical protein	NA	R9VWB9	Serratia_phage	67.5	5.0e-89
WP_064342904.1|3742774_3742966_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	64.4	7.8e-13
WP_064342905.1|3742962_3743181_+	TraR/DksA family transcriptional regulator	NA	A0A0M3LS11	Mannheimia_phage	45.6	1.9e-07
WP_064342906.1|3743184_3743427_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	94.5	1.6e-34
WP_064342907.1|3743469_3744729_+	DUF3596 domain-containing protein	NA	A0A286S1S8	Klebsiella_phage	90.4	2.7e-226
WP_064342908.1|3744725_3745505_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	81.9	1.1e-57
WP_004122068.1|3745558_3745954_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_049085135.1|3745993_3746737_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	28.7	1.1e-22
WP_049085133.1|3746733_3747750_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_029669910.1|3747850_3748585_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_024359882.1|3748661_3749231_-	VOC family protein	NA	NA	NA	NA	NA
WP_004136646.1|3749461_3751195_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	8.3e-85
>prophage 268
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3758219	3759734	5944658		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_024359885.1|3758219_3759734_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	27.6	1.5e-10
>prophage 269
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3776999	3777752	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_004122108.1|3776999_3777752_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	4.5e-27
>prophage 270
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3784451	3796458	5944658		Burkholderia_phage(28.57%)	12	NA	NA
WP_004136593.1|3784451_3786119_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	39.5	2.4e-17
WP_004122136.1|3786226_3786406_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_049100545.1|3786481_3787393_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_004136588.1|3787576_3788488_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_004136586.1|3788462_3788957_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	2.1e-33
WP_064343406.1|3788937_3790371_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.7	3.5e-97
WP_049089595.1|3790427_3791123_-	phosphohydrolase	NA	S4W232	Pandoravirus	27.8	6.2e-07
WP_004136582.1|3791165_3791447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024359897.1|3792071_3793142_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.9	1.0e-93
WP_049086147.1|3793625_3794015_+	GtrA family protein	NA	NA	NA	NA	NA
WP_032711001.1|3794011_3795004_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	39.5	7.6e-51
WP_024359900.1|3795000_3796458_+	glucosyl transferase GtrII family protein	NA	E5AGC8	Erwinia_phage	40.3	9.4e-98
>prophage 271
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3802870	3810721	5944658		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_004136560.1|3802870_3805558_-	cation-transporting P-type ATPase	NA	M1IAU8	Acanthocystis_turfacea_Chlorella_virus	27.8	4.7e-71
WP_004136558.1|3805608_3806040_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	43.4	2.9e-23
WP_049089257.1|3806573_3807659_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_024359971.1|3807658_3810721_+	efflux RND transporter permease subunit	NA	S5VL66	Leptospira_phage	21.8	5.5e-23
>prophage 272
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3823073	3823742	5944658		Bacillus_phage(100.0%)	1	NA	NA
WP_004132733.1|3823073_3823742_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	1.7e-33
>prophage 273
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3864432	3869411	5944658		Stx2-converting_phage(50.0%)	3	NA	NA
WP_004138794.1|3864432_3865599_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	81.7	4.7e-185
WP_064342933.1|3865779_3867204_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_024360004.1|3867308_3869411_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.6	2.8e-63
>prophage 274
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3882527	3884585	5944658		uncultured_virus(50.0%)	2	NA	NA
WP_004122401.1|3882527_3883352_+	Fe-S cluster assembly protein NifU	NA	A0A218MKD1	uncultured_virus	45.9	3.3e-23
WP_024360010.1|3883382_3884585_+	cysteine desulfurase NifS	NA	A0A1X7C038	Faustovirus	27.8	3.4e-29
>prophage 275
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3897095	3897995	5944658		Cellulophaga_phage(100.0%)	1	NA	NA
WP_004122431.1|3897095_3897995_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	89.5	5.4e-11
>prophage 276
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3903539	3923372	5944658	transposase	Escherichia_phage(16.67%)	17	NA	NA
WP_004122447.1|3903539_3904139_+	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A1V0SIZ6	Klosneuvirus	34.2	1.5e-17
WP_064342946.1|3904221_3905541_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	37.0	8.7e-10
WP_171840897.1|3905672_3906818_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_064342948.1|3906818_3907712_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_064342949.1|3907708_3908863_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	41.4	1.6e-76
WP_064342950.1|3908881_3910774_-	DUF4422 domain-containing protein	NA	NA	NA	NA	NA
WP_004138732.1|3910787_3911528_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	25.7	2.3e-07
WP_004138730.1|3911527_3912295_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004122469.1|3913606_3914611_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	2.0e-30
WP_004138729.1|3915092_3915215_+	small membrane protein	NA	NA	NA	NA	NA
WP_087859145.1|3915792_3916900_+|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
WP_025107748.1|3916977_3918144_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	5.3e-112
WP_004122474.1|3918317_3918872_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	56.7	7.3e-51
WP_064342951.1|3918887_3919778_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.1	1.4e-27
WP_004122480.1|3919809_3920679_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.7	3.7e-110
WP_064342952.1|3920692_3921757_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	3.7e-104
WP_064342953.1|3921965_3923372_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	7.3e-39
>prophage 277
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3931550	3932519	5944658	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_013815099.1|3931550_3932519_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
>prophage 278
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3942372	3949250	5944658		Bacillus_phage(25.0%)	5	NA	NA
WP_024360046.1|3942372_3943269_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	41.3	6.7e-46
WP_064342966.1|3944229_3945816_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.1	8.5e-36
WP_049088543.1|3946061_3947909_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004122535.1|3947936_3948518_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	1.0e-31
WP_004122537.1|3948608_3949250_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.3	1.7e-35
>prophage 279
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3966994	3967975	5944658		Planktothrix_phage(100.0%)	1	NA	NA
WP_064342974.1|3966994_3967975_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.5	3.4e-19
>prophage 280
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	3986466	3994841	5944658	tRNA	Bacillus_phage(33.33%)	8	NA	NA
WP_024359163.1|3986466_3988002_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	27.9	1.1e-27
WP_004138660.1|3987998_3988721_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.3	4.1e-30
WP_004138658.1|3989013_3990375_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	92.1	1.4e-201
WP_004138656.1|3990620_3991514_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	2.3e-14
WP_024359165.1|3991514_3991985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024359166.1|3991971_3992778_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_064342978.1|3993193_3993967_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.1e-25
WP_004138651.1|3993977_3994841_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	3.3e-10
>prophage 281
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4017634	4026551	5944658	integrase	Mycobacterium_phage(25.0%)	7	NA	NA
WP_049014278.1|4017634_4018210_+	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	39.2	1.7e-26
WP_049014279.1|4018524_4018785_+	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_049014282.1|4018785_4019994_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0ZCT8	Stx2-converting_phage	43.0	4.2e-19
WP_049014284.1|4020011_4021139_+	beta family protein	NA	NA	NA	NA	NA
WP_049014286.1|4021218_4022736_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	30.7	4.6e-31
WP_064343409.1|4022877_4024179_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_064342984.1|4024574_4026551_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	45.1	1.7e-158
>prophage 282
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4034835	4036869	5944658	tRNA	Indivirus(100.0%)	1	NA	NA
WP_064342988.1|4034835_4036869_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	6.1e-55
>prophage 283
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4047802	4057334	5944658		Enterobacteria_phage(83.33%)	10	NA	NA
WP_004138606.1|4047802_4048939_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	85.6	1.0e-144
WP_064342992.1|4048935_4050942_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	63.4	2.0e-236
WP_064342993.1|4050954_4051416_+	DUF1307 domain-containing protein	NA	NA	NA	NA	NA
WP_004138601.1|4051526_4051994_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	79.9	1.1e-65
WP_004138598.1|4052047_4052767_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_004138597.1|4052760_4054449_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	84.5	7.2e-259
WP_049086417.1|4054659_4055418_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	70.4	1.1e-76
WP_004103838.1|4055577_4055691_+	protein YohO	NA	NA	NA	NA	NA
WP_024359193.1|4055665_4056403_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024359194.1|4056386_4057334_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.3	2.4e-09
>prophage 284
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4063908	4064463	5944658		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004138576.1|4063908_4064463_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	37.2	3.9e-20
>prophage 285
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4068700	4069435	5944658		Streptococcus_phage(100.0%)	1	NA	NA
WP_004138568.1|4068700_4069435_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	41.6	2.8e-50
>prophage 286
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4087272	4088793	5944658		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_004870402.1|4087272_4088793_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	32.1	4.1e-11
>prophage 287
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4092549	4096633	5944658		Cellulophaga_phage(50.0%)	3	NA	NA
WP_004103895.1|4092549_4093218_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.8	6.9e-56
WP_064342999.1|4093585_4094422_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_004870389.1|4094659_4096633_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	35.8	8.1e-12
>prophage 288
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4100749	4101607	5944658		Catovirus(100.0%)	1	NA	NA
WP_004870380.1|4100749_4101607_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	30.1	9.9e-23
>prophage 289
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4112858	4117167	5944658		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_064343002.1|4112858_4114325_+	fructuronate reductase	NA	E5EQS6	Micromonas_sp._RCC1109_virus	30.1	3.3e-42
WP_024359216.1|4114444_4115422_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_024359217.1|4115457_4116171_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004122922.1|4116597_4117167_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	5.2e-12
>prophage 290
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4122926	4206529	5944658	head,tail,capsid,protease,terminase,holin,portal	Enterobacteria_phage(17.65%)	95	NA	NA
WP_049088484.1|4122926_4124516_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.9	7.2e-19
WP_004133916.1|4124519_4124864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004122939.1|4125194_4126391_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	24.1	2.8e-23
WP_024359222.1|4126387_4127107_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_064343004.1|4127254_4129012_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	42.2	2.9e-101
