The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	899	52293	5896839	transposase,integrase,holin,protease,tRNA	Streptococcus_phage(11.11%)	46	768:783	5486:5501
768:783	attL	CAGAGATGACATATGA	NA	NA	NA	NA
WP_000727738.1|899_1676_+|integrase	YidC family membrane integrase SpoIIIJ	integrase	NA	NA	NA	NA
WP_000111516.1|1672_2290_+	protein jag	NA	NA	NA	NA	NA
WP_000393754.1|2516_3893_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_000541031.1|3939_5829_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
5486:5501	attR	CAGAGATGACATATGA	NA	NA	NA	NA
WP_001019628.1|5850_6570_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_000799016.1|6675_7548_+	nucleoid occlusion protein	NA	S5VTK0	Leptospira_phage	36.4	9.1e-16
WP_113303242.1|7711_8500_+	sporulation initiation inhibitor protein Soj	NA	Q8JL10	Natrialba_phage	29.7	6.3e-24
WP_001051830.1|8492_9344_+	stage 0 sporulation protein Spo0J	NA	I3NLC2	Bifidobacterium_phage	34.4	2.5e-18
WP_001020714.1|9364_9961_-|protease	spore protease YyaC	protease	A0A0A8WIQ6	Clostridium_phage	39.4	2.1e-24
WP_000364814.1|10220_11102_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_060851485.1|11122_11320_+	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_060851486.1|11435_12536_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001233778.1|12727_13018_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000981966.1|13044_13557_+	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	63.5	7.9e-52
WP_000918873.1|13602_13836_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_000814838.1|13915_14851_+	YybS family protein	NA	NA	NA	NA	NA
WP_001113785.1|14929_16903_+	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_000864228.1|16899_17346_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001286148.1|17373_18735_+	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	52.8	6.6e-122
WP_000100238.1|18950_20240_+	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	36.6	6.6e-71
WP_000971865.1|21034_21742_+	cell wall metabolism DNA-binding response regulator WalR	NA	W8CYM9	Bacillus_phage	42.7	7.6e-45
WP_000755367.1|21745_23587_+	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.0	8.9e-37
WP_000061560.1|23583_24900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000383740.1|24880_25723_+	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_000522837.1|25706_26501_+	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.3	6.1e-43
WP_000008033.1|26564_27740_+|protease	serine protease	protease	W5SAB9	Pithovirus	31.9	1.0e-09
WP_001052827.1|27793_27979_+	CxxH/CxxC protein	NA	NA	NA	NA	NA
WP_001027000.1|28038_28518_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_060851487.1|29605_31042_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000713633.1|32490_33369_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000800228.1|33408_35226_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	39.2	7.5e-121
WP_000432447.1|35362_36346_-	GMP reductase	NA	G3MBI2	Bacillus_virus	84.7	3.4e-160
WP_000039350.1|36821_38267_+	ATP-dependent RNA helicase DbpA	NA	A0A1V0SBR7	Catovirus	34.4	4.5e-60
WP_000427879.1|38307_38868_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_000995363.1|39032_39680_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_000996541.1|39864_40881_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	51.6	3.6e-96
WP_000542575.1|41326_41917_+	acetamide transporter	NA	NA	NA	NA	NA
WP_002026638.1|42016_42904_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000094042.1|42992_43619_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	53.7	6.9e-58
WP_000047627.1|43836_44907_+	nitric oxide synthase oxygenase	NA	NA	NA	NA	NA
WP_001242442.1|45267_46836_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	23.9	4.3e-16
WP_001103412.1|46888_48187_-	MFS transporter	NA	NA	NA	NA	NA
WP_000933565.1|48513_50283_+	two-component system sensor histidine kinase LytS	NA	Q9EYF3	Enterobacteria_phage	30.6	1.3e-64
WP_000921843.1|50260_51001_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000104901.1|51133_51565_+|holin	antiholin-like murein hydrolase modulator LrgA	holin	NA	NA	NA	NA
WP_000168869.1|51600_52293_+|holin	antiholin-like protein LrgB	holin	NA	NA	NA	NA
>prophage 2
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	316936	360556	5896839	transposase,head,capsid,holin,protease,terminase,tail,portal	Bacillus_phage(36.96%)	51	NA	NA
WP_000926669.1|316936_317572_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.6	8.1e-38
WP_000684725.1|317808_318651_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.3	3.6e-17
WP_000400857.1|318823_319138_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060851522.1|319286_320699_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	1.3e-11
WP_060851523.1|320826_321228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851524.1|321259_322615_-	recombinase family protein	NA	A0A1B1P7M0	Bacillus_phage	84.3	7.9e-216
WP_060851525.1|322633_323290_-	helix-turn-helix domain-containing protein	NA	A0A1B1P7L1	Bacillus_phage	96.3	9.6e-119
WP_060851526.1|323486_323723_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JE95	uncultured_Caudovirales_phage	97.4	2.8e-36
WP_060851527.1|323735_323966_+	hypothetical protein	NA	A0A1B1P7N2	Bacillus_phage	71.4	2.5e-21
WP_171840934.1|323962_324115_+	hypothetical protein	NA	A0A1B1P7M3	Bacillus_phage	96.0	8.4e-18
WP_165365583.1|324130_324301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016125194.1|324394_324598_+	hypothetical protein	NA	A0A1B2APY4	Phage_Wrath	78.8	4.9e-21
WP_016125193.1|324597_324879_+	hypothetical protein	NA	A0A1B2AQ09	Phage_Wrath	86.0	2.9e-40
WP_060851528.1|324856_325405_+	host-nuclease inhibitor Gam family protein	NA	A0A2H4JFX2	uncultured_Caudovirales_phage	91.2	7.3e-88
WP_060851529.1|325410_326007_+	hypothetical protein	NA	A0A1B2AQ10	Phage_Wrath	90.9	1.8e-92
WP_060851530.1|326029_326962_+	AAA family ATPase	NA	A0A2H4JFH2	uncultured_Caudovirales_phage	53.9	1.7e-89
WP_060851531.1|326961_327396_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	64.1	5.3e-49
WP_060851532.1|327465_329853_+	DNA primase	NA	A0A2H4JEX8	uncultured_Caudovirales_phage	94.7	0.0e+00
WP_060851533.1|330150_330585_+	hypothetical protein	NA	A0A2H4J832	uncultured_Caudovirales_phage	95.8	1.5e-75
WP_060851534.1|330587_330965_+	hypothetical protein	NA	H0USU9	Bacillus_phage	56.4	4.6e-33
WP_060851535.1|330967_331507_+	ERCC4 domain-containing protein	NA	A0A2H4J819	uncultured_Caudovirales_phage	89.4	4.7e-87
WP_060851536.1|331540_331978_+	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	83.4	2.5e-62
WP_060851537.1|332049_332268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851538.1|332462_332858_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	87.8	3.7e-57
WP_081097609.1|333003_333507_+	hypothetical protein	NA	A0A1C8E9B7	Bacillus_phage	57.0	6.4e-22
WP_060851539.1|333510_333792_+	hypothetical protein	NA	A0A1C8EAA0	Bacillus_phage	83.2	2.6e-36
WP_060851540.1|333788_334154_+	HNH endonuclease	NA	A0A2H4JA38	uncultured_Caudovirales_phage	63.6	1.2e-41
WP_060851541.1|334274_334709_+	hypothetical protein	NA	A0A1B2APW6	Phage_Wrath	94.4	3.9e-68
WP_060851542.1|334705_336430_+|terminase	terminase large subunit	terminase	A0A1B2AQ28	Phage_Wrath	94.9	0.0e+00
WP_060851543.1|336534_337740_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	95.3	1.5e-218
WP_060851544.1|337708_338287_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	82.0	1.0e-84
WP_060851545.1|338288_339650_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	86.1	1.4e-180
WP_060851546.1|339651_339912_+	hypothetical protein	NA	A0A1B2APX3	Phage_Wrath	70.9	3.6e-29
WP_060851547.1|339892_340225_+|head	phage head closure protein	head	A0A2H4J220	uncultured_Caudovirales_phage	54.5	1.8e-25
WP_060851548.1|340236_340593_+	HK97 gp10 family phage protein	NA	D2XR21	Bacillus_phage	57.8	1.2e-30
WP_060851549.1|340589_340922_+	hypothetical protein	NA	D2XR22	Bacillus_phage	87.3	1.0e-47
WP_060851550.1|340922_341513_+|tail	phage tail protein	tail	D2XR23	Bacillus_phage	78.1	6.5e-82
WP_000415929.1|341517_341880_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.0	6.8e-42
WP_060851551.1|342110_345743_+	hypothetical protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	85.1	7.3e-184
WP_060851552.1|345784_347254_+|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	80.0	9.7e-236
WP_060851553.1|347250_352797_+|tail	phage tail protein	tail	A0A0S2MVB4	Bacillus_phage	56.1	0.0e+00
WP_042597362.1|352812_353187_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	93.5	4.3e-63
WP_060851554.1|353348_354560_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	4.4e-69
WP_060851555.1|354825_355251_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	89.4	1.4e-65
WP_060851556.1|355250_356180_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	85.5	1.0e-158
WP_061186062.1|356295_356466_+	hypothetical protein	NA	A0A2H4J852	uncultured_Caudovirales_phage	92.9	2.4e-13
WP_060851557.1|356726_356963_+	DNA-binding protein	NA	A0A2H4JBQ8	uncultured_Caudovirales_phage	66.2	4.8e-20
WP_049106735.1|357130_357463_-	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	60.7	3.1e-25
WP_060851558.1|357523_358357_-	hypothetical protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	82.9	6.9e-122
WP_081097512.1|359527_360232_+	ComF family protein	NA	NA	NA	NA	NA
WP_001990088.1|360358_360556_+	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	67.7	9.8e-19
>prophage 3
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	413488	478666	5896839	holin,protease,tRNA,transposase	Staphylococcus_phage(16.67%)	60	NA	NA
WP_000673222.1|413488_413857_+|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_000078309.1|413853_414546_+	LrgB family protein	NA	NA	NA	NA	NA
WP_000557264.1|414640_414874_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000761976.1|415035_415776_+	carboxylesterase	NA	NA	NA	NA	NA
WP_000391087.1|415918_418345_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
WP_001123919.1|418594_419062_+	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_000815812.1|419944_420622_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_060851561.1|421006_422023_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000042077.1|422042_423059_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	36.8	3.0e-58
WP_060851562.1|423055_424120_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000590071.1|424116_424869_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000576727.1|425305_426844_+	anthrolysin O/cereolysin O family cholesterol-dependent cytolysin	NA	NA	NA	NA	NA
WP_002164645.1|427253_427619_+	YxeA family protein	NA	NA	NA	NA	NA
WP_001053969.1|428130_429567_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_001034141.1|429853_430819_-	DUF4822 domain-containing protein	NA	NA	NA	NA	NA
WP_002164644.1|431421_432378_+	NERD domain-containing protein	NA	NA	NA	NA	NA
WP_000834710.1|432427_432832_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000076830.1|432974_433490_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_060851563.1|433926_435474_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	29.2	8.2e-52
WP_060851564.1|435479_436673_+	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	32.4	7.0e-43
WP_060852514.1|436853_437066_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_000980930.1|437145_437385_+	DUF3947 family protein	NA	NA	NA	NA	NA
