The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014950	Klebsiella pneumoniae strain YH43	5520319	1690045	1707881	5520319		Enterobacteria_phage(28.57%)	16	NA	NA
WP_000043543.1|1690045_1691452_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_012967599.1|1691678_1693094_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	3.1e-53
WP_061153926.1|1693115_1694486_+	O9 family phosphomannomutase RfbK2	NA	A0A127AWJ1	Bacillus_phage	26.7	3.8e-32
WP_047666784.1|1694643_1695708_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	1.3e-104
WP_061153927.1|1695721_1696591_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
WP_061153928.1|1696622_1697513_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.9	1.4e-27
WP_061153929.1|1697527_1698082_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.1	5.6e-51
WP_000704907.1|1698261_1699428_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_004144151.1|1699852_1699975_-	small membrane protein	NA	NA	NA	NA	NA
WP_061153931.1|1700373_1701378_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.7	6.8e-31
WP_061153932.1|1702230_1703295_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	4.9e-104
WP_061153927.1|1703308_1704178_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	9.8e-111
WP_023297949.1|1704209_1705100_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.9	1.8e-27
WP_061153933.1|1705114_1705669_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.1	2.5e-51
WP_158609881.1|1705756_1706530_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_061153934.1|1706519_1707881_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	1.5e-12
>prophage 2
NZ_AP014950	Klebsiella pneumoniae strain YH43	5520319	1813158	1951239	5520319	capsid,head,holin,portal,tRNA,protease,integrase,terminase,tail	Klebsiella_phage(35.87%)	147	1876158:1876217	1929742:1929870
WP_004184758.1|1813158_1814151_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
WP_004184757.1|1814152_1814380_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
WP_040227357.1|1815730_1816156_-	HNH endonuclease	NA	C6ZR29	Salmonella_phage	81.5	5.5e-59
WP_025714330.1|1816623_1816932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061154004.1|1817059_1817845_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	3.8e-61
WP_004184747.1|1817844_1818144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061154005.1|1818233_1819151_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.2	1.3e-44
WP_004184742.1|1819462_1820617_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	28.2	1.5e-34
WP_004184740.1|1820787_1821264_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	2.0e-12
WP_004197463.1|1821365_1821629_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	47.9	3.7e-13
WP_061154006.1|1821657_1822110_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.2	5.9e-67
WP_004184738.1|1822347_1822527_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
WP_061156340.1|1822516_1823485_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	2.1e-85
WP_061154007.1|1823481_1824291_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	4.5e-110
WP_061154008.1|1824300_1824678_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	1.3e-46
WP_061154009.1|1824690_1825671_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	67.2	1.2e-133
WP_061154010.1|1825684_1826263_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_061154011.1|1826375_1826975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017145563.1|1827060_1827456_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|1827442_1827724_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_032412057.1|1827723_1828353_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.4	9.0e-106
WP_032412056.1|1828360_1828636_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	60.7	4.3e-20
WP_049016906.1|1828859_1829795_+	DUF4747 family protein	NA	NA	NA	NA	NA
WP_016530196.1|1829799_1830426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071839060.1|1831059_1831410_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.1	7.8e-51
WP_032750791.1|1831566_1832064_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.7	2.2e-62
WP_048335121.1|1832063_1833821_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	90.8	0.0e+00
WP_032408651.1|1833831_1834017_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	61.7	6.2e-15
WP_048335123.1|1834016_1835246_+|portal	phage portal protein	portal	U5P411	Shigella_phage	82.7	3.7e-204
WP_061154014.1|1835232_1835886_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	86.9	3.5e-105
WP_040186336.1|1835900_1837109_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.2	1.7e-193
WP_061154015.1|1837147_1837351_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	1.8e-07
WP_040186339.1|1837347_1837668_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
WP_004216816.1|1837737_1837935_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	98.5	6.4e-26
WP_061154017.1|1837936_1838269_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	9.0e-57
WP_061154018.1|1838261_1838801_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	98.3	1.5e-93
WP_004104227.1|1838797_1839163_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	95.9	8.4e-64
WP_004104226.1|1839219_1839711_+	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	99.4	2.5e-87