WP_004122948.1|4129149_4129434_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_004133905.1|4129495_4130089_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_004133903.1|4130169_4130928_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_004122954.1|4130978_4131986_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	49.5	3.1e-84
WP_004133900.1|4132164_4132392_+	YejL family protein	NA	NA	NA	NA	NA
WP_004133897.1|4132411_4134172_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
WP_064343005.1|4134509_4135187_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.0	2.2e-78
WP_064343006.1|4135643_4136909_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.2	1.5e-208
WP_049130654.1|4136910_4137330_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	2.5e-35
WP_004119105.1|4137817_4138369_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	91.1	4.3e-88
WP_064343007.1|4140287_4140557_+	hypothetical protein	NA	H2DE47	Erwinia_phage	35.6	5.9e-06
WP_049082762.1|4140586_4140775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064343009.1|4143167_4146251_-	kinase	NA	A0A286S259	Klebsiella_phage	68.7	0.0e+00
WP_032750767.1|4146247_4146628_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_064343010.1|4146637_4147123_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.9	1.8e-53
WP_049069906.1|4147109_4147583_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.5	1.2e-54
WP_064343011.1|4147603_4151209_-|tail	phage tail tape measure protein	tail	A0A2H4JHR1	uncultured_Caudovirales_phage	54.6	7.7e-202
WP_032409974.1|4151268_4151610_-	hypothetical protein	NA	Q5G8W9	Enterobacteria_phage	46.8	5.7e-06
WP_064343012.1|4151694_4152003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048258037.1|4152036_4152294_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	76.7	1.5e-19
WP_064343013.1|4152296_4153052_-	KilA-N domain-containing protein	NA	K7PH30	Enterobacteria_phage	47.6	3.2e-57
WP_064343014.1|4153238_4153544_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	65.7	3.6e-28
WP_064343015.1|4153546_4153951_-|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	56.6	1.6e-31
WP_064343016.1|4153981_4154686_-	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.8	5.9e-82
WP_064343017.1|4154742_4155090_-	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.1	6.2e-32
WP_064343018.1|4155086_4155536_-	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.2	1.9e-62
WP_048258044.1|4155532_4155871_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	67.0	1.2e-37
WP_032734570.1|4155883_4156216_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6JIM5	Burkholderia_virus	31.6	8.8e-12
WP_064343019.1|4156221_4156476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064343020.1|4156521_4157742_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	64.8	2.6e-141
WP_014838140.1|4157751_4158459_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	63.0	6.4e-68
WP_049131802.1|4158434_4159754_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	59.1	5.8e-139
WP_077254316.1|4159760_4161497_-|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.1	4.9e-138
WP_014838137.1|4161450_4161915_-|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	6.3e-48
WP_064343021.1|4162032_4162374_-	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	75.7	6.0e-48
WP_064343022.1|4162424_4162820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064343023.1|4163006_4163369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042945553.1|4163735_4164029_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	72.2	7.5e-31
WP_064343024.1|4164059_4164344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064343026.1|4164491_4164761_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.1	4.8e-24
WP_064343027.1|4164757_4165105_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	73.9	1.2e-35
WP_064343028.1|4165101_4165644_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	96.6	2.0e-98
WP_064343411.1|4165732_4166026_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	64.5	1.2e-28
WP_064343029.1|4166048_4166441_-|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	74.6	3.0e-43
WP_171840899.1|4166561_4166714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171840900.1|4166716_4167562_-	hypothetical protein	NA	A0A1B2IGT1	Erwinia_phage	73.5	4.7e-110
WP_071830677.1|4167797_4168256_+	hypothetical protein	NA	U5P096	Shigella_phage	35.2	9.7e-17
WP_064343031.1|4168916_4169966_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	78.7	1.0e-170
WP_064343032.1|4170147_4170480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064343412.1|4170620_4170812_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	79.0	1.0e-20
WP_064343033.1|4171021_4171852_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	48.3	6.4e-59
WP_064343034.1|4171870_4172935_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.8	1.6e-110
WP_064343035.1|4172943_4173468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064343036.1|4173477_4174308_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	70.7	3.7e-99
WP_064343037.1|4174397_4174796_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	67.5	3.1e-43
WP_064343038.1|4174795_4175269_-|protease	SOS-response repressor and protease LexA	protease	A0A291AWY9	Escherichia_phage	58.3	5.0e-16
WP_064343039.1|4175265_4177248_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	52.1	2.7e-196
WP_064343040.1|4177240_4178608_-	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	48.7	4.3e-105
WP_064343042.1|4178795_4179707_-	conserved phage C-terminal domain-containing protein	NA	A0A1C9IHW0	Salmonella_phage	72.1	6.6e-49
WP_064155632.1|4179696_4179876_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	67.3	6.6e-14
WP_064343043.1|4180048_4180600_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	68.3	1.2e-66
WP_064155634.1|4180644_4180845_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	81.5	2.5e-22
WP_064155646.1|4180932_4181607_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	85.2	3.6e-113
WP_041937773.1|4182721_4183093_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	88.6	7.7e-57
WP_064343045.1|4183139_4183967_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	72.0	5.5e-111
WP_064343413.1|4184109_4184637_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	70.9	7.1e-64
WP_064343046.1|4184829_4185615_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	1.5e-65
WP_064343047.1|4185742_4185994_+	hypothetical protein	NA	S5MC15	Escherichia_phage	73.9	6.2e-10
WP_064343048.1|4185990_4186701_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	32.0	9.7e-24
WP_064343049.1|4186697_4187006_+	hypothetical protein	NA	A0A1B3AZN4	Gordonia_phage	36.0	9.7e-05
WP_064343050.1|4187518_4187827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343051.1|4187819_4188107_+	hypothetical protein	NA	A0A077KAZ4	Edwardsiella_phage	73.6	4.8e-30
WP_077265756.1|4188238_4188844_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	77.9	6.9e-47
WP_064343052.1|4188840_4189113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343053.1|4189105_4189318_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	52.9	9.0e-10
WP_064343054.1|4189396_4189969_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	74.6	1.0e-79
WP_064343055.1|4190011_4190221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343056.1|4190223_4191402_+	recombinase	NA	A0A2H4J1K3	uncultured_Caudovirales_phage	29.3	2.0e-29
WP_064343057.1|4191655_4192936_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_004133895.1|4193558_4194665_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004133893.1|4194724_4195147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024359224.1|4195485_4195977_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_024359225.1|4196019_4197654_-	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_171840921.1|4198023_4199181_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	48.4	1.6e-76
WP_024359227.1|4199143_4200580_-	magnesium transporter	NA	NA	NA	NA	NA
WP_024359228.1|4200748_4202392_-	multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.4	3.7e-10
WP_064343059.1|4202468_4203119_-	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_049086662.1|4203118_4204183_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	L7Y5F8	Megavirus	46.7	5.4e-18
WP_064343060.1|4204255_4205308_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_049088476.1|4205410_4206529_-	OmpK36 porin	NA	Q1MVN1	Enterobacteria_phage	59.0	5.3e-117
>prophage 291
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4210671	4221315	5944658		Pseudomonas_phage(40.0%)	6	NA	NA
WP_024359234.1|4210671_4213518_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.7	1.1e-41
WP_004123050.1|4213649_4216283_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.8	7.4e-93
WP_024359235.1|4216468_4217197_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_004123055.1|4217541_4219827_+	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	3.0e-284
WP_004123058.1|4219930_4221061_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	1.6e-174
WP_049087159.1|4221060_4221315_+	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	64.0	8.2e-26
>prophage 292
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4229924	4231130	5944658		Oenococcus_phage(100.0%)	1	NA	NA
WP_004134009.1|4229924_4231130_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.5	1.8e-25
>prophage 293
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4234235	4236774	5944658	transposase	Tupanvirus(50.0%)	2	NA	NA
WP_064343065.1|4234235_4235684_+	catalase	NA	A0A2K9L0T1	Tupanvirus	46.7	2.6e-100
WP_064343066.1|4235733_4236774_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	2.3e-74
>prophage 294
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4258224	4258776	5944658	integrase	Escherichia_phage(100.0%)	1	4250757:4250770	4259404:4259417
4250757:4250770	attL	GTTCGGCGTGGTGA	NA	NA	NA	NA
WP_024359262.1|4258224_4258776_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	4.2e-51
WP_024359262.1|4258224_4258776_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	4.2e-51
4259404:4259417	attR	TCACCACGCCGAAC	NA	NA	NA	NA
>prophage 295
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4277762	4278362	5944658		Salmonella_phage(100.0%)	1	NA	NA
WP_004870934.1|4277762_4278362_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	39.8	2.4e-07
>prophage 296
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4290056	4291076	5944658		Enterobacteria_phage(100.0%)	1	NA	NA
WP_004870912.1|4290056_4291076_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.3	1.6e-19
>prophage 297
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4295603	4297539	5944658		Salmonella_phage(50.0%)	3	NA	NA
WP_049088443.1|4295603_4296170_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	61.9	1.1e-46
WP_024359278.1|4296226_4296724_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004123193.1|4296765_4297539_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.7	3.9e-10
>prophage 298
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4301832	4303350	5944658		Mollivirus(100.0%)	1	NA	NA
WP_004870888.1|4301832_4303350_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.8	5.4e-88
>prophage 299
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4309763	4310900	5944658		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_049088435.1|4309763_4310900_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.5	3.2e-21
>prophage 300
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4319307	4320393	5944658		Pandoravirus(100.0%)	1	NA	NA
WP_004852905.1|4319307_4320393_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
>prophage 301
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4329515	4331816	5944658		Enterobacteria_phage(50.0%)	2	NA	NA
WP_024359296.1|4329515_4330412_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	77.2	1.2e-124
WP_049088424.1|4331042_4331816_+	hypothetical protein	NA	A0A1W6JPD1	Morganella_phage	22.7	1.1e-07
>prophage 302
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4336267	4337011	5944658		Clostridioides_phage(100.0%)	1	NA	NA
WP_004870833.1|4336267_4337011_+	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	26.0	3.3e-14
>prophage 303
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4354712	4364563	5944658		Lactobacillus_phage(25.0%)	9	NA	NA
WP_064343080.1|4354712_4355639_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	2.7e-10