WP_000568587.1|437415_437772_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000639315.1|437768_438173_-	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000714050.1|438519_439578_+	endonuclease	NA	NA	NA	NA	NA
WP_060851565.1|439610_441113_+	DUF4077 domain-containing protein	NA	NA	NA	NA	NA
WP_085961003.1|441171_442526_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	85.5	7.3e-129
WP_000573649.1|442728_443124_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_001057102.1|443506_444424_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_001021108.1|444793_446056_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	2.0e-88
WP_000043202.1|446246_447425_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001115309.1|447469_447910_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_000760481.1|448342_448687_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002026553.1|449060_450224_+	MFS transporter	NA	NA	NA	NA	NA
WP_000793532.1|450240_451080_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	56.5	2.9e-83
WP_060851566.1|451188_452109_+	Cys-Gln thioester bond-forming surface protein	NA	NA	NA	NA	NA
WP_060851567.1|452681_455870_+	peptidase M60	NA	NA	NA	NA	NA
WP_000689907.1|455914_456553_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001022930.1|456857_458288_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_000346373.1|458620_460063_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_085961003.1|460131_461485_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	85.5	7.3e-129
WP_000673841.1|461807_462989_+	pyrimidine nucleoside transporter NupC	NA	NA	NA	NA	NA
WP_000673874.1|463341_464523_+	pyrimidine nucleoside transporter NupC	NA	NA	NA	NA	NA
WP_001076347.1|464567_465737_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_000949403.1|465887_466394_-	ferritin	NA	NA	NA	NA	NA
WP_000355744.1|466447_466771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002026558.1|466859_467423_+	TIGR00730 family Rossman fold protein	NA	A0A1V0S9E9	Catovirus	23.1	4.4e-11
WP_000390910.1|467527_467809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656312.1|467824_468022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001041894.1|468596_469037_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	65.1	3.5e-48
WP_000124196.1|469279_469480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227591.1|469494_470928_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_001026075.1|471337_471832_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_000380225.1|471836_473036_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_000900214.1|473120_473714_+	DedA family protein	NA	NA	NA	NA	NA
WP_000422806.1|473851_474286_+	DUF3920 family protein	NA	NA	NA	NA	NA
WP_000845467.1|474395_474806_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000488929.1|474857_475556_+	pirin family protein	NA	NA	NA	NA	NA
WP_000745123.1|475712_477362_+|protease	neutral protease NprB	protease	NA	NA	NA	NA
WP_145977397.1|477471_478666_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.3	4.6e-26
>prophage 4
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	518011	555883	5896839	protease,coat,transposase	Acinetobacter_phage(25.0%)	43	NA	NA
WP_145977397.1|518011_519206_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.3	4.6e-26
WP_001232993.1|519646_520360_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001180555.1|520503_520689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001002981.1|520702_520951_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_145977398.1|520947_522147_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_000666172.1|522169_523183_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000713769.1|523242_523890_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000826873.1|524033_524561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218968.1|524971_525337_+	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	48.6	5.1e-21
WP_000026897.1|525378_525762_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000640870.1|526262_526607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002008881.1|526610_526919_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001242139.1|527071_527416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000601768.1|527959_528985_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.1	1.0e-29
WP_000359401.1|528977_529643_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000735099.1|529666_530479_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000757013.1|530550_531357_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000929160.1|531595_532381_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.8	1.3e-08
WP_000152167.1|532396_533689_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_001020767.1|533688_534909_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.6	2.3e-118
WP_000009523.1|534898_535330_+	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	37.6	1.5e-14
WP_001118827.1|535378_536776_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_081097515.1|537570_538962_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000248466.1|539027_539330_+	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_000021803.1|539384_540116_+	sporulation protein YunB	NA	NA	NA	NA	NA
WP_000944663.1|540189_541173_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_000166372.1|541362_542259_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_000272746.1|542280_542760_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_000721022.1|542834_543389_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_002164635.1|543986_544802_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000178775.1|544902_545637_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000744132.1|545671_546250_-	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_000435943.1|546368_546671_+	DUF1027 domain-containing protein	NA	NA	NA	NA	NA
WP_001174567.1|546716_547214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060851573.1|547626_549096_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	G3MB42	Bacillus_virus	38.8	9.5e-66
WP_060851574.1|549245_549512_-	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_000439090.1|549529_550501_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000274006.1|550648_551089_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000503345.1|551169_551802_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000276467.1|551911_552676_+	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_000683451.1|552821_553403_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000575374.1|553958_554774_-	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_000241503.1|554770_555883_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	32.0	3.0e-40
>prophage 5
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	559560	614929	5896839	coat,capsid,integrase,plate,holin,protease,terminase,tail,portal	Bacillus_phage(72.34%)	79	561551:561568	608682:608699
WP_000614215.1|559560_560562_+|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_001125507.1|560623_560839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000431159.1|561257_561494_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
561551:561568	attL	TTTTTCTCTTCTTGTTTT	NA	NA	NA	NA
WP_000248588.1|561689_561998_+	YuzD family protein	NA	NA	NA	NA	NA
WP_000788487.1|562049_562844_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000049706.1|562967_563636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006918875.1|563708_564347_-	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_002025033.1|564333_564804_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000383680.1|564893_565148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000607083.1|565184_565568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002026505.1|565856_566654_+	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000626489.1|566723_567005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000212737.1|567164_567506_+	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
WP_145977399.1|567705_568530_-	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000470314.1|568486_569146_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.0	6.4e-22
WP_001054090.1|569200_569374_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_060851575.1|569607_570678_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060851576.1|571029_571269_+	YuzB family protein	NA	NA	NA	NA	NA
WP_000077400.1|571536_572403_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000573826.1|572444_572798_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	43.3	3.7e-16
WP_000765222.1|573287_574055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833148.1|574739_575093_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	40.2	1.3e-13
WP_000237488.1|575182_576244_-|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	83.6	4.6e-171
WP_060852516.1|577208_577439_+	hypothetical protein	NA	H0UST5	Bacillus_phage	92.1	5.9e-31
WP_081097611.1|577574_578741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021727905.1|579153_579495_-	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	33.3	1.0e-10
WP_060851577.1|579652_579859_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021727908.1|580038_580227_+	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	80.6	2.0e-21
WP_000788368.1|580243_580399_+	hypothetical protein	NA	I7J4K2	Bacillus_phage	84.0	3.8e-18
WP_060851578.1|580436_581111_+	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	67.4	1.6e-84
WP_060851579.1|581134_582016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851580.1|582148_582922_+	conserved phage C-terminal domain-containing protein	NA	A0A1W6JNI1	Staphylococcus_phage	47.8	5.7e-54
WP_060851581.1|582933_583815_+	ATP-binding protein	NA	A0A0S2SXI8	Bacillus_phage	33.6	6.8e-27
WP_060851582.1|583814_584042_+	hypothetical protein	NA	C7DTL1	Bacillus_phage	72.0	6.2e-25
WP_060851583.1|584034_584781_+	sigma-70 family RNA polymerase sigma factor	NA	Q2I8C6	Bacillus_phage	73.0	2.0e-96
WP_060851584.1|584997_585402_+	hypothetical protein	NA	A0A0E3Y4X1	Fusobacterium_phage	35.7	2.7e-10
WP_060852517.1|585608_585794_+	hypothetical protein	NA	A0A0S2MV96	Bacillus_phage	83.6	9.9e-21
WP_081097518.1|585838_585976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851585.1|586161_586425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851586.1|587096_587312_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	80.3	3.8e-24
WP_060851587.1|587459_587810_+	hypothetical protein	NA	A0A218KDG0	Bacillus_phage	51.3	5.1e-26
WP_078187667.1|587821_587944_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_078187666.1|588055_588226_+	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	75.0	8.8e-08
WP_060851588.1|588253_588736_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	8.5e-72
WP_001012146.1|588735_589278_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.7	2.9e-89
WP_060851589.1|590001_590184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851590.1|590227_590584_+	hypothetical protein	NA	I7J6Y9	Bacillus_phage	42.5	9.2e-15
WP_153598852.1|590613_590757_+	hypothetical protein	NA	A0A288WG60	Bacillus_phage	73.9	5.6e-16
WP_060851591.1|590763_590946_+	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	60.4	1.0e-09
WP_060851592.1|591187_591514_+	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	46.7	1.4e-17