WP_001177591.1|1839754_1840108_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_061154019.1|1840140_1840404_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	97.7	1.5e-43
WP_061154020.1|1840467_1840860_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	41.4	4.7e-20
WP_061154021.1|1840929_1843362_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	85.8	0.0e+00
WP_004207036.1|1843361_1843832_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.7	8.3e-64
WP_023317177.1|1843828_1844311_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	90.6	7.2e-79
WP_061154022.1|1844320_1844689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023341366.1|1844669_1844939_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_061154023.1|1845068_1845449_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	92.1	1.9e-66
WP_061154024.1|1845445_1848508_+	kinase	NA	A0A286S259	Klebsiella_phage	89.9	0.0e+00
WP_061154026.1|1850902_1852861_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_061154028.1|1854109_1854481_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	47.1	6.6e-24
WP_061154029.1|1855088_1856234_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.2	1.4e-117
WP_061154030.1|1856772_1857054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061154031.1|1857096_1857804_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.1	3.7e-07
WP_171841577.1|1857880_1859281_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	51.7	4.8e-99
WP_061154033.1|1859261_1859756_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	52.2	1.8e-32
WP_061154034.1|1859730_1860642_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_061154035.1|1860824_1861736_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_061156341.1|1861851_1863531_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.9	1.0e-18
WP_165784174.1|1863830_1864052_-	YodD family protein	NA	NA	NA	NA	NA
WP_061154037.1|1864185_1864377_+	protein DsrB	NA	NA	NA	NA	NA
WP_061154038.1|1864409_1865033_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_162677290.1|1865405_1865840_+	lipoprotein	NA	NA	NA	NA	NA
WP_061154040.1|1865885_1867373_-	alpha-amylase	NA	NA	NA	NA	NA
WP_061154041.1|1867573_1868374_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_061154042.1|1868469_1869456_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_008804215.1|1869471_1870140_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_061154043.1|1870136_1870889_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	1.3e-26
WP_061154044.1|1871206_1871929_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_061154045.1|1871996_1872221_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_002911539.1|1872682_1873339_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_061154046.1|1873335_1875168_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_008804219.1|1875225_1875774_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
1876158:1876217	attL	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGGTACCATTG	NA	NA	NA	NA
WP_040188681.1|1876307_1877342_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	63.1	3.5e-123
WP_071839062.1|1877341_1877572_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_040188683.1|1877638_1877830_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	88.9	7.3e-27
WP_042345976.1|1877826_1878612_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	1.3e-61
WP_032741705.1|1878611_1878911_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	8.5e-14
WP_040188688.1|1879256_1879913_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	88.1	1.5e-108
WP_061154047.1|1880012_1880210_+	hypothetical protein	NA	K7PHB1	Enterobacterial_phage	86.2	1.7e-23
WP_040188690.1|1880244_1880697_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.8	3.5e-67
WP_071839063.1|1880934_1881114_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	71.2	7.8e-15
WP_061156342.1|1881103_1882057_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	71.2	2.4e-94
WP_061154049.1|1882053_1882863_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	1.0e-109
WP_071839064.1|1882887_1883868_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	8.4e-135
WP_061154050.1|1883886_1884228_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	85.0	2.3e-55
WP_061154051.1|1884276_1884762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061154052.1|1884786_1885608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061154054.1|1886300_1886642_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_017880269.1|1887546_1887762_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_061154055.1|1887761_1888259_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	86.4	5.6e-79
WP_016160650.1|1888255_1888606_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_142375566.1|1888873_1889086_+	hypothetical protein	NA	A0A286N2Q9	Klebsiella_phage	67.1	1.7e-21
WP_148719719.1|1889551_1889758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880264.1|1889741_1890104_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	84.2	1.8e-58
WP_023159881.1|1890055_1890379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017880263.1|1890375_1890807_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.7	3.7e-42
WP_012542168.1|1891056_1891491_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_061154056.1|1891490_1893212_+|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	56.6	7.2e-190
WP_020318187.1|1893205_1893385_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.9	6.8e-11