WP_004870798.1|4355728_4356727_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_004870796.1|4356723_4356942_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_049099598.1|4356934_4358959_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.1	1.5e-146
WP_024359308.1|4359033_4360029_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_064343081.1|4360259_4361021_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_004870789.1|4361180_4362152_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	50.0	2.8e-74
WP_002913505.1|4362533_4362791_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_004870786.1|4362835_4364563_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.6	3.3e-17
>prophage 304
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4368809	4377451	5944658		Streptococcus_phage(25.0%)	10	NA	NA
WP_024359313.1|4368809_4369721_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.4	2.2e-57
WP_049088208.1|4369839_4370934_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	1.3e-30
WP_004870763.1|4370923_4371799_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_004123378.1|4371798_4372632_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_004870758.1|4372631_4373648_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_004123382.1|4373867_4374767_-	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	31.8	2.7e-23
WP_004870754.1|4374863_4375439_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_004870752.1|4375502_4375952_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_004853033.1|4375938_4376364_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_004870750.1|4376575_4377451_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	32.4	7.5e-18
>prophage 305
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4410576	4412280	5944658		Rhodococcus_phage(50.0%)	2	NA	NA
WP_024359331.1|4410576_4411446_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	35.9	5.7e-34
WP_024359332.1|4411566_4412280_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.8e-38
>prophage 306
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4419548	4420838	5944658		Enterobacteria_phage(100.0%)	1	NA	NA
WP_024359333.1|4419548_4420838_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	9.2e-65
>prophage 307
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4424342	4426018	5944658		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_024359334.1|4424342_4425380_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.2	3.1e-71
WP_004853109.1|4425376_4426018_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.2	1.2e-28
>prophage 308
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4438459	4438651	5944658		Escherichia_phage(100.0%)	1	NA	NA
WP_024359340.1|4438459_4438651_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	71.4	2.3e-17
>prophage 309
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4442650	4445649	5944658		Klosneuvirus(50.0%)	2	NA	NA
WP_004123540.1|4442650_4444117_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.5	1.5e-87
WP_024359344.1|4444275_4445649_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.7	2.2e-40
>prophage 310
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4457059	4457491	5944658		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_004114414.1|4457059_4457491_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	38.6	1.7e-18
>prophage 311
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4466884	4473243	5944658		Mycoplasma_phage(20.0%)	8	NA	NA
WP_049100576.1|4466884_4468171_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.6	5.8e-35
WP_004104502.1|4468278_4468479_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_004104503.1|4468480_4468816_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_024359356.1|4468817_4470668_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	40.0	6.5e-104
WP_004104505.1|4470683_4471199_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_002913979.1|4471272_4471596_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	47.7	1.6e-21
WP_002913991.1|4471615_4472002_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.3	2.7e-52
WP_004134936.1|4472028_4473243_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	1.6e-34
>prophage 312
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4487576	4509748	5944658	tRNA	Bacillus_phage(25.0%)	19	NA	NA
WP_004134918.1|4487576_4488830_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.1	3.3e-99
WP_024359364.1|4489155_4490346_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_002914032.1|4490437_4490776_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_024359365.1|4490841_4492179_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.1	3.0e-10
WP_049085699.1|4492165_4492870_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_004134904.1|4492883_4494320_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.6	2.7e-12
WP_049088346.1|4494883_4498771_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.0	2.2e-130
WP_024359368.1|4498945_4500562_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_071830681.1|4500558_4501104_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	33.8	1.6e-05
WP_064343101.1|4501123_4501759_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004134895.1|4501968_4502817_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004114478.1|4502983_4503244_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	3.2e-17
WP_004123676.1|4503280_4503661_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004123677.1|4503660_4504392_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004134893.1|4504403_4505141_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004134890.1|4505152_4506058_-	GTPase Era	NA	NA	NA	NA	NA
WP_004104573.1|4506054_4506735_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.5	2.8e-20
WP_004123684.1|4506959_4507934_-	signal peptidase I	NA	NA	NA	NA	NA
WP_004123687.1|4507948_4509748_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.7	3.8e-24
>prophage 313
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4515523	4520042	5944658	tRNA	Cafeteria_roenbergensis_virus(25.0%)	5	NA	NA
WP_064343103.1|4515523_4516855_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	8.4e-45
WP_004104596.1|4516899_4517283_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	69.9	3.1e-32
WP_004132784.1|4517594_4518284_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	50.7	1.3e-54
WP_049085826.1|4518339_4519413_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_004104599.1|4519616_4520042_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	4.6e-13
>prophage 314
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4525341	4526640	5944658		Burkholderia_virus(100.0%)	1	NA	NA
WP_064343104.1|4525341_4526640_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	3.4e-43
>prophage 315
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4532392	4534966	5944658		Enterobacteria_phage(100.0%)	1	NA	NA
WP_024358389.1|4532392_4534966_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	4.0e-128
>prophage 316
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4541768	4542839	5944658		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_004136932.1|4541768_4542839_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	6.2e-91
>prophage 317
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4558081	4558564	5944658		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004104655.1|4558081_4558564_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	1.8e-29
>prophage 318
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4561918	4562887	5944658	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_013815099.1|4561918_4562887_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
>prophage 319
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4567802	4569323	5944658		Pithovirus(100.0%)	1	NA	NA
WP_004135091.1|4567802_4569323_+	amino acid ABC transporter permease/ATP-binding protein	NA	W5SAS9	Pithovirus	27.0	7.9e-15
>prophage 320
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4575234	4578719	5944658		Mollivirus(50.0%)	4	NA	NA
WP_004135077.1|4575234_4576011_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.2	2.1e-11
WP_064343113.1|4576155_4577076_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004135074.1|4577115_4577889_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_049085033.1|4577924_4578719_-	CatB-related O-acetyltransferase	NA	M1HS53	Paramecium_bursaria_Chlorella_virus	40.0	3.0e-05
>prophage 321
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4594008	4599299	5944658		Gordonia_phage(25.0%)	5	NA	NA
WP_049099465.1|4594008_4594254_+	glutaredoxin-like protein NrdH	NA	A0A0E3T8B5	Gordonia_phage	37.3	6.1e-10
WP_064343119.1|4594250_4594661_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_024358418.1|4594633_4596778_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	47.7	2.0e-189
WP_004132940.1|4596788_4597751_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.2	3.2e-131
WP_024358419.1|4598096_4599299_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.2	3.8e-28
>prophage 322
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4613948	4622249	5944658	tRNA	Vibrio_phage(20.0%)	8	NA	NA
WP_000906486.1|4613948_4614134_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_024358428.1|4614372_4617000_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.8	4.9e-81
WP_064343122.1|4617130_4617631_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_024358430.1|4617701_4618760_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	2.3e-114
WP_049087226.1|4618840_4619338_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	47.8	4.5e-28
WP_064343123.1|4619791_4620670_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_024358432.1|4620678_4621542_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_171840901.1|4621538_4622249_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.1	1.7e-07
>prophage 323
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4627829	4628795	5944658		Tetraselmis_virus(100.0%)	1	NA	NA
WP_064343124.1|4627829_4628795_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.2	1.8e-36
>prophage 324
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4668734	4669556	5944658		Pithovirus(100.0%)	1	NA	NA
WP_004132184.1|4668734_4669556_+	manganese/iron ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	30.0	2.1e-14
>prophage 325
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4677576	4678356	5944658		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_064343135.1|4677576_4678356_+	heme ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	4.6e-11
>prophage 326
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4682994	4683963	5944658	transposase	Salmonella_phage(100.0%)	1	NA	NA
WP_022652343.1|4682994_4683963_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
>prophage 327
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4688839	4694051	5944658		Planktothrix_phage(66.67%)	3	NA	NA
WP_064343138.1|4688839_4690783_-	ABC transporter permease	NA	G9BWD6	Planktothrix_phage	38.7	3.8e-30
WP_064343139.1|4690782_4691943_-	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	38.9	8.4e-09
WP_004137372.1|4691939_4694051_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.8	3.3e-19
>prophage 328
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4704933	4707495	5944658		Catovirus(100.0%)	1	NA	NA
WP_064343142.1|4704933_4707495_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.4	3.1e-27
>prophage 329
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4713607	4717381	5944658		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_004104962.1|4713607_4714600_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_064343144.1|4714758_4715877_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	34.6	6.5e-06
WP_024358491.1|4715999_4716626_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.2	3.1e-34
WP_004124266.1|4716619_4717381_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.6	2.9e-58
>prophage 330
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4720453	4722486	5944658		Tupanvirus(50.0%)	2	NA	NA
WP_004124289.1|4720453_4721059_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	36.5	1.4e-26
WP_064343145.1|4721058_4722486_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	27.8	2.5e-31
>prophage 331
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4742195	4747520	5944658		Vibrio_phage(33.33%)	4	NA	NA
WP_004124321.1|4742195_4742867_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.6	3.5e-15
WP_004137295.1|4743326_4744436_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004124327.1|4744503_4745802_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	2.8e-130