WP_060852518.1|591573_591819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851594.1|592148_592649_+|terminase	P27 family phage terminase small subunit	terminase	A0A1B1P762	Bacillus_phage	36.2	1.9e-10
WP_060851595.1|592632_594303_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	57.7	4.4e-184
WP_060851596.1|594318_595548_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	36.8	6.7e-73
WP_060851597.1|595501_596248_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	44.5	6.4e-42
WP_060851598.1|596240_597377_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	54.3	5.4e-101
WP_060851599.1|597391_597715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851600.1|597704_598061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851601.1|598047_598428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851602.1|598417_598828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851603.1|598830_599412_+	hypothetical protein	NA	A0A1B1P778	Bacillus_phage	49.2	6.9e-44
WP_060851604.1|599482_599839_+	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	36.5	5.2e-10
WP_171840935.1|599883_600021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851605.1|600020_603524_+|tail	phage tail tape measure protein	tail	E2ELJ5	Clostridium_phage	49.7	1.3e-81
WP_060851606.1|603525_604203_+|tail	phage tail protein	tail	A0A1C8EA72	Bacillus_phage	77.9	6.3e-97
WP_060851607.1|604199_606542_+|tail	phage tail protein	tail	A0A1C8E983	Bacillus_phage	86.0	0.0e+00
WP_060851608.1|606556_607837_+|plate	BppU family phage baseplate upper protein	plate	A0A1C8E978	Bacillus_phage	75.6	4.0e-185
WP_030026929.1|607989_608214_+	hemolysin XhlA family protein	NA	A0A1B1P780	Bacillus_phage	95.9	7.0e-29
WP_000373914.1|608289_608715_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	96.5	9.1e-70
608682:608699	attR	AAAACAAGAAGAGAAAAA	NA	NA	NA	NA
WP_060851609.1|608714_609650_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	96.1	8.7e-182
WP_060851610.1|610191_610530_-	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	78.6	4.7e-37
WP_060851611.1|610583_611162_-	type IV secretory system conjugative DNA transfer family protein	NA	H0USX9	Bacillus_phage	89.6	1.4e-97
WP_001137905.1|611167_611347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000649833.1|611355_611553_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_060851612.1|611736_612054_+	hypothetical protein	NA	H0USY0	Bacillus_phage	97.1	2.4e-51
WP_000170777.1|612050_612233_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	1.4e-22
WP_000891536.1|612348_613530_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.7	6.9e-216
WP_000551103.1|613471_614092_+	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	93.2	6.5e-109
WP_060851613.1|614101_614929_-	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	69.9	6.1e-102
>prophage 6
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	983869	991555	5896839		uncultured_Caudovirales_phage(16.67%)	10	NA	NA
WP_001036848.1|983869_984853_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.1e-17
WP_000403758.1|984842_985613_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.1	3.7e-13
WP_001086126.1|985645_986410_+	class B sortase	NA	NA	NA	NA	NA
WP_000587818.1|986482_986806_-	heme oxygenase	NA	NA	NA	NA	NA
WP_001235508.1|987101_988301_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	3.6e-71
WP_001014310.1|988339_988534_-	YwbE family protein	NA	NA	NA	NA	NA
WP_001293578.1|988534_988708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060851665.1|988876_989569_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	7.0e-35
WP_000247684.1|989570_990506_+	HAMP domain-containing histidine kinase	NA	Q8QNA2	Ectocarpus_siliculosus_virus	26.6	3.0e-12
WP_000221069.1|990631_991555_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.4	1.4e-46
>prophage 7
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	1039287	1130879	5896839	coat,head,capsid,plate,protease,terminase,tRNA,tail,portal	Bacillus_phage(37.74%)	106	NA	NA
WP_000472289.1|1039287_1040547_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	1.0e-148
WP_000119176.1|1040653_1042324_+|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.0	7.4e-14
WP_060851672.1|1042506_1044837_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.5	4.3e-177
WP_000869116.1|1044833_1045430_+	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000359767.1|1045463_1045880_-	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000133916.1|1045882_1046335_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000547863.1|1046751_1048086_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000008991.1|1048103_1048937_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_001226395.1|1048952_1049882_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000992345.1|1049884_1050637_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001087065.1|1050657_1051647_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000712943.1|1051646_1052936_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_002024850.1|1053015_1054026_+	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000350658.1|1054092_1055118_+|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_000072252.1|1055637_1058283_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	42.8	1.6e-164
WP_000582071.1|1058376_1059678_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_060851673.1|1059843_1060794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001226292.1|1061026_1061602_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_001013397.1|1061648_1062047_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_060851674.1|1062050_1063445_-	recombinase family protein	NA	A0A2H4JFH9	uncultured_Caudovirales_phage	81.7	3.9e-218
WP_060851675.1|1063528_1064215_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JDE4	uncultured_Caudovirales_phage	95.2	5.7e-122
WP_060851676.1|1064385_1064637_+	Cro/Cl family transcriptional regulator	NA	A0A2H4JEY2	uncultured_Caudovirales_phage	85.7	2.4e-33
WP_171840937.1|1064614_1064755_+	hypothetical protein	NA	A0A2H4J841	uncultured_Caudovirales_phage	81.0	7.0e-11
WP_171840938.1|1064751_1064904_+	hypothetical protein	NA	A0A2H4JAZ7	uncultured_Caudovirales_phage	66.0	4.9e-10
WP_060851677.1|1064919_1065147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851678.1|1065147_1065498_+	hypothetical protein	NA	A0A1B2AQ59	Phage_Wrath	79.3	4.7e-48
WP_060851679.1|1065592_1065850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851680.1|1065846_1066197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851681.1|1066196_1066481_+	hypothetical protein	NA	A0A2H4J9A3	uncultured_Caudovirales_phage	77.7	3.2e-34
WP_060851682.1|1066458_1067007_+	host-nuclease inhibitor Gam family protein	NA	A0A2H4JFP8	uncultured_Caudovirales_phage	78.0	1.1e-75
WP_060851683.1|1067009_1067261_+	hypothetical protein	NA	A0A2H4JG95	uncultured_Caudovirales_phage	95.2	7.6e-40
WP_060851684.1|1067266_1067863_+	hypothetical protein	NA	A0A1B2AQ10	Phage_Wrath	90.9	1.7e-93
WP_000694784.1|1067878_1068571_+	AAA family ATPase	NA	A0A2H4J9A0	uncultured_Caudovirales_phage	95.9	1.6e-119
WP_000008625.1|1068570_1069044_+	DUF669 domain-containing protein	NA	A0A2H4J986	uncultured_Caudovirales_phage	96.8	8.0e-83
WP_060851685.1|1069115_1071458_+	DNA primase	NA	A0A1B2AQ05	Phage_Wrath	98.2	0.0e+00
WP_060851686.1|1071778_1072207_+	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	88.0	7.5e-72
WP_060851687.1|1072210_1072396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851688.1|1072392_1072932_+	ERCC4 domain-containing protein	NA	A0A0S2SXQ1	Bacillus_phage	50.8	2.2e-44
WP_060851689.1|1072933_1073206_+	hypothetical protein	NA	A0A0H3V0M3	Geobacillus_virus	53.5	7.5e-17
WP_060851690.1|1073256_1073694_+	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	82.8	3.6e-61
WP_060851691.1|1073764_1073998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851692.1|1074182_1074485_+	hypothetical protein	NA	Q3HKX6	Bacillus_phage	76.0	4.7e-36
WP_140159945.1|1074643_1074832_+	hypothetical protein	NA	S5MC27	Brevibacillus_phage	62.3	1.1e-11
WP_038413844.1|1074873_1075260_+	phage protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	74.4	4.4e-47
WP_038413842.1|1075459_1075849_+	DUF3942 family protein	NA	NA	NA	NA	NA
WP_060851693.1|1076160_1076364_+	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	72.3	1.9e-17
WP_000074276.1|1076404_1076623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000627439.1|1076619_1076934_+	Rho termination factor N-terminal domain-containing protein	NA	A0A1B0T6C6	Bacillus_phage	89.4	5.2e-46
WP_038413837.1|1076930_1077323_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	96.9	9.6e-74
WP_038413835.1|1077407_1077845_+|terminase	P27 family phage terminase small subunit	terminase	A0A1B1P7N7	Bacillus_phage	90.3	2.0e-67
WP_038413833.1|1077841_1079569_+|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	97.7	0.0e+00
WP_038413832.1|1079584_1080790_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	91.0	1.3e-209
WP_038413830.1|1080758_1081337_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	81.5	1.4e-84
WP_038413828.1|1081338_1082706_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	79.3	7.8e-155
WP_038413826.1|1082707_1082968_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	94.2	1.7e-39
WP_038413824.1|1082942_1083278_+	phage protein	NA	A0A1B0T691	Bacillus_phage	97.2	7.2e-54
WP_038413822.1|1083267_1083597_+	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	96.3	4.4e-56
WP_038413820.1|1083596_1083974_+	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	99.2	5.1e-64
WP_038413819.1|1083985_1084621_+|tail	phi13 family phage major tail protein	tail	A0A1C8E980	Bacillus_phage	96.2	3.8e-112
WP_000113342.1|1084632_1085019_+	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	100.0	7.3e-66
WP_006927278.1|1085057_1085246_+	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	98.4	8.2e-31
WP_038413814.1|1088783_1089467_+|tail	phage tail family protein	tail	A0A1B1P7Q0	Bacillus_phage	97.8	9.1e-128
WP_038413812.1|1089463_1091806_+|tail	phage tail protein	tail	A0A1B1P7P0	Bacillus_phage	97.8	0.0e+00
WP_060851694.1|1091820_1093101_+|plate	BppU family phage baseplate upper protein	plate	A0A1C8E978	Bacillus_phage	77.7	1.4e-190
WP_038413980.1|1093150_1093360_+	hemolysin XhlA family protein	NA	A0A1B2APY8	Phage_Wrath	84.8	7.0e-23
WP_038413810.1|1093361_1093565_+	hypothetical protein	NA	A0A1B1P886	Bacillus_phage	95.3	8.8e-31
WP_038413809.1|1093561_1094614_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1C8E990	Bacillus_phage	93.1	6.4e-189
WP_038413808.1|1094792_1095125_-	hypothetical protein	NA	A0A2H4J846	uncultured_Caudovirales_phage	70.0	1.5e-32
WP_038413806.1|1095203_1095452_-	hypothetical protein	NA	A0A1B1P7Q5	Bacillus_phage	95.1	2.7e-37
WP_060851695.1|1095765_1096599_-	hypothetical protein	NA	A0A2H4J9W9	uncultured_Caudovirales_phage	90.3	4.1e-122