WP_061154057.1|1893384_1894644_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.5	3.1e-222
WP_061154058.1|1894680_1895601_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	3.6e-148
WP_061154059.1|1895678_1896965_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	83.6	2.9e-204
WP_020317538.1|1897346_1897664_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_014228910.1|1897660_1897999_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_017880258.1|1897979_1898369_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	86.0	9.6e-58
WP_017898997.1|1898365_1898767_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_014228913.1|1898798_1899260_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228914.1|1899317_1899683_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_061154061.1|1899915_1903251_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.9	0.0e+00
WP_017880254.1|1903250_1903589_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
WP_023289191.1|1903585_1904341_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
WP_017880253.1|1904342_1905053_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.3	8.5e-137
WP_148719720.1|1905084_1905435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228919.1|1905450_1906062_+|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	72.5	5.3e-71
WP_061154062.1|1906124_1918712_+	carbohydrate binding domain-containing protein	NA	Q6UAW1	Klebsiella_phage	48.9	0.0e+00
WP_061154063.1|1918773_1920198_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	52.3	3.5e-97
WP_141651119.1|1920781_1920892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077274726.1|1921576_1922626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061154064.1|1922628_1922997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061154065.1|1923390_1923759_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	44.8	2.0e-20
WP_061154066.1|1923879_1924257_+	VOC family protein	NA	NA	NA	NA	NA
WP_061154067.1|1924314_1924638_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_061156344.1|1924757_1925657_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_032732989.1|1925764_1926418_-	LysE family translocator	NA	NA	NA	NA	NA
WP_061154068.1|1926605_1927031_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.1e-50
WP_061154069.1|1927043_1928333_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	70.2	9.3e-166
WP_061154070.1|1928377_1928698_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	52.4	6.5e-20
WP_061154071.1|1928784_1929483_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	69.0	2.2e-89
WP_061154072.1|1930020_1930902_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
1929742:1929870	attR	GATTTAAAATCCCTCGGCGTTCGCGCTGTGTGGGTTCAAGTCCCACTCCGGGTACCATTGGGATAAAAGCAGAATAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTACGGGTGGTTTTTTTGTTTC	NA	NA	NA	NA
WP_061154073.1|1930992_1931661_+	YecA family protein	NA	NA	NA	NA	NA
WP_061154074.1|1931687_1932899_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_061154075.1|1933089_1933329_+	YecH family protein	NA	NA	NA	NA	NA
WP_008804225.1|1933364_1933862_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_061154076.1|1934272_1934911_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_061154077.1|1934948_1936370_-	MFS transporter	NA	NA	NA	NA	NA
WP_002911524.1|1936520_1936772_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_162678270.1|1936809_1938321_-	MFS transporter	NA	NA	NA	NA	NA
WP_061154079.1|1938613_1939123_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_002911518.1|1940013_1940994_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_061154080.1|1941054_1942569_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	5.3e-11
WP_004203438.1|1942583_1943564_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_061154081.1|1943725_1944514_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_061154082.1|1944488_1945913_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_008804235.1|1945936_1946365_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_061154083.1|1946716_1948300_+	MFS transporter	NA	NA	NA	NA	NA
WP_061154084.1|1948304_1949444_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_061154085.1|1949505_1951239_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	4.0e-87
>prophage 3
NZ_AP014950	Klebsiella pneumoniae strain YH43	5520319	2817258	2828141	5520319		Escherichia_phage(87.5%)	9	NA	NA
WP_061154663.1|2817258_2820366_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_008804978.1|2820420_2821686_+	MFS transporter	NA	NA	NA	NA	NA
WP_061154664.1|2821716_2822805_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	97.2	1.7e-205
WP_008804980.1|2822892_2823153_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	95.3	3.0e-39
WP_061154665.1|2823447_2824308_+	class A beta-lactamase LEN-42	NA	A0A077SL40	Escherichia_phage	91.3	2.7e-145
WP_061154666.1|2824326_2825088_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	98.4	4.0e-132
WP_061154667.1|2825348_2826251_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.0	6.5e-158
WP_061154668.1|2826262_2827528_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.4	7.6e-229
WP_061154669.1|2827520_2828141_+	aldolase	NA	A0A077SK32	Escherichia_phage	97.1	4.8e-112
>prophage 4
NZ_AP014950	Klebsiella pneumoniae strain YH43	5520319	3294411	3340813	5520319	capsid,head,tRNA,portal,terminase,integrase,tail,plate	Enterobacteria_phage(54.55%)	55	3299640:3299657	3337077:3337094