WP_004124328.1|4745882_4747520_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.3	1.4e-155
>prophage 332
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4750933	4756335	5944658		Erysipelothrix_phage(33.33%)	3	NA	NA
WP_049131606.1|4750933_4752277_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.6	3.6e-35
WP_049085089.1|4752401_4755155_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.4	7.5e-48
WP_004137285.1|4755195_4756335_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.0	1.8e-48
>prophage 333
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4763764	4764610	5944658		Vibrio_phage(100.0%)	1	NA	NA
WP_064343153.1|4763764_4764610_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	8.0e-41
>prophage 334
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4776985	4777741	5944658		Bacillus_phage(100.0%)	1	NA	NA
WP_004124395.1|4776985_4777741_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.1	4.2e-09
>prophage 335
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4788254	4790849	5944658	tRNA	environmental_halophage(50.0%)	3	NA	NA
WP_004132800.1|4788254_4789460_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.5	1.4e-70
WP_064343157.1|4789459_4789900_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_004133704.1|4790039_4790849_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.3	2.5e-15
>prophage 336
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4795753	4796569	5944658		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_024358524.1|4795753_4796569_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	23.8	3.3e-07
>prophage 337
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4829567	4840680	5944658		Deep-sea_thermophilic_phage(25.0%)	5	NA	NA
WP_004124560.1|4829567_4830821_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	29.4	5.0e-15
WP_004105227.1|4831048_4832380_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_024358544.1|4832420_4834256_-	exodeoxyribonuclease V subunit alpha	NA	A0A0K2FLP8	Brevibacillus_phage	24.2	5.8e-20
WP_064343164.1|4834252_4837798_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	22.7	1.5e-11
WP_064343165.1|4837794_4840680_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.9	2.6e-59
>prophage 338
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4846147	4853015	5944658		Geobacillus_virus(33.33%)	7	NA	NA
WP_064343168.1|4846147_4846942_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	72.0	3.4e-118
WP_004124587.1|4846948_4847824_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_024358549.1|4848051_4850298_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	22.9	1.5e-09
WP_004124593.1|4850310_4850841_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_171840923.1|4851294_4851507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004124598.1|4851523_4852216_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_004132983.1|4852301_4853015_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.8	1.0e-44
>prophage 339
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4856025	4865181	5944658		Staphylococcus_phage(33.33%)	7	NA	NA
WP_064343170.1|4856025_4858185_-	bifunctional acyl-ACP--phospholipid O-acyltransferase/long-chain-fatty-acid--ACP ligase	NA	A0A2H4PQU7	Staphylococcus_phage	25.1	3.2e-17
WP_004132976.1|4858807_4859824_+	HTH-type transcriptional regulator GalR	NA	NA	NA	NA	NA
WP_049087301.1|4859784_4860264_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004105268.1|4860260_4861034_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024358554.1|4861102_4862530_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	27.5	4.5e-36
WP_004132963.1|4862537_4863875_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_162685340.1|4864179_4865181_+	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	29.6	9.8e-30
>prophage 340
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4871063	4872191	5944658		Bacillus_phage(100.0%)	1	NA	NA
WP_004132950.1|4871063_4872191_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.9	3.9e-11
>prophage 341
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4880402	4882894	5944658		Aichi_virus(50.0%)	2	NA	NA
WP_004132105.1|4880402_4881821_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	27.8	3.5e-25
WP_004124661.1|4882132_4882894_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.9	1.4e-20
>prophage 342
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4913568	4915122	5944658		Acinetobacter_phage(100.0%)	1	NA	NA
WP_004134506.1|4913568_4915122_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	57.8	3.9e-158
>prophage 343
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4920250	4921024	5944658		Escherichia_phage(100.0%)	1	NA	NA
WP_004134484.1|4920250_4921024_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.0	8.9e-23
>prophage 344
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4928307	4929864	5944658		Catovirus(100.0%)	1	NA	NA
WP_064343179.1|4928307_4929864_+	acyl--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.3	1.9e-16
>prophage 345
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4937226	4938402	5944658		Streptococcus_phage(100.0%)	1	NA	NA
WP_004134460.1|4937226_4938402_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	37.7	2.9e-41
>prophage 346
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4941918	4944049	5944658		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_024358596.1|4941918_4942344_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	3.3e-51
WP_064343183.1|4942353_4943646_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.3	1.1e-169
WP_004134443.1|4943698_4944049_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.4	2.8e-24
>prophage 347
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4954346	4958680	5944658	transposase	Salmonella_phage(50.0%)	4	NA	NA
WP_074422008.1|4954346_4955315_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	8.7e-185
WP_024358607.1|4955803_4956286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024358608.1|4956254_4956980_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004124922.1|4957954_4958680_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	35.0	2.5e-11
>prophage 348
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4963340	4969423	5944658	tRNA	Catovirus(25.0%)	5	NA	NA
WP_024358611.1|4963340_4964858_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.1	1.0e-86
WP_098066859.1|4964867_4965966_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	3.1e-05
WP_049090244.1|4966051_4967785_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	9.2e-60
WP_004134425.1|4967790_4968504_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004124942.1|4968526_4969423_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	3.6e-31
>prophage 349
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4981644	4987624	5944658		Pandoravirus(50.0%)	4	NA	NA
WP_064343191.1|4981644_4983078_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.3	8.8e-32
WP_064343192.1|4983268_4983760_+	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_004133590.1|4983946_4984690_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_024358625.1|4984750_4987624_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.1	4.1e-262
>prophage 350
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	4995801	4997034	5944658		Catovirus(100.0%)	1	NA	NA
WP_004133574.1|4995801_4997034_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.6	6.9e-102
>prophage 351
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5014531	5016393	5944658	transposase	Staphylococcus_phage(50.0%)	2	NA	NA
WP_024358642.1|5014531_5015188_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	1.9e-10
WP_049130515.1|5015412_5016393_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.8	6.0e-24
>prophage 352
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5023745	5024900	5944658		Staphylococcus_phage(100.0%)	1	NA	NA
WP_004125136.1|5023745_5024900_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.7	2.1e-129
>prophage 353
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5031418	5032526	5944658	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_087859145.1|5031418_5032526_+|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
>prophage 354
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5044125	5045208	5944658		Geobacillus_virus(100.0%)	1	NA	NA
WP_004135825.1|5044125_5045208_+	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	38.1	3.8e-11
>prophage 355
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5052267	5053638	5944658		Streptococcus_phage(100.0%)	1	NA	NA
WP_004135812.1|5052267_5053638_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	37.0	2.5e-44
>prophage 356
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5070503	5078974	5944658		Staphylococcus_phage(25.0%)	6	NA	NA
WP_004135777.1|5070503_5071331_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	3.6e-62
WP_004854228.1|5071425_5073609_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.0	1.0e-103
WP_004125252.1|5073729_5075142_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_004125254.1|5075226_5075964_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_004135773.1|5076155_5078414_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.5	5.2e-87
WP_004135770.1|5078566_5078974_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	42.0	2.0e-18
>prophage 357
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5087704	5089600	5944658		Bacillus_virus(100.0%)	1	NA	NA
WP_024358676.1|5087704_5089600_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	36.0	2.5e-90
>prophage 358
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5093922	5095757	5944658		Erwinia_phage(50.0%)	2	NA	NA
WP_064343208.1|5093922_5094591_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	51.7	1.6e-44
WP_004135741.1|5094596_5095757_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.9	9.8e-90
>prophage 359
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5102810	5106095	5944658		Staphylococcus_phage(50.0%)	4	NA	NA
WP_064343210.1|5102810_5103464_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	4.5e-44
WP_049089054.1|5103842_5104124_+	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_004135725.1|5104178_5104388_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_004125323.1|5104661_5106095_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.8	8.8e-40
>prophage 360
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5111205	5112447	5944658		Sinorhizobium_phage(100.0%)	1	NA	NA
WP_148719882.1|5111205_5112447_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	50.8	3.6e-90
>prophage 361
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5121706	5161798	5944658	lysis,head,tail,portal,capsid,plate,tRNA,terminase,holin,transposase	Escherichia_phage(31.82%)	49	NA	NA
WP_004872392.1|5121706_5122720_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	1.1e-108
WP_001144069.1|5122957_5123173_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004872393.1|5123406_5125152_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.2	4.9e-77
WP_004125383.1|5125425_5127270_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_064343215.1|5127510_5128155_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064343216.1|5128151_5129279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024358695.1|5129275_5129782_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_032420109.1|5130139_5130358_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_064343217.1|5130425_5131592_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	81.4	5.2e-176
WP_064159021.1|5131591_5132071_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	77.1	3.4e-65
WP_064343218.1|5132084_5134526_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	72.9	2.2e-293
WP_014343413.1|5134518_5134638_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_032440325.1|5134670_5134946_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	79.8	2.0e-33
WP_048335307.1|5135006_5135522_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	3.2e-69
WP_064343219.1|5135535_5136717_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.4	3.0e-195
WP_064343220.1|5136826_5137993_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.0	7.4e-45
WP_064343221.1|5138085_5138379_-	hypothetical protein	NA	H2DE47	Erwinia_phage	34.4	3.7e-06
WP_064343222.1|5138392_5140618_-	hypothetical protein	NA	A0A2P0QGN7	Salmonella_phage	37.5	4.6e-11
WP_064343223.1|5140623_5141220_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	52.4	3.5e-51
WP_064343224.1|5141212_5142121_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	71.9	3.4e-114