WP_060851696.1|1096705_1097110_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000466736.1|1097267_1098287_+	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_001135488.1|1098328_1099180_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000975766.1|1099194_1099740_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000391521.1|1099775_1100462_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000503309.1|1100464_1101262_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000797471.1|1101396_1102143_+	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000599064.1|1102135_1102996_+	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000855481.1|1103063_1104452_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000270907.1|1104621_1104930_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_001973720.1|1104941_1105286_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000944957.1|1105289_1105580_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_001003587.1|1105643_1106192_+	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_000497128.1|1106191_1107478_+	GTPase ObgE	NA	NA	NA	NA	NA
WP_000276723.1|1107617_1108325_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000865181.1|1108314_1109397_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_000114529.1|1109490_1110267_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	1.3e-29
WP_060851697.1|1110241_1112164_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001028685.1|1112213_1114127_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000621705.1|1114223_1115075_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_000510666.1|1115235_1115883_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000812275.1|1115962_1116505_-	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000973777.1|1116504_1117647_-	IscS subfamily cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	29.2	5.0e-30
WP_001138531.1|1117799_1119329_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001092226.1|1119348_1120182_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_000025342.1|1120211_1121318_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_060851698.1|1121543_1123436_+|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_001093536.1|1123614_1124259_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_000721223.1|1124292_1124727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871193.1|1125156_1125687_+	BofC C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000823611.1|1125700_1126645_-	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464511.1|1126833_1127451_+	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_000344449.1|1127456_1128458_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	6.8e-07
WP_000138162.1|1128454_1128655_+	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000354014.1|1128674_1129727_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000125365.1|1129739_1130879_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.3	1.1e-82
>prophage 8
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	1275480	1389317	5896839	transposase,head,capsid,plate,integrase,holin,protease,terminase,tail,portal	Bacillus_phage(82.29%)	152	1283925:1283942	1384417:1384434
WP_001053969.1|1275480_1276917_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_081097528.1|1277228_1278452_+	phosphoglucomutase	NA	NA	NA	NA	NA
WP_001265616.1|1278521_1278671_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000642750.1|1278775_1279354_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_000253699.1|1279457_1279658_+	YqgQ family protein	NA	NA	NA	NA	NA
WP_000391704.1|1279677_1280661_+	glucokinase	NA	NA	NA	NA	NA
WP_000524852.1|1280741_1280915_-	DUF2759 domain-containing protein	NA	NA	NA	NA	NA
WP_000871231.1|1281087_1281717_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	38.7	4.1e-34
WP_000525154.1|1281726_1282839_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000894377.1|1282981_1283272_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000379156.1|1283705_1284218_-	cysteine hydrolase	NA	NA	NA	NA	NA
1283925:1283942	attL	ATCTAAAATTTCTTTTAA	NA	NA	NA	NA
WP_060851709.1|1284385_1285549_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_000103897.1|1285545_1286658_-	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	28.2	5.8e-15
WP_000770352.1|1287246_1289079_+	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000649675.1|1289078_1292477_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	51.7	4.8e-12
WP_000724776.1|1292495_1293554_+	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_001250699.1|1293748_1294009_+	DUF3966 domain-containing protein	NA	NA	NA	NA	NA
WP_001012342.1|1294104_1294479_+	nucleoside 2-deoxyribosyltransferase	NA	NA	NA	NA	NA
WP_000764267.1|1294558_1295047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093239.1|1295081_1295393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008327.1|1295645_1295861_+	DUF3912 family protein	NA	NA	NA	NA	NA
WP_000875395.1|1295948_1296341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145977397.1|1296442_1297638_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.3	4.6e-26
WP_001094345.1|1297739_1299134_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_000440716.1|1299241_1299484_-	DUF2626 domain-containing protein	NA	NA	NA	NA	NA
WP_000434125.1|1299609_1300305_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081097529.1|1300510_1300963_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_060851710.1|1300975_1302397_-	recombinase family protein	NA	A0A1L2JY12	Aeribacillus_phage	44.4	3.1e-106
WP_042595834.1|1302410_1302713_-	DUF1827 family protein	NA	NA	NA	NA	NA
WP_160292204.1|1302754_1303159_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0K2CZC9	Paenibacillus_phage	46.2	9.1e-27
WP_042595830.1|1303222_1303618_-	helix-turn-helix transcriptional regulator	NA	Q38327	Lactococcus_phage	46.2	6.4e-09
WP_171840939.1|1303800_1304034_+	helix-turn-helix transcriptional regulator	NA	U3PDM7	Lactobacillus_phage	43.5	1.7e-06
WP_153598418.1|1304997_1305165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171840940.1|1305611_1305770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042595826.1|1306042_1306237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851711.1|1306416_1306629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171840941.1|1306630_1306807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042595820.1|1306987_1307470_+	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	45.0	1.2e-28
WP_052497230.1|1307466_1308192_+	ERF family protein	NA	W8CYS2	Bacillus_phage	66.1	1.8e-41
WP_171840942.1|1308193_1308361_+	hypothetical protein	NA	A0A0M4R389	Bacillus_phage	62.7	2.9e-11
WP_042595819.1|1308357_1309203_+	phage replisome organizer N-terminal domain-containing protein	NA	A8ASN4	Listeria_phage	50.3	8.0e-41
WP_042595817.1|1309195_1309534_+	hypothetical protein	NA	W8EIZ4	Geobacillus_phage	37.9	2.7e-08
WP_060851712.1|1309530_1310874_+	replicative DNA helicase	NA	D2XR44	Bacillus_phage	47.1	4.1e-108
WP_060851713.1|1310870_1311089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851714.1|1311175_1311796_+	hypothetical protein	NA	Q5YA91	Bacillus_phage	33.3	4.3e-28
WP_081097530.1|1311826_1312369_+	hypothetical protein	NA	A0A0S2MVC3	Bacillus_phage	83.3	2.0e-82
WP_060851716.1|1312407_1312755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851717.1|1312852_1313512_+	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	75.4	8.2e-102
WP_060851718.1|1313674_1313965_+	hypothetical protein	NA	A0A290GDV5	Caldibacillus_phage	77.9	5.3e-37
WP_060851719.1|1313971_1314400_+	ArpU family transcriptional regulator	NA	NA	NA	NA	NA
WP_060851720.1|1314778_1315252_+|terminase	terminase small subunit	terminase	A0A0M4RU19	Bacillus_phage	51.0	6.2e-35
WP_060851721.1|1315238_1316543_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0M4R5F3	Bacillus_phage	85.0	3.0e-228
WP_060851722.1|1316554_1316758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851723.1|1316757_1318104_+|portal	phage portal protein	portal	A0A0M4S669	Bacillus_phage	80.1	1.7e-207
WP_060851724.1|1318090_1319116_+|capsid	minor capsid protein	capsid	A0A0M5M7Z2	Bacillus_phage	84.4	1.3e-154
WP_060851725.1|1319188_1319848_+	DUF4355 domain-containing protein	NA	A0A0M3ULE7	Bacillus_phage	46.5	4.6e-20
WP_060851726.1|1319861_1320713_+	hypothetical protein	NA	A0A0M5M1L4	Bacillus_phage	74.6	7.8e-113
WP_060851727.1|1320752_1321091_+|head,tail	phage head-tail connector protein	head,tail	W8CYS9	Bacillus_phage	40.5	2.2e-10
WP_060851728.1|1321072_1321432_+	hypothetical protein	NA	A0A0M4S6Z9	Bacillus_phage	73.5	2.3e-42
WP_060851729.1|1321415_1321832_+	hypothetical protein	NA	A0A0M4S6Z2	Bacillus_phage	86.2	1.5e-64
WP_060851730.1|1321828_1322209_+	hypothetical protein	NA	A0A0M4RD75	Bacillus_phage	81.0	4.3e-55
WP_060851731.1|1322227_1322860_+	hypothetical protein	NA	A0A0M4R5F9	Bacillus_phage	75.7	7.0e-74
WP_060851732.1|1322904_1323342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016098868.1|1323377_1323644_+	hypothetical protein	NA	A0A0M4S6X7	Bacillus_phage	55.7	1.6e-19
WP_060851733.1|1323649_1326247_+|tail	phage tail tape measure protein	tail	A0A0M3ULL5	Bacillus_phage	48.4	1.0e-107
WP_081097531.1|1326256_1327726_+|tail	phage tail family protein	tail	A0A0A7AQV1	Bacillus_phage	64.6	1.3e-192
WP_042595780.1|1327722_1329882_+|tail	phage tail protein	tail	H0USX5	Bacillus_phage	71.1	5.7e-168
WP_042595778.1|1329897_1330260_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	62.6	4.2e-31
WP_042595776.1|1330256_1331411_+|plate	BppU family phage baseplate upper protein	plate	A0A1C8E978	Bacillus_phage	48.8	4.1e-96
WP_042595773.1|1331451_1331871_+|holin	phage holin family protein	holin	H0USX7	Bacillus_phage	82.2	9.3e-59
WP_042598441.1|1331870_1332827_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	77.6	3.0e-113
WP_042595771.1|1333025_1334063_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_042595770.1|1334545_1334746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042595767.1|1335460_1336297_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_042598439.1|1336822_1337014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042595765.1|1338067_1339159_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	87.1	4.9e-168
WP_000475176.1|1339874_1340906_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_001178687.1|1340917_1341217_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_000813141.1|1341213_1341669_+	type II secretion system protein	NA	NA	NA	NA	NA
WP_000829469.1|1341661_1341964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021727637.1|1341933_1342122_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_060851734.1|1342263_1343433_-|integrase	site-specific integrase	integrase	A0A0M5M609	Bacillus_phage	38.0	1.2e-63
WP_060852521.1|1343635_1343980_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	45.5	3.1e-20
WP_060851735.1|1344476_1345607_+	hypothetical protein	NA	A0A1B0T6A5	Bacillus_phage	38.7	3.5e-68
WP_171840943.1|1345647_1345800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851736.1|1346119_1346461_-	helix-turn-helix transcriptional regulator	NA	A0A1B0T6A7	Bacillus_phage	41.2	2.7e-16
WP_060851737.1|1346635_1346857_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060851738.1|1346880_1347612_+	ORF6C domain-containing protein	NA	A0A1B1P7T7	Bacillus_phage	90.1	1.9e-123
WP_060851739.1|1347650_1347911_+	group-specific protein	NA	A0A1B1P7U4	Bacillus_phage	94.2	2.2e-42
WP_081097534.1|1347923_1348088_+	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	79.6	9.0e-18
WP_000364160.1|1348117_1348294_+	hypothetical protein	NA	A0A1B1P7U0	Bacillus_phage	87.9	2.6e-23
WP_049107944.1|1348299_1349145_+	phage replisome organizer N-terminal domain-containing protein	NA	V5UQV4	Oenococcus_phage	59.3	1.8e-37