WP_008807680.1|3294411_3294912_+|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_008807681.1|3295029_3295476_+	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_171841557.1|3295459_3296254_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171841582.1|3296360_3297536_+	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_061154985.1|3297567_3298260_-	CTP synthase	NA	NA	NA	NA	NA
WP_061154986.1|3298405_3298915_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_162678316.1|3298919_3299258_+	DUF488 family protein	NA	NA	NA	NA	NA
WP_025713446.1|3299247_3299487_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
3299640:3299657	attL	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_071839088.1|3299752_3300004_-	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	51.6	2.0e-08
WP_061154987.1|3300047_3301187_-	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.7	2.7e-145
WP_061154988.1|3301341_3302514_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.5	5.0e-158
WP_061154989.1|3302513_3303029_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	60.6	6.3e-57
WP_004131585.1|3303074_3303392_+	hypothetical protein	NA	B9A7B2	Serratia_phage	54.8	1.0e-17
WP_071993210.1|3303412_3303550_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_061154990.1|3303536_3306512_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.4	2.6e-219
WP_061154991.1|3306526_3307006_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	64.8	4.8e-51
WP_061154992.1|3307581_3308034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061154993.1|3308043_3310821_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_061154994.1|3311115_3312213_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	29.0	4.2e-10
WP_061154995.1|3312197_3312413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061154996.1|3312409_3315439_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	37.6	2.9e-24
WP_061154997.1|3315428_3316352_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	43.2	1.3e-52
WP_017898624.1|3316353_3316704_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	56.5	1.2e-27
WP_061154998.1|3316700_3317288_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	59.5	1.3e-58
WP_061154999.1|3317284_3317920_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.0	3.9e-56
WP_032437023.1|3317916_3318384_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	60.1	3.1e-47
WP_134878507.1|3318384_3318660_-	peptidase	NA	NA	NA	NA	NA
WP_061155000.1|3318906_3319452_-	lysozyme	NA	A0A1S5Q8G1	Aeromonas_phage	40.9	4.5e-29
WP_004213110.1|3319448_3319733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045854925.1|3319723_3319924_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	64.6	1.6e-16
WP_048024509.1|3319923_3320439_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	50.0	1.8e-40
WP_061155001.1|3320543_3321410_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.5	5.8e-71
WP_020324085.1|3321459_3322494_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	50.0	8.1e-96
WP_061155002.1|3322504_3323344_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	1.2e-94
WP_061155003.1|3323501_3325229_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.7	3.0e-228
WP_061155004.1|3325222_3326284_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.7	9.1e-143
WP_148719726.1|3326722_3328987_+	restriction endonuclease	NA	A0A1L2BY82	Clostridium_phage	28.2	2.0e-54
WP_061155006.1|3329109_3329628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061155007.1|3329630_3332180_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	58.7	1.5e-247
WP_061155008.1|3332217_3333153_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.0	1.3e-84
WP_061155009.1|3333385_3333952_-	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	33.2	1.2e-13
WP_004213098.1|3333948_3334173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023328079.1|3334250_3334514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032432798.1|3334529_3334907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004131515.1|3334922_3335141_-	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	4.7e-06
WP_023339925.1|3335161_3335440_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	87.8	2.4e-42
WP_048024533.1|3335561_3335861_+	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	85.9	3.0e-43
WP_024359508.1|3335976_3336960_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.4	1.7e-151
WP_061155010.1|3337225_3338239_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	30.5	6.4e-13
3337077:3337094	attR	CCCGACGGGGCTTTTTTT	NA	NA	NA	NA
WP_004150782.1|3338296_3338398_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_004892898.1|3338397_3338472_+	protein YoaJ	NA	NA	NA	NA	NA
WP_012542130.1|3338591_3338717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004203731.1|3338776_3339040_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_061155011.1|3339170_3339809_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_061155012.1|3339898_3340813_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	5.0e-73
>prophage 5
NZ_AP014950	Klebsiella pneumoniae strain YH43	5520319	3372246	3424766	5520319	capsid,lysis,head,holin,portal,terminase,integrase,tail	Klebsiella_phage(38.89%)	49	3402612:3402627	3432513:3432528
WP_061155039.1|3372246_3373305_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.0	3.6e-14