WP_064343225.1|5142125_5142473_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	75.7	1.8e-44
WP_064343226.1|5142469_5143105_-|plate	phage baseplate assembly protein V	plate	M1SV78	Escherichia_phage	83.4	3.4e-97
WP_064343227.1|5143173_5143623_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.7	7.9e-48
WP_064343228.1|5143615_5144083_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	1.4e-63
WP_071830693.1|5144045_5144204_-|lysis	phage lysis protein	lysis	A0A218M4L1	Erwinia_phage	74.0	4.9e-13
WP_064343229.1|5144178_5144610_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	64.7	5.3e-41
WP_064343230.1|5144606_5145104_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	86.1	1.5e-79
WP_004195910.1|5145090_5145381_-|holin	holin	holin	O80308	Escherichia_phage	85.7	5.3e-37
WP_064343231.1|5145385_5145589_-|tail	tail protein X	tail	S4TTA0	Salmonella_phage	77.6	9.5e-25
WP_064343232.1|5145588_5146095_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.2	3.5e-60
WP_171840924.1|5146191_5146911_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.0	1.6e-95
WP_025710540.1|5146938_5147997_-|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	4.9e-165
WP_025710541.1|5148070_5148925_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	79.6	3.6e-126
WP_064343234.1|5149090_5150860_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.4	4.5e-304
WP_064343235.1|5150859_5151903_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	81.5	2.2e-165
WP_064343237.1|5152218_5152836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064343238.1|5152959_5153691_-	hypothetical protein	NA	A0A218M4H5	Erwinia_phage	93.4	1.7e-127
WP_064343239.1|5153773_5154214_-	DinI family protein	NA	A0A218M4I0	Erwinia_phage	97.8	4.7e-69
WP_171840925.1|5154332_5156402_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	96.2	0.0e+00
WP_000238509.1|5156548_5157379_-	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	97.1	7.1e-159
WP_064343241.1|5157382_5157661_-	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	89.1	5.3e-42
WP_064343242.1|5157661_5157883_-	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	91.8	1.1e-31
WP_001246237.1|5157882_5158110_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
WP_000963463.1|5158177_5158516_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	94.6	7.3e-54
WP_071830694.1|5158479_5158680_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	98.5	4.6e-32
WP_000459331.1|5158687_5159197_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	100.0	3.3e-90
WP_000135597.1|5159227_5159491_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.7	3.3e-38
WP_064343243.1|5159621_5160200_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	64.1	7.1e-65
WP_087859145.1|5160690_5161798_+|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
>prophage 362
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5173639	5175019	5944658		Klosneuvirus(100.0%)	1	NA	NA
WP_049089047.1|5173639_5175019_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.6e-33
>prophage 363
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5179312	5180800	5944658		Bacillus_phage(100.0%)	1	NA	NA
WP_064343424.1|5179312_5180800_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	W8CYL7	Bacillus_phage	28.2	5.9e-07
>prophage 364
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5193151	5194120	5944658		Escherichia_phage(100.0%)	1	NA	NA
WP_024358714.1|5193151_5194120_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	33.3	5.5e-38
>prophage 365
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5210552	5211698	5944658		Streptococcus_phage(100.0%)	1	NA	NA
WP_064343250.1|5210552_5211698_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	39.4	1.8e-48
>prophage 366
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5216837	5217647	5944658		Escherichia_phage(100.0%)	1	NA	NA
WP_049089704.1|5216837_5217647_-	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.3	9.7e-28
>prophage 367
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5227283	5235700	5944658		Streptococcus_phage(20.0%)	11	NA	NA
WP_004125570.1|5227283_5228144_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	47.2	2.1e-49
WP_049089722.1|5228207_5230289_+	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_024358733.1|5230246_5230633_+	YraN family protein	NA	NA	NA	NA	NA
WP_002918211.1|5230655_5231246_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.8	5.4e-12
WP_004125578.1|5231255_5231831_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_004139888.1|5232039_5233080_-	permease	NA	NA	NA	NA	NA
WP_024358734.1|5233152_5233800_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_024358735.1|5233928_5234447_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	29.0	1.4e-11
WP_004139879.1|5234426_5234870_-	YhbP family protein	NA	NA	NA	NA	NA
WP_004139877.1|5234925_5235210_+	GIY-YIG nuclease family protein	NA	A0A068LKN9	Peridroma_alphabaculovirus	51.1	5.8e-12
WP_024358736.1|5235196_5235700_-	N-acetyltransferase	NA	A0A1P8CWJ6	Bacillus_phage	32.7	1.7e-14
>prophage 368
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5252101	5254063	5944658		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_024358749.1|5252101_5254063_-	DEAD/DEAH family ATP-dependent RNA helicase	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	8.0e-52
>prophage 369
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5259462	5271103	5944658	protease	Cafeteria_roenbergensis_virus(25.0%)	8	NA	NA
WP_004125655.1|5259462_5262153_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.6	7.2e-27
WP_004125657.1|5262177_5263665_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_004139810.1|5263692_5264145_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_064343264.1|5264735_5266079_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	93.7	1.1e-63
WP_004106103.1|5266333_5266663_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_024358752.1|5266892_5268230_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_004125673.1|5268222_5269071_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	31.9	3.7e-22
WP_004139802.1|5269168_5271103_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.5	9.2e-117
>prophage 370
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5277689	5279132	5944658		Indivirus(50.0%)	2	NA	NA
WP_049100548.1|5277689_5278661_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	1.3e-07
WP_004139786.1|5278859_5279132_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	68.3	1.7e-16
>prophage 371
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5283182	5297177	5944658		Staphylococcus_phage(28.57%)	16	NA	NA
WP_004125691.1|5283182_5283995_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.8	6.3e-19
WP_004139780.1|5284204_5285182_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_171820852.1|5285178_5286183_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	32.9	7.2e-41
WP_024358756.1|5286197_5286764_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	81.3	1.8e-57
WP_004125700.1|5286760_5287336_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004125703.1|5287304_5287850_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_004125705.1|5287856_5288582_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	9.3e-22
WP_049087000.1|5288629_5290063_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004106167.1|5290085_5290373_+	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_004125714.1|5290438_5290927_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004106169.1|5290972_5291827_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_004139771.1|5291823_5292096_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_024358758.1|5292149_5292875_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_024358759.1|5292871_5293525_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_024358760.1|5293759_5296099_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.4	6.0e-38
WP_064343265.1|5296241_5297177_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	33.6	9.8e-16
>prophage 372
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5304318	5304807	5944658	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_014226996.1|5304318_5304807_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.7	4.9e-27
>prophage 373
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5308711	5313127	5944658	protease,transposase	uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_024358764.1|5308711_5310079_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	24.2	1.5e-20
WP_004134703.1|5310165_5311224_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_064343267.1|5311250_5311949_-	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_064343425.1|5312146_5313127_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	31.1	2.4e-25
>prophage 374
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5318410	5319679	5944658		Oenococcus_phage(100.0%)	1	NA	NA
WP_024360661.1|5318410_5319679_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.5	5.2e-60
>prophage 375
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5338573	5339617	5944658		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_002918653.1|5338573_5339617_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 376
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5357018	5358126	5944658	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_087859145.1|5357018_5358126_+|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
>prophage 377
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5369582	5371054	5944658	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_004138433.1|5369582_5370092_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_004138430.1|5370106_5371054_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	36.7	6.5e-07
>prophage 378
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5390938	5396509	5944658		Tupanvirus(33.33%)	7	NA	NA
WP_004097636.1|5390938_5392123_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	27.2	8.9e-14
WP_004115957.1|5392193_5394308_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.2	6.2e-58
WP_004106370.1|5394403_5394874_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_002920115.1|5394969_5395344_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_024359852.1|5395468_5395756_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_049087547.1|5395763_5396123_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_064343279.1|5396122_5396509_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	41.4	1.6e-20
>prophage 379
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5402138	5414990	5944658		Tupanvirus(14.29%)	12	NA	NA
WP_049090174.1|5402138_5404043_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.1	1.5e-74
WP_064343427.1|5404104_5405595_-	nicotinate phosphoribosyltransferase	NA	K4F7Y4	Cronobacter_phage	50.1	1.6e-140
WP_049090175.1|5405599_5406469_-	ribose-phosphate pyrophosphokinase	NA	A0A2P1CBA5	Salmonella_phage	40.4	4.1e-48
WP_024359847.1|5406665_5407385_+	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	27.9	3.3e-19
WP_162626054.1|5407490_5408489_+	hydrolase	NA	NA	NA	NA	NA
WP_004125965.1|5408485_5408704_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	38.8	4.0e-05
WP_004138395.1|5408739_5409609_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_004106401.1|5409655_5410060_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242758.1|5410364_5410997_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_024359844.1|5411048_5413127_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	85.5	5.3e-62
WP_004138387.1|5413116_5414337_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_024359843.1|5414426_5414990_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	57.1	9.6e-59
>prophage 380
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5427143	5427971	5944658		Vibrio_phage(100.0%)	1	NA	NA
WP_004132251.1|5427143_5427971_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	51.1	9.4e-71
>prophage 381
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5442821	5448997	5944658		Staphylococcus_phage(50.0%)	3	NA	NA
WP_004870264.1|5442821_5444444_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	51.5	1.2e-141
WP_049087559.1|5444502_5446596_-	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_049090185.1|5446606_5448997_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	1.2e-14
>prophage 382
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5452490	5453249	5944658		Escherichia_phage(100.0%)	1	NA	NA
WP_024359827.1|5452490_5453249_-	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	31.1	5.1e-23
>prophage 383