WP_060851740.1|1349113_1349911_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	98.5	2.1e-144
WP_060851741.1|1349931_1350126_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	78.1	3.6e-21
WP_060851742.1|1350142_1350421_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	57.6	9.7e-12
WP_060851743.1|1350413_1350773_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	55.0	1.7e-32
WP_000717829.1|1350791_1350959_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	64.2	9.5e-15
WP_000109543.1|1350984_1351236_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	2.2e-07
WP_001054607.1|1351255_1351765_+	dUTP diphosphatase	NA	A0A1L2JY27	Aeribacillus_phage	44.9	1.4e-27
WP_002134037.1|1351809_1351995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387671.1|1352046_1352445_+	hypothetical protein	NA	A0A068ELY9	Bacillus_phage	79.1	2.8e-57
WP_000805074.1|1352469_1352892_+	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	82.9	2.3e-65
WP_000433730.1|1352926_1353064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000397931.1|1353067_1353334_+	hypothetical protein	NA	D2XR50	Bacillus_phage	42.7	2.2e-13
WP_000404182.1|1353371_1353770_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	75.0	1.2e-52
WP_000872736.1|1353807_1353957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365653.1|1354056_1354275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851744.1|1354314_1354719_+	hypothetical protein	NA	L0L8J8	Bacillus_phage	48.5	6.5e-09
WP_060852522.1|1354976_1355429_+	hypothetical protein	NA	A0A0A7AQW7	Bacillus_phage	72.0	9.1e-60
WP_060851745.1|1355469_1355652_+	hypothetical protein	NA	A0A218KC21	Bacillus_phage	72.4	2.9e-17
WP_060851746.1|1355684_1356005_+	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	49.5	8.2e-15
WP_060851747.1|1356001_1356199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851748.1|1356227_1356464_+	hypothetical protein	NA	A0A0A7AQI9	Bacillus_phage	98.7	1.1e-21
WP_024086075.1|1356580_1356751_+	hypothetical protein	NA	A0A0A7AQ99	Bacillus_phage	100.0	5.5e-26
WP_060851749.1|1356793_1357075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000645536.1|1357189_1357360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046945209.1|1357383_1357857_+	ArpU family transcriptional regulator	NA	A0A1B1P7X5	Bacillus_phage	98.1	4.9e-80
WP_046945210.1|1357853_1358396_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7Y2	Bacillus_phage	98.9	8.0e-95
WP_171840944.1|1358596_1358734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852523.1|1359140_1359443_+	hypothetical protein	NA	A0A0S2MVB8	Bacillus_phage	52.0	4.4e-18
WP_060851750.1|1359429_1359642_+	hypothetical protein	NA	H0USV9	Bacillus_phage	95.7	2.3e-29
WP_060852524.1|1359966_1360164_+	hypothetical protein	NA	A0A1B1P8J7	Bacillus_phage	78.6	8.3e-18
WP_060851751.1|1360156_1360519_+	HNH endonuclease	NA	A0A1B1P8D2	Bacillus_phage	94.2	6.0e-62
WP_060851752.1|1360680_1361061_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B1P7R2	Bacillus_phage	96.8	1.3e-64
WP_060851753.1|1361041_1362814_+|terminase	terminase large subunit	terminase	A0A1B1P7R3	Bacillus_phage	95.1	0.0e+00
WP_060851754.1|1362829_1364044_+|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	88.6	3.3e-213
WP_059303836.1|1364021_1364777_+|protease	Clp protease ClpP	protease	A0A0U3U021	Bacillus_phage	98.4	1.2e-136
WP_060851755.1|1364773_1365952_+|capsid	phage major capsid protein	capsid	A0A1B1P7R4	Bacillus_phage	94.9	1.9e-205
WP_002180393.1|1365926_1366229_+	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_000891191.1|1366237_1366513_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B1P7Q8	Bacillus_phage	98.9	8.0e-43
WP_001069938.1|1366499_1366847_+|head	phage head closure protein	head	A0A1B1P7T4	Bacillus_phage	96.5	1.6e-59
WP_000852721.1|1366834_1367272_+	HK97 gp10 family phage protein	NA	A0A1B1P7R6	Bacillus_phage	96.6	7.4e-75
WP_001211430.1|1367268_1367628_+	hypothetical protein	NA	A0A1B1P7S7	Bacillus_phage	92.4	8.0e-59
WP_000952022.1|1367641_1368226_+|tail	tail protein	tail	A0A1B1P7S4	Bacillus_phage	98.5	1.7e-106
WP_060851756.1|1368285_1368681_+	hypothetical protein	NA	A0A1B1P7S9	Bacillus_phage	88.5	2.6e-55
WP_000938713.1|1368698_1368839_+	hypothetical protein	NA	A0A1B1P7R9	Bacillus_phage	95.7	1.3e-17
WP_060851757.1|1368854_1373870_+|tail	phage tail tape measure protein	tail	A0A1B1P7S6	Bacillus_phage	88.3	0.0e+00
WP_060851758.1|1373911_1375387_+|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	81.5	2.6e-241
WP_060851759.1|1375383_1380294_+|tail	phage tail protein	tail	W8CYT7	Bacillus_phage	53.0	0.0e+00
WP_060851760.1|1380395_1381355_+|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	95.9	1.6e-175
WP_060851761.1|1381370_1381796_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	95.0	5.3e-70
WP_060851762.1|1381795_1382731_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	97.4	2.1e-183
WP_085961003.1|1382833_1384187_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	85.5	7.3e-129
WP_060851763.1|1384242_1384446_-	helix-turn-helix domain-containing protein	NA	A0A1B1P7S8	Bacillus_phage	54.4	5.0e-10
1384417:1384434	attR	ATCTAAAATTTCTTTTAA	NA	NA	NA	NA
WP_060851764.1|1384585_1384894_+	hypothetical protein	NA	A0A288WG38	Bacillus_phage	86.3	8.7e-46
WP_060851765.1|1384890_1385073_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	88.3	3.9e-22
WP_060851766.1|1385188_1386370_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	82.7	5.5e-189
WP_060851767.1|1386311_1386935_+	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	83.4	4.0e-98
WP_060851768.1|1386969_1387563_-	hypothetical protein	NA	A0A0U3TZ58	Bacillus_phage	90.2	1.4e-87
WP_060851769.1|1387812_1388124_+	ComGF family competence protein	NA	NA	NA	NA	NA
WP_001231317.1|1388120_1388492_+	competence protein ComG	NA	NA	NA	NA	NA
WP_000183856.1|1388666_1389317_+	2OG-Fe(II) oxygenase	NA	A0A1V0SIE1	Klosneuvirus	30.1	2.8e-17
>prophage 9
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	1900343	1994847	5896839	transposase,head,capsid,integrase,holin,protease,terminase,tRNA,tail,portal,bacteriocin	Bacillus_phage(62.69%)	112	1890798:1890816	1971173:1971191
1890798:1890816	attL	TTAATGTAAATGAAATGAA	NA	NA	NA	NA
WP_060851554.1|1900343_1901555_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	4.4e-69
WP_001179093.1|1901823_1902987_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000957279.1|1903146_1903899_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000640859.1|1903895_1904807_+	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000704605.1|1904820_1906677_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000734640.1|1907026_1907977_+	SH3 domain-containing protein	NA	A0A0S2SXZ8	Bacillus_phage	70.3	1.4e-33
WP_000814429.1|1908039_1908285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000504929.1|1908465_1909419_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_000813896.1|1909440_1909665_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_085961003.1|1909757_1911111_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	85.5	7.3e-129
WP_060851808.1|1911195_1913163_-	Gly-Xaa-Xaa repeat protein	NA	NA	NA	NA	NA
WP_000450326.1|1913276_1914242_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000438178.1|1914355_1915312_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	42.3	3.5e-53
WP_000181500.1|1915343_1915481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312267.1|1915580_1916204_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000391393.1|1916296_1917571_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000460302.1|1917563_1918835_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_000656783.1|1919008_1919398_+	transcriptional repressor GlnR	NA	NA	NA	NA	NA
WP_000092763.1|1919446_1920781_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_060851809.1|1920881_1921988_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	57.5	6.9e-101
WP_081097545.1|1922330_1923479_+	hypothetical protein	NA	H0UST6	Bacillus_phage	40.4	9.7e-82
WP_153602161.1|1923482_1923638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851810.1|1923841_1924183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851811.1|1924215_1924878_+	hypothetical protein	NA	A0A0A7AR45	Bacillus_phage	43.5	7.1e-45
WP_171840945.1|1925029_1925179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851812.1|1925184_1925535_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P8C2	Bacillus_phage	66.1	7.1e-36
WP_060851813.1|1925743_1925944_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P7V5	Bacillus_phage	90.9	1.3e-26
WP_060851814.1|1926006_1926795_+	phage antirepressor KilAC domain-containing protein	NA	A0A0B5A507	Paenibacillus_phage	53.4	1.4e-68
WP_060851815.1|1926809_1927085_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	85.4	3.6e-35
WP_081097546.1|1927121_1927268_+	hypothetical protein	NA	A0A1B1P8G4	Bacillus_phage	83.3	4.9e-15
WP_081097547.1|1927313_1927490_+	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	89.7	3.8e-22
WP_060851816.1|1927496_1928384_+	DnaD domain protein	NA	W8CYG5	Bacillus_phage	42.9	5.8e-42
WP_060851817.1|1928322_1929198_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	46.5	5.3e-64
WP_016123365.1|1929214_1929418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016123364.1|1929414_1929639_-	hypothetical protein	NA	Q9T1I9	Lactobacillus_phage	61.4	8.9e-16
WP_000337986.1|1929719_1929914_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	76.6	1.0e-20
WP_000805170.1|1929939_1930113_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	91.2	2.6e-23
WP_000811696.1|1930127_1930382_+	hypothetical protein	NA	A0A1B0T6B9	Bacillus_phage	88.1	1.4e-36
WP_060851818.1|1930390_1930855_+	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	35.5	9.8e-17
WP_060851819.1|1930881_1931073_+	hypothetical protein	NA	A0A1B0T6B5	Bacillus_phage	90.5	6.8e-25
WP_060851820.1|1931134_1931326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000387671.1|1931366_1931765_+	hypothetical protein	NA	A0A068ELY9	Bacillus_phage	79.1	2.8e-57
WP_000805074.1|1931789_1932212_+	hypothetical protein	NA	A0A1B1P7B4	Bacillus_phage	82.9	2.3e-65
WP_042597315.1|1932241_1932676_+	hypothetical protein	NA	A0A1B1P7W5	Bacillus_phage	63.3	4.7e-45
WP_000404182.1|1932705_1933104_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	75.0	1.2e-52
WP_000872736.1|1933141_1933291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365653.1|1933390_1933609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851821.1|1933645_1933891_+	hypothetical protein	NA	A0A0S2MVC7	Bacillus_phage	97.5	1.3e-33
WP_060851822.1|1933938_1934262_+	hypothetical protein	NA	D2XR52	Bacillus_phage	96.9	3.3e-48
WP_081097548.1|1934320_1934569_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MV80	Bacillus_phage	96.3	1.2e-37
WP_021728831.1|1934586_1934769_+	hypothetical protein	NA	A0A0S2MV77	Bacillus_phage	100.0	3.7e-28
WP_000525861.1|1934807_1935089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866156.1|1935204_1935375_+	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	80.4	5.0e-11
WP_000166182.1|1935402_1935885_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.9e-71
WP_001012113.1|1935884_1936427_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	92.2	1.3e-89
WP_000124642.1|1937102_1937363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000336221.1|1937504_1937909_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	75.0	2.7e-47