WP_061155040.1|3373726_3375151_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	48.7	3.8e-96
WP_148719727.1|3375212_3387815_-	carbohydrate binding domain-containing protein	NA	Q6UAW1	Klebsiella_phage	41.6	0.0e+00
WP_099729057.1|3387872_3388448_-|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	57.0	1.1e-49
WP_061155041.1|3388461_3389169_-	C40 family peptidase	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	45.4	1.7e-60
WP_012542162.1|3389171_3389921_-|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	57.2	2.6e-83
WP_061155042.1|3390013_3390373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039103081.1|3390385_3390736_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	7.6e-22
WP_061155043.1|3390735_3393732_-|tail	phage tail tape measure protein	tail	A0A2H4J7J3	uncultured_Caudovirales_phage	25.5	2.6e-33
WP_016160678.1|3393960_3394305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039103079.1|3394319_3394787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171841558.1|3394807_3395221_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	59.3	1.5e-37
WP_048964996.1|3395225_3395606_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	67.8	3.9e-40
WP_046881319.1|3395586_3395925_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	92.0	6.6e-55
WP_061155044.1|3395921_3396239_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	87.8	8.4e-44
WP_014907814.1|3396219_3396480_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	1.5e-22
WP_014228907.1|3396538_3397825_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_032429388.1|3397902_3398823_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	9.6e-149
WP_012542166.1|3398859_3400119_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	2.8e-223
WP_017898992.1|3400118_3400298_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	3.1e-11
WP_021462603.1|3400291_3402013_-|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.5e-190
WP_012542168.1|3402012_3402447_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
3402612:3402627	attL	GGCTGCGCCAGCGGCG	NA	NA	NA	NA
WP_023289184.1|3402696_3403128_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	1.1e-41
WP_061155045.1|3403124_3403442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014228901.1|3403393_3403756_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_061155046.1|3404324_3404843_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	93.6	9.1e-88
WP_061155047.1|3405151_3405613_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	57.9	2.6e-38
WP_061155048.1|3405609_3406140_-	lysozyme	NA	G9L6J6	Escherichia_phage	83.7	3.1e-83
WP_004111739.1|3406117_3406354_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	82.6	4.0e-27
WP_128316005.1|3407014_3407218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061155049.1|3407461_3408064_-	hypothetical protein	NA	H9C175	Pectobacterium_phage	67.5	1.6e-75
WP_061155050.1|3408080_3409112_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	1.6e-96
WP_061155052.1|3409311_3409704_-	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	35.6	3.0e-11
WP_050597314.1|3409744_3409984_-	hypothetical protein	NA	H6WRY6	Salmonella_phage	58.6	1.9e-16
WP_043875513.1|3410046_3410280_-	DinI family protein	NA	K7PM44	Enterobacteria_phage	71.4	3.4e-26
WP_071839091.1|3410731_3410929_+	DUF1737 domain-containing protein	NA	NA	NA	NA	NA
WP_061155053.1|3411795_3417687_+	DUF3320 domain-containing protein	NA	NA	NA	NA	NA
WP_061155054.1|3417989_3418439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043875529.1|3418452_3418917_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	72.2	2.4e-63
WP_077257623.1|3418909_3419914_-	helix-turn-helix domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	44.2	2.1e-32
WP_043875517.1|3419973_3420528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071839093.1|3420530_3420755_-	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	56.7	1.0e-11
WP_014228883.1|3420856_3421240_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	63.5	5.1e-19
WP_071839094.1|3421569_3421884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039103071.1|3422273_3422468_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_061155056.1|3422510_3422855_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_071839095.1|3423084_3423360_+	3'-5' exoribonuclease	NA	A0A2I7RDR9	Vibrio_phage	59.2	4.1e-23
WP_012542206.1|3423412_3423658_+	excisionase	NA	NA	NA	NA	NA
WP_043875519.1|3423638_3424766_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	58.4	2.6e-119
3432513:3432528	attR	CGCCGCTGGCGCAGCC	NA	NA	NA	NA
>prophage 6
NZ_AP014950	Klebsiella pneumoniae strain YH43	5520319	3670427	3679875	5520319	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_061155194.1|3670427_3672149_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.7	2.6e-14
WP_061155195.1|3672188_3672893_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3673244_3673463_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_061155196.1|3673581_3675861_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	1.8e-164
WP_002896520.1|3675891_3676209_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3676534_3676756_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_061155197.1|3676822_3678763_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	2.9e-38
WP_061155198.1|3678759_3679875_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