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5456261	5458709	5944658		Dickeya_phage(100.0%)	1	NA	NA
WP_049087561.1|5456261_5458709_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	83.3	1.6e-33
>prophage 384
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5468607	5470707	5944658		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_004870224.1|5468607_5470707_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	32.8	4.3e-43
>prophage 385
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5479735	5481543	5944658		Enterococcus_phage(50.0%)	2	NA	NA
WP_064343289.1|5479735_5480476_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	26.9	3.1e-12
WP_004126131.1|5480472_5481543_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	34.7	2.6e-20
>prophage 386
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5489883	5491366	5944658		Anomala_cuprea_entomopoxvirus(100.0%)	2	NA	NA
WP_004126158.1|5489883_5490597_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.0	7.2e-11
WP_004126165.1|5490598_5491366_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	7.5e-14
>prophage 387
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5499873	5505633	5944658		Klosneuvirus(25.0%)	5	NA	NA
WP_024359814.1|5499873_5501139_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.3	8.3e-26
WP_064343292.1|5501256_5502771_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.8	3.9e-14
WP_004133023.1|5502802_5503657_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.7	7.0e-45
WP_024359812.1|5503913_5504972_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004106557.1|5504964_5505633_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	9.5e-13
>prophage 388
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5508723	5512922	5944658		Dickeya_phage(50.0%)	4	NA	NA
WP_004126194.1|5508723_5509350_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	5.5e-31
WP_064343293.1|5509428_5511633_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	37.0	2.1e-117
WP_004134789.1|5511844_5512090_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
WP_004126198.1|5512256_5512922_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.8	6.2e-57
>prophage 389
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5519224	5523331	5944658		Tupanvirus(66.67%)	3	NA	NA
WP_004134775.1|5519224_5521210_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	1.6e-20
WP_004134773.1|5521206_5522190_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase ArnC	NA	A8CG95	Salmonella_phage	32.7	2.8e-37
WP_064343294.1|5522191_5523331_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	27.4	6.1e-28
>prophage 390
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5529840	5534034	5944658		Bacillus_virus(50.0%)	5	NA	NA
WP_024359802.1|5529840_5530611_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.4	4.3e-17
WP_004134751.1|5530616_5531033_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_024359800.1|5531437_5532451_+	magnesium transporter	NA	NA	NA	NA	NA
WP_170960566.1|5532416_5532722_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004134748.1|5533080_5534034_+	hydroxyacid dehydrogenase	NA	A0A285PXZ1	Cedratvirus	32.8	1.5e-35
>prophage 391
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5548676	5550719	5944658		Indivirus(100.0%)	1	NA	NA
WP_004134707.1|5548676_5550719_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.0	1.7e-44
>prophage 392
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5561681	5563759	5944658		Bacillus_phage(100.0%)	2	NA	NA
WP_001157751.1|5561681_5562401_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_024359787.1|5562397_5563759_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.6	1.3e-11
>prophage 393
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5572177	5572606	5944658		Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_024359780.1|5572177_5572606_+	lysozyme	NA	A0A142EZW8	Stenotrophomonas_phage	33.6	2.0e-08
>prophage 394
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5609707	5615896	5944658		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_004132651.1|5609707_5611819_-	UDP-forming cellulose synthase catalytic subunit	NA	M1I277	Paramecium_bursaria_Chlorella_virus	33.9	5.6e-35
WP_024359763.1|5611839_5612643_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_064343307.1|5612633_5613191_-	cellulose biosynthesis protein BcsO	NA	NA	NA	NA	NA
WP_064343308.1|5613902_5614916_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.7e-18
WP_004126385.1|5614912_5615896_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.2	8.7e-15
>prophage 395
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5633176	5634148	5944658		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004137815.1|5633176_5634148_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1HST2	Paramecium_bursaria_Chlorella_virus	25.7	7.1e-17
>prophage 396
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5637501	5641006	5944658	transposase	Morganella_phage(33.33%)	4	NA	NA
WP_004126446.1|5637501_5637714_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	71.4	6.0e-22
WP_049086995.1|5637812_5639432_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1B0RXA0	Streptococcus_phage	26.0	5.6e-27
WP_004137811.1|5639735_5639888_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_049106381.1|5639959_5641006_+|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	22.9	1.0e-05
>prophage 397
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5644920	5645916	5944658		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_004137808.1|5644920_5645916_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.1	5.9e-11
>prophage 398
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5650745	5652287	5944658		Staphylococcus_phage(100.0%)	1	NA	NA
WP_064343314.1|5650745_5652287_+	xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	2.9e-17
>prophage 399
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5673381	5675223	5944658		Tupanvirus(100.0%)	1	NA	NA
WP_024359736.1|5673381_5675223_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	24.3	7.6e-12
>prophage 400
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5691157	5700289	5944658		Rhizobium_phage(20.0%)	9	NA	NA
WP_004106850.1|5691157_5691409_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	7.6e-16
WP_004126582.1|5691520_5691952_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_024359727.1|5692197_5693742_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_049086978.1|5693751_5695023_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	33.9	2.1e-08
WP_064343318.1|5695026_5695959_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_004137741.1|5695955_5696753_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004126597.1|5696913_5697939_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	82.7	1.0e-18
WP_024359723.1|5697948_5699142_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.6	1.3e-36
WP_024359722.1|5699356_5700289_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	36.1	1.1e-35
>prophage 401
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5713050	5714437	5944658		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_004106901.1|5713050_5713527_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.7	2.4e-26
WP_004137720.1|5713627_5714437_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.4	1.0e-24
>prophage 402
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5721288	5722936	5944658		Methanothermobacter_phage(50.0%)	2	NA	NA
WP_024359710.1|5721288_5722500_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	35.8	7.6e-45
WP_004126662.1|5722477_5722936_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	58.8	4.0e-47
>prophage 403
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5726444	5727668	5944658	integrase	Morganella_phage(100.0%)	1	5719810:5719821	5728276:5728287
5719810:5719821	attL	TTTGATTTTAGC	NA	NA	NA	NA
WP_064343323.1|5726444_5727668_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	41.0	1.6e-74
WP_064343323.1|5726444_5727668_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	41.0	1.6e-74
5728276:5728287	attR	TTTGATTTTAGC	NA	NA	NA	NA
>prophage 404
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5736445	5740651	5944658	transposase	Leptospira_phage(100.0%)	3	NA	NA
WP_087859145.1|5736445_5737553_+|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
WP_077265754.1|5737492_5738737_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_087859145.1|5739542_5740651_-|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
>prophage 405
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5757545	5762572	5944658		Bacillus_virus(33.33%)	4	NA	NA
WP_049089288.1|5757545_5759222_-	NAD-dependent DNA ligase LigB	NA	G3M9X7	Bacillus_virus	22.3	9.6e-22
WP_004137706.1|5759479_5760103_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	36.2	2.6e-20
WP_004106927.1|5760157_5760433_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_024359707.1|5760451_5762572_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	2.8e-10
>prophage 406
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5777955	5778807	5944658		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_004106970.1|5777955_5778807_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	1.3e-14
>prophage 407
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5781929	5783321	5944658		environmental_Halophage(100.0%)	1	NA	NA
WP_004137676.1|5781929_5783321_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	95.9	1.6e-67
>prophage 408
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5820028	5821195	5944658		Salmonella_phage(100.0%)	1	NA	NA
WP_004133139.1|5820028_5821195_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	24.7	5.9e-26
>prophage 409
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5825129	5826104	5944658	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_064343353.1|5825129_5826104_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.3	6.5e-71
>prophage 410
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5840851	5846193	5944658		Micromonas_sp._RCC1109_virus(50.0%)	6	NA	NA
WP_064343356.1|5840851_5842540_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.4	1.4e-60
WP_004107123.1|5842642_5842738_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_004107126.1|5843320_5843410_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_004133098.1|5843480_5843927_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004133095.1|5843997_5844831_+	EamA family transporter	NA	NA	NA	NA	NA
WP_024360558.1|5845008_5846193_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.7	2.2e-12
>prophage 411
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5858456	5864917	5944658		Synechococcus_phage(25.0%)	7	NA	NA
WP_004126915.1|5858456_5858885_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	5.5e-14
WP_004126917.1|5859003_5859417_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	35.4	1.3e-17
WP_162685356.1|5859787_5860117_+	YceK/YidQ family lipoprotein	NA	NA	NA	NA	NA
WP_049132000.1|5860118_5861345_-	DUF3748 domain-containing protein	NA	NA	NA	NA	NA
WP_064343358.1|5861404_5862349_-	2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	25.2	3.2e-14
WP_004871812.1|5862363_5863674_-	MFS transporter	NA	NA	NA	NA	NA
WP_004871813.1|5863768_5864917_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	8.0e-52
>prophage 412
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5870350	5877871	5944658		Bacillus_virus(33.33%)	7	NA	NA
WP_024360548.1|5870350_5872765_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.1	6.3e-115
WP_024360547.1|5872793_5873867_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_004107206.1|5874005_5875106_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.3	6.9e-53
WP_004871826.1|5875110_5876511_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_004871828.1|5877134_5877275_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_004871829.1|5877290_5877650_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_004871831.1|5877613_5877871_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	7.1e-17
>prophage 413
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5882620	5885319	5944658		Tetraselmis_virus(50.0%)	2	NA	NA
WP_004871837.1|5882620_5883502_-	MurR/RpiR family transcriptional regulator	NA	A0A2P0VNK5	Tetraselmis_virus	28.2	6.6e-06
WP_064343360.1|5883828_5885319_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	23.0	4.1e-08
>prophage 414
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5891208	5892546	5944658		Moraxella_phage(100.0%)	1	NA	NA
WP_004127003.1|5891208_5892546_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	36.2	1.3e-61