WP_000666403.1|1937905_1938241_+	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.9	1.0e-52
WP_000124848.1|1938391_1938727_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	2.3e-07
WP_000615714.1|1938723_1940382_+|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.3	1.0e-257
WP_044157418.1|1940447_1941554_+|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	89.9	2.4e-186
WP_000216402.1|1941537_1942314_+|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	57.7	2.5e-57
WP_000234863.1|1942334_1943498_+|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	96.9	1.7e-211
WP_001243199.1|1943510_1943807_+	hypothetical protein	NA	A0A2H4JF26	uncultured_Caudovirales_phage	87.8	1.6e-41
WP_001182260.1|1943808_1944183_+|head	phage head closure protein	head	A0A2H4JHA9	uncultured_Caudovirales_phage	90.3	1.1e-58
WP_000818829.1|1944170_1944608_+	HK97 gp10 family phage protein	NA	A0A2H4JBV5	uncultured_Caudovirales_phage	93.1	7.4e-75
WP_000793436.1|1944604_1944967_+	DUF3168 domain-containing protein	NA	A0A2H4JBW1	uncultured_Caudovirales_phage	85.0	1.4e-55
WP_001251821.1|1944982_1945567_+|tail	tail protein	tail	A0A2H4JET9	uncultured_Caudovirales_phage	93.3	2.9e-98
WP_015382157.1|1945623_1945998_+	hypothetical protein	NA	A0A2H4JBU8	uncultured_Caudovirales_phage	86.8	1.8e-53
WP_001173498.1|1946162_1951160_+|tail	phage tail tape measure protein	tail	A0A2H4JI37	uncultured_Caudovirales_phage	80.5	0.0e+00
WP_000093847.1|1951199_1952669_+|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	78.3	1.1e-231
WP_015382146.1|1952665_1958230_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	64.1	0.0e+00
WP_015382147.1|1958246_1958612_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	59.0	3.7e-35
WP_000390477.1|1958738_1958963_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	1.1e-26
WP_000373855.1|1959038_1959464_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	97.2	4.8e-71
WP_000403436.1|1959463_1960402_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	94.7	3.3e-136
WP_042883360.1|1961267_1961927_-	helix-turn-helix domain-containing protein	NA	A0A2H4J441	uncultured_Caudovirales_phage	41.0	2.5e-34
WP_000283431.1|1962129_1962342_+	hypothetical protein	NA	A6M975	Geobacillus_virus	63.0	1.6e-11
WP_000531225.1|1962544_1963303_+	ORF6C domain-containing protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	69.0	9.2e-97
WP_001189065.1|1963314_1963509_+	hypothetical protein	NA	A0A1C8E9A1	Bacillus_phage	71.0	1.7e-15
WP_000511420.1|1963661_1964534_+	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	65.3	6.8e-96
WP_000883316.1|1964540_1964678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000464425.1|1964652_1965039_+	DUF1492 domain-containing protein	NA	A0A288WG73	Bacillus_phage	71.4	2.6e-47
WP_033692154.1|1965277_1966264_+	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	43.9	1.7e-34
WP_000116992.1|1967218_1968649_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000364215.1|1968797_1969208_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000405767.1|1969808_1970705_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	52.4	4.1e-80
WP_000392442.1|1970766_1970997_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	77.6	3.1e-24
WP_001102628.1|1971368_1971692_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
1971173:1971191	attR	TTAATGTAAATGAAATGAA	NA	NA	NA	NA
WP_000031382.1|1971684_1972227_+	DUF1700 domain-containing protein	NA	NA	NA	NA	NA
WP_002164461.1|1972227_1973031_+	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_000413738.1|1973121_1973742_-	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.2	8.2e-19
WP_000991469.1|1973883_1974540_+	recombinase family protein	NA	NA	NA	NA	NA
WP_000607015.1|1974585_1974825_+	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_001053969.1|1976082_1977519_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000915065.1|1978299_1979238_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000569241.1|1979321_1980095_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.9	2.6e-22
WP_001000763.1|1980091_1980886_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_000047896.1|1980885_1981689_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_000019766.1|1981985_1983986_+	transketolase	NA	NA	NA	NA	NA
WP_000860632.1|1984142_1984583_+	sporulation inhibitor of replication protein SirA	NA	NA	NA	NA	NA
WP_001123317.1|1984661_1984883_+	YneF family protein	NA	NA	NA	NA	NA
WP_000862455.1|1985005_1986757_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.4	7.4e-49
WP_060851824.1|1986756_1988520_+	ABC transporter ATP-binding protein	NA	A0A076FI99	Aureococcus_anophage	26.2	1.2e-25
WP_001181399.1|1988650_1989697_+	SH3 domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	40.4	3.4e-33
WP_001110279.1|1989837_1990857_+	NERD domain-containing protein	NA	A0A1L2JY40	Aeribacillus_phage	28.7	1.8e-26
WP_000644411.1|1991670_1991817_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_000974659.1|1991915_1992671_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000625222.1|1993032_1993239_-	DUF3903 domain-containing protein	NA	NA	NA	NA	NA
WP_000442981.1|1993381_1993795_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000578954.1|1993807_1994485_-	LrgB family protein	NA	NA	NA	NA	NA
WP_000872365.1|1994481_1994847_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
>prophage 10
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	2067059	2135169	5896839	transposase,head,capsid,integrase,holin,protease,terminase,tail,portal	Bacillus_phage(94.0%)	73	2093600:2093617	2135507:2135524
WP_145977397.1|2067059_2068254_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.3	4.6e-26
WP_000864729.1|2068477_2069011_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000368253.1|2069023_2070022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000526730.1|2070039_2071077_+	LCP family protein	NA	NA	NA	NA	NA
WP_060851831.1|2071281_2072544_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_000730151.1|2072890_2074588_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000823467.1|2074886_2076602_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000823438.1|2077043_2078738_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000828249.1|2078820_2079540_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000554997.1|2079580_2079976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000842902.1|2080110_2080458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000511515.1|2080517_2080856_+	VOC family protein	NA	NA	NA	NA	NA
WP_048538095.1|2081112_2083212_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000175104.1|2083291_2086654_+	tubulin-like doman-containing protein	NA	NA	NA	NA	NA
WP_001116195.1|2086711_2086852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051657.1|2087350_2088733_+	amino acid permease	NA	NA	NA	NA	NA
WP_001252213.1|2088807_2089944_-	spore germination protein GerSC	NA	NA	NA	NA	NA
WP_000166517.1|2089944_2091042_-	endospore germination permease	NA	NA	NA	NA	NA
WP_000534525.1|2091038_2092577_-	spore germination protein	NA	NA	NA	NA	NA
WP_060851832.1|2092943_2093669_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
2093600:2093617	attL	ATTTATGACGGGATTAAA	NA	NA	NA	NA
WP_060851833.1|2093642_2094734_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	79.8	9.6e-164
WP_060851834.1|2095555_2096776_+	hypothetical protein	NA	A0A0U3TNF6	Bacillus_phage	48.6	9.2e-107
WP_171840946.1|2097035_2097188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851835.1|2097194_2097530_-	helix-turn-helix domain-containing protein	NA	H0UST7	Bacillus_phage	40.6	8.6e-15
WP_060851836.1|2097703_2097910_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060852527.1|2097985_2098174_+	helix-turn-helix domain-containing protein	NA	A0A0S2GLE9	Bacillus_phage	95.2	4.6e-26
WP_171840947.1|2098197_2098353_+	hypothetical protein	NA	I7J4K2	Bacillus_phage	96.1	4.0e-23
WP_060851837.1|2098391_2099216_+	ORF6C domain-containing protein	NA	A0A0S2MV65	Bacillus_phage	77.7	8.7e-117
WP_000176230.1|2099377_2099686_+	hypothetical protein	NA	W8CYU1	Bacillus_phage	92.6	2.2e-41
WP_060851838.1|2099711_2100359_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	96.7	3.5e-113
WP_060851839.1|2100602_2101619_+	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	99.4	1.8e-188
WP_060851840.1|2101581_2102394_+	ATP-binding protein	NA	W8CZ50	Bacillus_phage	98.9	3.0e-154
WP_060851841.1|2102433_2102700_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	92.0	2.2e-37
WP_016098383.1|2102771_2102936_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	98.1	2.9e-24
WP_060851842.1|2102971_2103208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851843.1|2103567_2103966_+	hypothetical protein	NA	W8CYU3	Bacillus_phage	98.5	1.5e-69
WP_000965620.1|2105374_2105656_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	98.9	1.9e-44
WP_002162928.1|2105839_2105980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851844.1|2106005_2106491_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	97.5	1.7e-83
WP_001012128.1|2106487_2107030_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	99.4	3.3e-96
WP_060851845.1|2107245_2107491_+	hypothetical protein	NA	H0USV5	Bacillus_phage	95.9	3.0e-33
WP_060851846.1|2107899_2108187_+	hypothetical protein	NA	H0USV6	Bacillus_phage	97.9	2.8e-46
WP_060851848.1|2108496_2108682_+	hypothetical protein	NA	A0A0S2GLH7	Bacillus_phage	98.4	1.1e-24
WP_060851849.1|2108710_2108950_+	hypothetical protein	NA	A0A0S2GLE8	Bacillus_phage	97.5	4.4e-21
WP_060851850.1|2108966_2109179_+	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_042596524.1|2109567_2109792_+	hypothetical protein	NA	A0A0M4REP0	Bacillus_phage	40.3	2.4e-05
WP_060851852.1|2109798_2110200_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	46.5	4.5e-18
WP_060851853.1|2110205_2110583_+	HNH endonuclease	NA	H0USW1	Bacillus_phage	95.2	2.4e-66
WP_081097549.1|2110712_2111216_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	6.7e-88
WP_015382179.1|2111217_2112912_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	100.0	0.0e+00
WP_015382180.1|2113100_2114354_+|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.8	3.5e-242
WP_045350343.1|2114340_2115051_+|protease	Clp protease ClpP	protease	H0USW5	Bacillus_phage	99.6	9.4e-128
WP_060851854.1|2115088_2116255_+|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	99.5	4.7e-209
WP_060851855.1|2116275_2116563_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	6.8e-45
WP_060851856.1|2116549_2116873_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	96.3	8.2e-55
WP_060851857.1|2116865_2117300_+	HK97 gp10 family phage protein	NA	H0USW9	Bacillus_phage	96.5	9.6e-75
WP_000981497.1|2117296_2117656_+	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	95.0	1.4e-58
WP_060851858.1|2117656_2118262_+|tail	phage tail protein	tail	A0A0S2GLI0	Bacillus_phage	99.0	1.7e-98
WP_060851859.1|2118308_2118626_+	hypothetical protein	NA	A0A0S2GLH2	Bacillus_phage	99.0	5.8e-53
WP_000344048.1|2118655_2118832_+	hypothetical protein	NA	I3WTY5	Bacillus_phage	100.0	1.1e-26
WP_060851860.1|2118846_2122695_+|tail	phage tail tape measure protein	tail	A0A2H4J380	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_081097550.1|2122709_2124191_+|tail	phage tail family protein	tail	H0USX4	Bacillus_phage	93.7	2.4e-282
WP_060851861.1|2124187_2128276_+|tail	tail fiber domain-containing protein	tail	H0USX5	Bacillus_phage	79.8	0.0e+00