>prophage 415
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5898314	5905859	5944658		Bacillus_phage(25.0%)	6	NA	NA
WP_004107254.1|5898314_5899088_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.1	9.9e-14
WP_004107257.1|5899135_5900026_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004871867.1|5900025_5900985_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_004127017.1|5901120_5902161_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	38.4	4.0e-50
WP_004871870.1|5902477_5904307_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.9	4.3e-132
WP_024360536.1|5904488_5905859_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.0	3.6e-35
>prophage 416
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5920445	5921438	5944658		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_024360530.1|5920445_5921438_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	1.6e-48
>prophage 417
NZ_AP014951	Klebsiella oxytoca strain JKo3	5944658	5924608	5930484	5944658		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_004871930.1|5924608_5926477_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.2	1.2e-65
WP_064343366.1|5926659_5927079_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_024360528.1|5927089_5928595_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2K9L0W2	Tupanvirus	22.3	1.2e-18
WP_004855792.1|5928600_5929566_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_024360527.1|5929593_5930484_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	24.1	5.7e-05
>prophage 1
NZ_AP014952	Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence	209081	3199	12115	209081		Macacine_betaherpesvirus(33.33%)	8	NA	NA
WP_000523812.1|3199_4366_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	3.0e-224
WP_009309982.1|4365_5337_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.3	9.2e-150
WP_009309981.1|6619_6925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206783.1|6978_7230_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_064343432.1|7308_8580_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	9.5e-155
WP_009309980.1|8579_9005_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	2.9e-31
WP_004178082.1|9407_10895_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001568038.1|11143_12115_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
>prophage 2
NZ_AP014952	Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence	209081	42953	100534	209081	transposase	Salmonella_phage(33.33%)	48	NA	NA
WP_077265736.1|42953_43922_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.9e-172
WP_171840930.1|43941_44115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004195465.1|44115_44427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197817.1|44493_44898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023179972.1|45274_45673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197813.1|45744_48384_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_004197815.1|48383_48773_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_009309871.1|48772_49399_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_004194992.1|49440_49830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009309872.1|49826_50816_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_011977786.1|50828_51467_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_048288587.1|51525_53481_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_004195500.1|53512_53767_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_004152675.1|53744_53993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004194451.1|54005_54332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042946327.1|54352_55105_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_009309875.1|55115_55355_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_009309876.1|55326_55899_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_004152689.1|55891_56320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343437.1|56306_57677_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_147614328.1|57676_57916_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000227969.1|57890_58967_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_009309879.1|62658_63351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343439.1|65785_71044_+	conjugative transfer relaxase/helicase TraI	NA	A0A1P8DII4	Virus_Rctr197k	33.8	1.0e-05
WP_004206764.1|71087_71813_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.0	1.6e-05
WP_004178053.1|71969_72566_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_064343440.1|72585_72933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343441.1|73403_74048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040088256.1|74426_75818_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008103233.1|75814_76114_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_040088258.1|76097_77225_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_077265758.1|77975_78806_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_040088261.1|79005_79917_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_064343443.1|80199_80919_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_040088265.1|80921_81641_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_040088267.1|81741_82578_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_040088269.1|82802_84032_+	bifunctional succinylornithine transaminase/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.6	7.5e-24
WP_040088270.1|84028_85057_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_040088272.1|85053_86532_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_040088274.1|86543_87881_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_040088275.1|87926_88928_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_040088280.1|88969_89743_+	histidine ABC transporter ATP-binding protein HisP	NA	A0A2H4UUX5	Bodo_saltans_virus	24.8	8.1e-08
WP_040088276.1|89771_90128_+	RidA family protein	NA	NA	NA	NA	NA
WP_022652343.1|90431_91400_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.7e-183
WP_109910538.1|91752_92583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003031967.1|95913_96882_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.1	2.8e-13
WP_088765928.1|98017_99138_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_077265736.1|99565_100534_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.9e-172
>prophage 3
NZ_AP014952	Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_1, complete sequence	209081	110553	159989	209081	protease,transposase	Stx2-converting_phage(31.58%)	53	NA	NA
WP_074184081.1|110553_111522_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.9	1.5e-173
WP_004118209.1|113376_113640_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|113654_113918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|114141_114423_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_064343449.1|114457_115027_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_064343450.1|115132_117982_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.1	9.0e-129
WP_001446316.1|117981_118173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032731999.1|118233_120042_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	39.6	2.7e-94
WP_032427175.1|120129_120558_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_032427176.1|120610_121525_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_064343451.1|121627_122515_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_032427177.1|122604_123216_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_032732003.1|123295_124441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786814.1|124430_124871_+	heat resistance system thioredoxin Trx-GI	NA	A0A023NHA9	Dinoroseobacter_phage	34.7	5.8e-11
WP_032732004.1|124874_126590_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_003847780.1|126586_127084_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_032732006.1|127061_128027_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_032732007.1|128051_129203_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
WP_171840927.1|130476_130617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064343453.1|131845_133384_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.4	1.6e-273
WP_002952999.1|133433_133781_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	97.4	2.8e-61
WP_064343454.1|133777_134158_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	88.9	2.1e-57
WP_001567369.1|135185_135818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001272054.1|135846_137250_-|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|137450_137933_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|137920_138187_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004152108.1|138362_138617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152107.1|138692_138950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|138998_139202_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152105.1|139235_139604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|139647_140142_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152103.1|140172_140748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021312577.1|140735_141005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206664.1|141362_141713_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.1e-23
WP_004206665.1|141764_142127_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_016151356.1|142144_143896_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_023292114.1|143943_145233_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	5.6e-171
WP_007779002.1|145245_145671_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	1.3e-52
WP_165314624.1|146252_148004_-	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_032432072.1|148028_148391_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_016151352.1|148466_149012_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004182006.1|149020_149734_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004152092.1|149730_150057_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004196778.1|150388_150886_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_071830740.1|150935_151445_-	aquaporin	NA	NA	NA	NA	NA
WP_004196907.1|152803_154342_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.2	7.4e-295
WP_004196919.1|154390_154738_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	99.1	3.3e-62
WP_004196883.1|154734_155139_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	99.3	1.1e-69
WP_087859145.1|155460_156569_-|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
WP_004152086.1|156849_157029_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004152085.1|157260_157695_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_002436614.1|157911_159312_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
WP_001188930.1|159308_159989_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 1
NZ_AP014953	Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_2, complete sequence	104259	0	103515	104259	tail,transposase,integrase,portal,terminase	Salmonella_phage(90.32%)	107	1058:1080	104138:104160
WP_001293470.1|0_1056_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	98.0	1.5e-185
1058:1080	attL	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
WP_148719895.1|1316_2424_+|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	36.8	5.5e-42
WP_064343470.1|2436_2652_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	100.0	6.3e-35
WP_064343471.1|2651_2987_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	98.2	2.0e-56
WP_004110036.1|2983_3163_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	98.3	7.3e-21
WP_064343472.1|3203_3479_-	hypothetical protein	NA	J9Q738	Salmonella_phage	86.8	1.2e-38
WP_064343473.1|3547_3958_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	97.1	4.1e-75
WP_004110046.1|3941_4313_-	DUF2591 domain-containing protein	NA	J9Q7S7	Salmonella_phage	99.2	1.0e-69
WP_004110049.1|4475_5306_-	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	99.3	1.1e-127
WP_064343474.1|5309_5510_-	hypothetical protein	NA	J9Q6J0	Salmonella_phage	90.9	7.9e-24
WP_064343475.1|6680_6947_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	98.9	1.0e-39
WP_022649902.1|6946_7891_-	hypothetical protein	NA	J9Q7S6	Salmonella_phage	99.7	4.0e-182
WP_040110289.1|7951_8980_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	99.7	4.1e-164
WP_000102109.1|9099_9531_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	100.0	4.0e-73