WP_081097551.1|2128368_2129337_+|integrase	site-specific integrase	integrase	A0A0S2MVF5	Bacillus_phage	98.4	6.9e-182
WP_000373869.1|2129353_2129779_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	99.3	9.7e-72
WP_060851863.1|2129778_2130714_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	98.1	1.4e-184
WP_060851864.1|2130790_2131594_-	hypothetical protein	NA	A6M971	Geobacillus_virus	41.3	7.1e-23
WP_060851865.1|2131593_2131800_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	43.1	1.1e-07
WP_060851866.1|2131988_2132291_+	hypothetical protein	NA	H0USY0	Bacillus_phage	100.0	2.4e-48
WP_060851867.1|2132293_2132476_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	91.7	3.6e-23
WP_060851868.1|2132591_2133773_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	93.1	6.4e-214
WP_060851869.1|2133714_2134335_+	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	95.1	7.7e-110
WP_060851870.1|2134344_2135169_-	helix-turn-helix domain-containing protein	NA	A0A1C8EA76	Bacillus_phage	71.0	2.5e-103
2135507:2135524	attR	ATTTATGACGGGATTAAA	NA	NA	NA	NA
>prophage 11
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	2484376	2556980	5896839	protease,transposase	Bacillus_phage(50.0%)	58	NA	NA
WP_000275829.1|2484376_2485000_-|protease	protease synthase/sporulation negative transcriptional regulator PaiB	protease	NA	NA	NA	NA
WP_000207068.1|2485022_2485541_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000658990.1|2485566_2486019_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060851919.1|2486134_2486803_+	YitT family protein	NA	NA	NA	NA	NA
WP_000781961.1|2486883_2487561_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	53.0	1.0e-62
WP_060851920.1|2487562_2488939_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	40.6	9.9e-57
WP_000820996.1|2489140_2489611_+	DinB family protein	NA	NA	NA	NA	NA
WP_060851921.1|2489720_2490980_-	MFS transporter	NA	NA	NA	NA	NA
WP_048538247.1|2491049_2491673_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006922800.1|2491857_2492922_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000202606.1|2492921_2493593_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	1.6e-36
WP_060851922.1|2493657_2494770_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_060851923.1|2494910_2495501_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_081097557.1|2495715_2496648_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000916240.1|2496785_2497004_+	RtcB family protein	NA	A0A223LGY9	Bacillus_phage	84.7	1.2e-28
WP_060851925.1|2497286_2498246_+	RtcB family protein	NA	A0A222Z820	Bacillus_phage	78.6	2.2e-143
WP_060851926.1|2498574_2499807_+	DUF4073 domain-containing protein	NA	NA	NA	NA	NA
WP_044307402.1|2500164_2501160_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000554419.1|2501244_2501841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005108.1|2502268_2503747_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_048519423.1|2504316_2507514_+	bifunctional P-450/NADPH--P450 reductase	NA	V5UQK0	Mycobacterium_phage	38.1	1.5e-79
WP_060851927.1|2507725_2509837_-	TerD family protein	NA	A0A1I9SAC2	Rhodococcus_phage	31.7	1.5e-67
WP_000022543.1|2510387_2510816_+	DUF5412 domain-containing protein	NA	NA	NA	NA	NA
WP_000636463.1|2511124_2512066_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	44.2	5.4e-54
WP_000444089.1|2512256_2512943_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.0	1.4e-40
WP_000800285.1|2512939_2514016_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	1.4e-18
WP_000595170.1|2514261_2515023_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.5	2.0e-35
WP_000897821.1|2515039_2516869_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060851928.1|2517032_2518820_-	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	34.5	6.0e-06
WP_060851929.1|2518935_2519514_-	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_060851554.1|2520863_2522075_-|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	4.4e-69
WP_002183718.1|2523157_2524036_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_060851930.1|2524673_2526119_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_001104104.1|2526465_2526681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851931.1|2526872_2528246_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.8	1.2e-25
WP_001264525.1|2528242_2528917_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.9	2.4e-32
WP_060851932.1|2529184_2529655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025686869.1|2529675_2529999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000655287.1|2530612_2531857_+	MFS transporter	NA	NA	NA	NA	NA
WP_000549725.1|2531871_2533131_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_000499523.1|2533374_2534568_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
WP_000441009.1|2534866_2535028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002204749.1|2535445_2535832_+	DUF1259 domain-containing protein	NA	NA	NA	NA	NA
WP_001048567.1|2536337_2536757_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_033690982.1|2537086_2537437_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000323764.1|2537633_2537939_+	monooxygenase	NA	NA	NA	NA	NA
WP_000802592.1|2538180_2539050_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000059810.1|2539170_2540043_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001014149.1|2540451_2541771_-	septum formation initiator	NA	NA	NA	NA	NA
WP_059304306.1|2542935_2544102_+	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	26.2	2.2e-20
WP_059304307.1|2544195_2546280_+	serine hydrolase	NA	NA	NA	NA	NA
WP_000169655.1|2547631_2548222_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060851933.1|2548814_2549624_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002164503.1|2550228_2550663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060851934.1|2550900_2551680_+	DUF1510 family protein	NA	NA	NA	NA	NA
WP_000833211.1|2554169_2554523_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	38.0	2.2e-13
WP_000364215.1|2554990_2555401_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000116992.1|2555549_2556980_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	3712257	3760927	5896839	protease,coat,transposase	Bacillus_phage(27.27%)	54	NA	NA
WP_000340527.1|3712257_3712716_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_002023919.1|3712747_3713932_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_000505094.1|3714092_3714179_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000141164.1|3714305_3714812_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_001053969.1|3714914_3716351_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000488043.1|3716597_3717467_-	TIGR03943 family protein	NA	NA	NA	NA	NA
WP_000418716.1|3717470_3718367_-	permease	NA	NA	NA	NA	NA
WP_000932389.1|3718564_3719506_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_000678845.1|3719838_3721218_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000880691.1|3721315_3721918_-	DedA family protein	NA	NA	NA	NA	NA
WP_000153584.1|3722022_3722640_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_017656823.1|3722744_3723821_-|coat	spore coat protein CotH	coat	NA	NA	NA	NA
WP_000817498.1|3724002_3724581_+	exosporium protein ExsB	NA	NA	NA	NA	NA
WP_000858827.1|3724626_3725238_-	phosphoserine phosphatase 1	NA	NA	NA	NA	NA
WP_000543107.1|3725251_3725797_-	short-chain dehydrogenase	NA	NA	NA	NA	NA
WP_000943775.1|3725810_3726227_-	FosB/FosD family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	64.0	1.8e-38
WP_000824276.1|3726286_3727948_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002164561.1|3728032_3729019_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_000283910.1|3729044_3729497_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.0	1.1e-25
WP_001086168.1|3729630_3730668_+	NADPH dehydrogenase NamA	NA	NA	NA	NA	NA
WP_001042735.1|3730697_3731357_-	oxidoreductase	NA	NA	NA	NA	NA
WP_001053969.1|3731562_3732999_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_053512689.1|3733081_3733234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001126148.1|3733499_3734450_+	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001048677.1|3734588_3735059_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000613422.1|3735171_3736122_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_060852188.1|3736287_3737190_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	25.1	1.5e-08
WP_001068750.1|3737214_3737799_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001168130.1|3737883_3739347_-	flavin monoamine oxidase family protein	NA	A0A2K9L022	Tupanvirus	21.6	2.6e-15
WP_000683368.1|3739525_3739717_+	DUF3896 domain-containing protein	NA	NA	NA	NA	NA
WP_000594045.1|3739821_3740823_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000798324.1|3740867_3741812_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000488210.1|3742025_3742481_-	DUF3939 domain-containing protein	NA	NA	NA	NA	NA
WP_000105199.1|3742584_3743028_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	62.1	6.2e-45
WP_000370204.1|3743268_3744309_+	membrane protein	NA	NA	NA	NA	NA
WP_000965068.1|3744343_3744709_-	DUF3979 family protein	NA	NA	NA	NA	NA
WP_000539569.1|3745031_3745337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517290.1|3745533_3747516_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.2	1.1e-29
WP_001073045.1|3747716_3748766_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_000687340.1|3748948_3749476_-	DUF664 domain-containing protein	NA	NA	NA	NA	NA
WP_000426317.1|3749672_3750020_+	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_000162602.1|3750104_3750329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001198796.1|3750528_3750891_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_002197676.1|3751289_3751553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852189.1|3751678_3752626_-|protease	serine protease	protease	A0A127AWU5	Bacillus_phage	57.8	1.7e-95
WP_000648324.1|3752901_3753189_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	55.7	7.6e-12
WP_017656811.1|3753305_3755186_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000174904.1|3755456_3756275_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	63.0	3.9e-93
WP_000024992.1|3756324_3756786_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	35.1	6.5e-05
WP_002183486.1|3756817_3757015_-	DUF4083 domain-containing protein	NA	NA	NA	NA	NA
WP_000520862.1|3757119_3758280_-	peptidase	NA	NA	NA	NA	NA
WP_001034844.1|3758430_3759183_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_000540425.1|3759406_3759553_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000499523.1|3759733_3760927_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.1e-24
>prophage 13
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	3774563	3839251	5896839	transposase,capsid,tail,terminase,portal	Bacillus_phage(88.52%)	79	NA	NA
WP_085961003.1|3774563_3775918_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	85.5	7.3e-129
WP_000119510.1|3775999_3776680_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	41.0	2.2e-17
WP_000873566.1|3776839_3777496_-	YkyA family protein	NA	NA	NA	NA	NA
WP_000409484.1|3777510_3778332_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_000824535.1|3778433_3779792_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	31.3	6.4e-40