WP_000459729.1|9776_10367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162933658.1|10460_10886_-	hypothetical protein	NA	J9Q7S4	Salmonella_phage	97.2	1.1e-70
WP_064343477.1|10900_14419_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	99.3	0.0e+00
WP_004110112.1|14599_15835_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	99.3	2.3e-238
WP_064343478.1|15931_18304_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	93.8	0.0e+00
WP_004110118.1|18413_18626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224608.1|18890_19277_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_050194546.1|19268_20375_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	32.2	2.1e-25
WP_064343479.1|20547_20964_-	type II toxin-antitoxin system YafO family toxin	NA	NA	NA	NA	NA
WP_006812569.1|20954_21479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006812570.1|21575_21821_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	1.0e-12
WP_032655934.1|21820_22186_-	phage family protein	NA	K7PH35	Enterobacteria_phage	65.6	1.5e-36
WP_064343480.1|22201_22405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045339937.1|22415_23189_-	phosphate starvation-inducible protein PhoH	NA	W8D063	Erwinia_phage	65.5	3.8e-90
WP_131087327.1|23350_23689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046340566.1|23720_24368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343481.1|25778_26084_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	96.0	1.7e-46
WP_022649968.1|26232_26445_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	98.6	5.8e-33
WP_064343482.1|26604_27927_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	99.5	9.6e-259
WP_022649966.1|27961_28438_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	98.7	2.2e-80
WP_064343483.1|28519_29314_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	96.6	1.2e-139
WP_064343484.1|29394_30510_-	DNA primase	NA	J9Q720	Salmonella_phage	98.1	6.5e-216
WP_006812582.1|30659_32000_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	99.8	1.3e-247
WP_064343485.1|32060_32786_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	98.8	4.9e-140
WP_064343486.1|33080_34139_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	44.4	3.4e-65
WP_162933659.1|34199_34553_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	100.0	1.9e-44
WP_064343488.1|34558_35224_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	99.1	3.1e-117
WP_032623541.1|35378_36080_-	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	99.6	5.4e-136
WP_016051638.1|36112_36535_-	hypothetical protein	NA	J9Q6E9	Salmonella_phage	100.0	5.7e-72
WP_016051635.1|36883_37135_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	100.0	6.6e-36
WP_064343489.1|37136_37829_-	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	97.0	3.9e-126
WP_004109805.1|37845_38169_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	95.3	2.3e-49
WP_064343490.1|38268_39702_-|tail	tail fiber domain-containing protein	tail	A0A0H4TGH1	Klebsiella_phage	35.8	1.6e-33
WP_064343491.1|39754_51928_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	48.3	1.3e-22
WP_004109814.1|51944_52556_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	71.6	3.2e-76
WP_064343492.1|52543_53341_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	84.9	2.1e-139
WP_004109820.1|53333_54032_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	87.4	1.2e-122
WP_032423010.1|54118_54454_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	84.5	2.6e-51
WP_064343493.1|54497_59036_-	tape measure protein	NA	J9Q712	Salmonella_phage	72.7	0.0e+00
WP_014342129.1|59043_59268_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	93.2	2.0e-31
WP_004109835.1|59393_59711_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	93.3	1.8e-46
WP_004109839.1|59772_60519_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	3.7e-106
WP_004109842.1|60586_60979_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	69.8	1.4e-48
WP_004109845.1|60980_61454_-	hypothetical protein	NA	J9Q711	Salmonella_phage	93.6	1.9e-76
WP_004109848.1|61444_61789_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	92.1	7.4e-54
WP_004109850.1|61886_62720_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	84.5	1.3e-131
WP_023279433.1|62719_63154_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	84.0	2.9e-63
WP_047065788.1|63201_63630_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	71.6	1.0e-28
WP_064343494.1|63708_64587_-	hypothetical protein	NA	J9Q710	Salmonella_phage	94.5	2.8e-153
WP_064343495.1|64613_65513_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	88.0	2.5e-133
WP_064343496.1|65535_67110_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	88.4	4.3e-274
WP_004109863.1|67142_68399_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	97.4	9.4e-248
WP_004109866.1|68401_69043_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	88.2	5.0e-96
WP_004109869.1|69218_69485_-	hypothetical protein	NA	J9Q757	Salmonella_phage	90.9	1.3e-37
WP_004109872.1|69494_70385_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	97.0	5.4e-165
WP_004109875.1|70381_70933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004109877.1|70922_71564_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	96.2	2.6e-108
WP_004109879.1|71560_72229_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	93.1	4.3e-106
WP_064343497.1|72228_72933_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	90.2	8.8e-110
WP_004109885.1|72992_74552_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.5	2.9e-278
WP_004109887.1|74554_74830_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	68.1	3.1e-26
WP_004109889.1|74880_75318_-	hypothetical protein	NA	A0A1V0E8D6	Vibrio_phage	37.0	9.5e-14
WP_004109890.1|75473_76004_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	85.1	9.3e-72
WP_139157562.1|76013_76313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004109892.1|76636_77287_+	hypothetical protein	NA	J9Q754	Salmonella_phage	91.7	8.4e-107
WP_004109904.1|77337_77541_+	hypothetical protein	NA	J9Q7I3	Salmonella_phage	95.5	4.1e-28
WP_064343498.1|78133_78616_-	hypothetical protein	NA	J9Q805	Salmonella_phage	78.1	4.2e-71
WP_064343499.1|78821_79103_-	ABC transporter	NA	J9Q753	Salmonella_phage	81.7	1.0e-40
WP_032440494.1|79229_79637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162933655.1|79756_80056_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	68.7	3.2e-29
WP_004109924.1|80204_80564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064343501.1|82132_82516_-	hypothetical protein	NA	J9Q750	Salmonella_phage	62.0	7.5e-23
WP_087859145.1|82560_83668_+|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
WP_004109939.1|84014_85700_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	98.0	0.0e+00
WP_004109941.1|86089_88159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004109944.1|88327_88822_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	98.8	1.9e-82
WP_004109947.1|88964_89573_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	97.0	6.6e-114
WP_000262979.1|90169_90400_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	100.0	2.1e-36
WP_064343502.1|90602_91196_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	98.5	1.9e-110
WP_004109978.1|91381_92224_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	90.4	2.1e-102
WP_004109984.1|92434_93541_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_058662781.1|93579_94122_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	97.8	6.6e-97
WP_004109992.1|94131_94551_-	hypothetical protein	NA	J9Q743	Salmonella_phage	97.8	6.4e-68
WP_004109994.1|94614_95259_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	99.5	1.2e-116
WP_064343503.1|95258_95735_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	99.4	4.0e-90
WP_160956520.1|95731_96127_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.7	3.6e-68
WP_064343504.1|96146_97250_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	98.4	5.8e-217
WP_004110004.1|97439_98309_-	hypothetical protein	NA	J9Q742	Salmonella_phage	98.6	6.1e-161
WP_002231164.1|98391_99534_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	100.0	1.7e-219
WP_071830756.1|99641_101537_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	93.0	4.7e-283
WP_000832167.1|101765_102269_+	hypothetical protein	NA	J9Q7Z6	Salmonella_phage	98.2	5.5e-90
WP_004110023.1|102300_102795_-	GNAT family N-acetyltransferase	NA	J9Q6J3	Salmonella_phage	98.2	7.8e-89
WP_004110025.1|102870_103515_-	hypothetical protein	NA	J9Q739	Salmonella_phage	99.5	5.7e-124
104138:104160	attR	CCAACCACTGTAGAGAGTAGAAA	NA	NA	NA	NA
>prophage 1
NZ_AP014954	Klebsiella oxytoca strain JKo3 plasmid pKO_JKo3_3, complete sequence	81481	2960	43494	81481	transposase,integrase	Leptospira_phage(12.5%)	48	NA	NA
WP_013815099.1|2960_3929_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_064343506.1|3970_4429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020805590.1|4459_5032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000272716.1|5028_5277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020315560.1|5713_6403_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004193995.1|6434_7124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145997648.1|7659_7947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343508.1|7994_8645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343542.1|8669_9446_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.5	2.7e-51
WP_020804955.1|9590_10580_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	55.1	1.5e-70
WP_087859145.1|11506_12614_+|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
WP_032743918.1|13000_13621_+	ParA family protein	NA	A2I303	Vibrio_virus	32.4	1.5e-17
WP_032743917.1|13670_13901_+	DNA partition complex ParG	NA	NA	NA	NA	NA
WP_058914060.1|13943_14144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064343509.1|14245_15520_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.4	2.4e-158
WP_032743916.1|15519_15945_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.7	4.9e-31
WP_032743912.1|16153_16384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343510.1|16819_17521_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	34.1	5.3e-22
WP_064343511.1|17520_17742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343512.1|17751_18171_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_048756101.1|18223_18991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171840931.1|19064_19208_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_048757065.1|19902_20409_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	32.4	1.5e-07
WP_000761848.1|20451_20643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048757064.1|20843_21107_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	53.8	2.0e-14
WP_064343513.1|21135_21456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343514.1|22226_22763_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	73.2	5.9e-50
WP_064343515.1|22812_23061_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_064343516.1|23129_25130_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.8e-22
WP_142255945.1|25170_25605_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_048757529.1|25601_26330_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_048757527.1|26326_26650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118128.1|26870_28031_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.4	2.1e-39
WP_064343517.1|28347_30546_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_048757617.1|30542_31859_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_064343518.1|31862_34172_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_022644716.1|35365_35593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020804025.1|35685_35916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343519.1|35964_36840_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_064343520.1|37619_37958_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	52.9	1.1e-22
WP_064343521.1|38013_38361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343522.1|38453_38600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064343523.1|38647_39481_+	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	33.8	1.1e-21
WP_071830763.1|39632_39914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064343524.1|40106_40649_+	antirestriction protein	NA	NA	NA	NA	NA
WP_064343543.1|40671_41154_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_020805752.1|41597_41990_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_087859145.1|42386_43494_+|transposase	IS3-like element ISKpn20 family transposase	transposase	S5WIU1	Leptospira_phage	37.2	1.1e-42