WP_000036068.1|3779788_3780478_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	6.1e-31
WP_001174859.1|3780490_3781738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002182662.1|3781902_3782904_-	LCP family protein	NA	NA	NA	NA	NA
WP_048538790.1|3783224_3785540_-	glycoside hydrolase	NA	NA	NA	NA	NA
WP_001031479.1|3785747_3785957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612682.1|3786090_3786984_-	homoserine kinase	NA	NA	NA	NA	NA
WP_000276434.1|3786980_3788039_-	threonine synthase	NA	NA	NA	NA	NA
WP_048538791.1|3788031_3789327_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_000510730.1|3790445_3791084_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_000141352.1|3791165_3791774_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_031312782.1|3791821_3792160_-	SdpI family protein	NA	NA	NA	NA	NA
WP_000291201.1|3792232_3793060_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001258504.1|3793178_3794051_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.7	1.2e-63
WP_000818985.1|3794341_3795061_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_048538792.1|3795279_3795846_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_001231621.1|3795870_3796944_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	98.0	6.1e-187
WP_000612414.1|3796940_3797618_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_016124454.1|3797704_3797962_-	hypothetical protein	NA	W8CYT2	Bacillus_phage	98.3	2.9e-26
WP_060852191.1|3797992_3798784_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7K2	Bacillus_phage	98.5	3.2e-153
WP_000427019.1|3798842_3799130_-	hypothetical protein	NA	W8CZ40	Bacillus_phage	100.0	6.2e-46
WP_060852192.1|3799139_3804479_-	hypothetical protein	NA	K4LNZ9	Bacillus_virus	92.8	0.0e+00
WP_060852193.1|3804482_3805997_-|tail	phage tail family protein	tail	W8CYX4	Bacillus_phage	99.2	1.3e-299
WP_060852194.1|3806008_3808852_-|tail	phage tail tape measure protein	tail	K4LRV6	Bacillus_virus	96.7	0.0e+00
WP_060852195.1|3808854_3809127_-	hypothetical protein	NA	W8CYM7	Bacillus_phage	97.8	8.5e-45
WP_060852196.1|3809147_3809567_-	hypothetical protein	NA	W8CYT0	Bacillus_phage	96.4	2.9e-68
WP_000561467.1|3809632_3810298_-	hypothetical protein	NA	A0A1B1P7K6	Bacillus_phage	100.0	2.2e-126
WP_060852197.1|3810316_3810718_-	hypothetical protein	NA	A0A1B1P7K0	Bacillus_phage	98.5	2.3e-70
WP_060852198.1|3810714_3811131_-	hypothetical protein	NA	W8CYF3	Bacillus_phage	97.8	4.4e-69
WP_060852199.1|3811130_3811463_-	hypothetical protein	NA	W8CYM6	Bacillus_phage	98.2	1.3e-55
WP_060852200.1|3811466_3811832_-	hypothetical protein	NA	W8CYS9	Bacillus_phage	99.2	4.6e-62
WP_060852201.1|3811868_3812705_-	hypothetical protein	NA	A0A1B1P7J5	Bacillus_phage	96.8	6.0e-150
WP_060852202.1|3812781_3813393_-	DUF4355 domain-containing protein	NA	A0A1B1P7J6	Bacillus_phage	86.2	7.4e-81
WP_000677148.1|3813493_3813694_-	hypothetical protein	NA	W8CYM5	Bacillus_phage	97.0	2.2e-26
WP_060852203.1|3813702_3814728_-|capsid	minor capsid protein	capsid	K4LP29	Bacillus_virus	98.8	1.2e-189
WP_060852204.1|3814731_3816204_-|portal	phage portal protein	portal	A0A1B1P7K9	Bacillus_phage	99.2	1.1e-279
WP_060852205.1|3816217_3817537_-|terminase	PBSX family phage terminase large subunit	terminase	W8CZ36	Bacillus_phage	97.9	6.2e-258
WP_145977411.1|3817631_3817853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852207.1|3817852_3818332_-|terminase	terminase small subunit	terminase	W8CYF1	Bacillus_phage	99.4	9.3e-87
WP_000432374.1|3818426_3818696_-	hypothetical protein	NA	W8CYM4	Bacillus_phage	100.0	4.6e-43
WP_016064726.1|3818695_3818959_-	hypothetical protein	NA	W8CYS7	Bacillus_phage	100.0	2.2e-45
WP_060852208.1|3818930_3819215_-	hypothetical protein	NA	W8CYW3	Bacillus_phage	98.9	2.2e-48
WP_060852210.1|3820671_3820914_-	hypothetical protein	NA	W8CYF0	Bacillus_phage	96.2	7.5e-37
WP_060852211.1|3821217_3821487_-	hypothetical protein	NA	K4LPB5	Bacillus_virus	68.1	3.8e-29
WP_016064723.1|3821604_3821769_-	hypothetical protein	NA	W8CYS6	Bacillus_phage	100.0	8.4e-24
WP_002162844.1|3822121_3822274_-	hypothetical protein	NA	W8CZ34	Bacillus_phage	98.0	1.8e-20
WP_171840932.1|3822273_3822441_-	hypothetical protein	NA	A0A1B1P7H5	Bacillus_phage	96.4	3.1e-21
WP_060852212.1|3822425_3823025_-	DUF1064 domain-containing protein	NA	A0A1B1P7H7	Bacillus_phage	98.5	1.5e-110
WP_016064719.1|3822996_3823143_-	hypothetical protein	NA	W8CYM2	Bacillus_phage	100.0	6.8e-17
WP_060852213.1|3823139_3823370_-	hypothetical protein	NA	A0A1B1P7I3	Bacillus_phage	97.4	8.8e-35
WP_060852214.1|3823366_3823582_-	hypothetical protein	NA	A0A1B1P7I9	Bacillus_phage	54.9	2.0e-09
WP_060852542.1|3823775_3825110_-	hypothetical protein	NA	W8CYE8	Bacillus_phage	99.8	7.7e-256
WP_015994862.1|3825147_3825348_-	NINE protein	NA	A0A1B1P7I0	Bacillus_phage	100.0	1.6e-32
WP_060852216.1|3825471_3825972_-	hypothetical protein	NA	A0A1B1P7G1	Bacillus_phage	97.0	1.0e-88
WP_153598354.1|3826102_3826249_-	hypothetical protein	NA	A0A1B1P7F9	Bacillus_phage	46.9	1.1e-06
WP_060852217.1|3826248_3826455_-	hypothetical protein	NA	W8CYE7	Bacillus_phage	88.2	3.4e-30
WP_060852218.1|3826447_3826729_-	hypothetical protein	NA	W8CYM0	Bacillus_phage	51.0	1.3e-19
WP_060852219.1|3826728_3827079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081097588.1|3827247_3828126_-	Rha family transcriptional regulator	NA	W8CYS3	Bacillus_phage	74.2	2.3e-91
WP_000571723.1|3828122_3828302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852220.1|3828314_3829127_-	hypothetical protein	NA	W8CYV0	Bacillus_phage	96.3	6.3e-152
WP_060852221.1|3829144_3829732_-	hypothetical protein	NA	W8CZ31	Bacillus_phage	96.4	3.9e-103
WP_060852222.1|3830296_3830611_-	hypothetical protein	NA	W8CYL9	Bacillus_phage	93.3	5.0e-49
WP_060852223.1|3830615_3831308_-	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	91.3	1.3e-118
WP_060852224.1|3831288_3831498_-	hypothetical protein	NA	A0A1B1P7F7	Bacillus_phage	71.2	4.7e-19
WP_060852225.1|3831509_3831995_-	siphovirus Gp157 family protein	NA	W8CYU7	Bacillus_phage	91.3	2.4e-74
WP_016064702.1|3832007_3832181_-	hypothetical protein	NA	W8CZ30	Bacillus_phage	100.0	1.2e-23
WP_060852226.1|3832180_3832450_-	hypothetical protein	NA	W8CYE5	Bacillus_phage	98.9	1.2e-46
WP_060852227.1|3832421_3832679_-	hypothetical protein	NA	A0A1B1P7G5	Bacillus_phage	94.1	1.8e-33
WP_016064699.1|3832794_3833043_-	helix-turn-helix transcriptional regulator	NA	W8CYU5	Bacillus_phage	100.0	8.3e-39
WP_060852228.1|3833293_3833926_+	helix-turn-helix domain-containing protein	NA	A0A1B1P7E9	Bacillus_phage	99.5	2.7e-110
WP_060852229.1|3833925_3835308_+	recombinase family protein	NA	B8R885	Bacillus_phage	99.8	1.4e-265
WP_060852230.1|3835285_3836860_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.9	1.5e-282
WP_001194306.1|3837100_3837865_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755507.1|3837964_3839251_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
>prophage 14
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	4009962	4019346	5896839		Brevibacillus_phage(100.0%)	9	NA	NA
WP_000277551.1|4009962_4010553_+	helix-turn-helix domain-containing protein	NA	A0A0K2CNS5	Brevibacillus_phage	43.4	2.3e-26
WP_001005178.1|4010611_4011382_+	ATP-binding protein	NA	A0A0K2CNX1	Brevibacillus_phage	48.8	2.0e-62
WP_001139155.1|4011861_4013154_+	DNA helicase	NA	A0A0K2CP24	Brevibacillus_phage	57.9	2.0e-139
WP_001167933.1|4013178_4014255_+	toprim domain-containing protein	NA	A0A0K2CNW6	Brevibacillus_phage	54.3	5.8e-105
WP_060852242.1|4014282_4014840_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CPD2	Brevibacillus_phage	40.5	1.2e-24
WP_000207534.1|4015301_4015961_+	hypothetical protein	NA	A0A0K2CPH8	Brevibacillus_phage	56.9	4.7e-57
WP_060852243.1|4016047_4017442_+	hypothetical protein	NA	A0A0K2CP19	Brevibacillus_phage	45.6	3.2e-103
WP_000781409.1|4018065_4018470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000177372.1|4018638_4019346_+	DNA polymerase I	NA	A0A0K2CNW2	Brevibacillus_phage	53.5	7.3e-64
>prophage 15
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	4033338	4044218	5896839		Brevibacillus_phage(66.67%)	7	NA	NA
WP_060852245.1|4033338_4037694_-	DNRLRE domain-containing protein	NA	A0A0K2CP88	Brevibacillus_phage	23.7	5.4e-32
WP_000350104.1|4037736_4040628_-	hypothetical protein	NA	A0A127AW61	Bacillus_phage	33.0	4.8e-13
WP_000602965.1|4040612_4041224_-	hypothetical protein	NA	A0A127AW14	Bacillus_phage	51.6	2.2e-48
WP_001111326.1|4041264_4041756_-	hypothetical protein	NA	A0A0K2CNZ3	Brevibacillus_phage	55.2	2.4e-37
WP_000345536.1|4041831_4042275_-	hypothetical protein	NA	A0A0K2CPK2	Brevibacillus_phage	40.6	3.0e-23
WP_000537240.1|4042353_4043085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000022193.1|4043096_4044218_-	hypothetical protein	NA	A0A0K2CPP1	Brevibacillus_phage	37.0	7.3e-66
>prophage 16
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	4057131	4073990	5896839	tail	Brevibacillus_phage(100.0%)	11	NA	NA
WP_001145940.1|4057131_4059717_-	hypothetical protein	NA	A0A0K2CPJ7	Brevibacillus_phage	43.5	1.6e-31
WP_000007798.1|4059732_4060173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000057630.1|4060187_4060904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001134181.1|4060982_4064174_-	M23 family metallopeptidase	NA	A0A0K2CNY2	Brevibacillus_phage	50.0	3.7e-06
WP_001126624.1|4064186_4065260_-	hypothetical protein	NA	A0A0K2CP35	Brevibacillus_phage	40.3	4.1e-74
WP_000068595.1|4065262_4065880_-	S-layer homology domain-containing protein	NA	A0A0K2CPJ2	Brevibacillus_phage	60.7	8.3e-72
WP_060852250.1|4065938_4071278_-|tail	phage tail tape measure protein	tail	A0A0K2CPN3	Brevibacillus_phage	26.8	2.3e-141
WP_000743719.1|4071350_4071593_-	hypothetical protein	NA	A0A0K2CP74	Brevibacillus_phage	55.0	2.1e-18
WP_000004090.1|4071679_4072150_-	hypothetical protein	NA	A0A0K2CPC8	Brevibacillus_phage	70.3	9.9e-33
WP_000077128.1|4072383_4073472_-	hypothetical protein	NA	A0A0K2CNX7	Brevibacillus_phage	55.8	1.2e-94
WP_002062978.1|4073471_4073990_-	hypothetical protein	NA	A0A0K2CP30	Brevibacillus_phage	45.8	4.4e-26
>prophage 17
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	4564555	4704018	5896839	transposase,head,capsid,plate,holin,protease,tail,tRNA,terminase,portal,bacteriocin	Bacillus_phage(47.52%)	170	NA	NA
WP_145977397.1|4564555_4565750_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.3	4.6e-26
WP_000003349.1|4565805_4567632_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	26.7	1.1e-63
WP_000628313.1|4567682_4568927_-	competence protein	NA	NA	NA	NA	NA
WP_000799194.1|4569007_4570552_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_060852307.1|4570624_4571308_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_000362607.1|4571653_4572328_+	TerC family protein	NA	W8EBD0	Pseudomonas_phage	42.6	3.4e-26
WP_000258267.1|4572377_4572773_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_000559971.1|4573366_4573570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852308.1|4573600_4575247_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002164600.1|4575600_4577046_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_000166348.1|4577189_4578125_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.5	1.1e-22
WP_000854346.1|4578117_4579161_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.1e-18
WP_000974106.1|4579179_4580196_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000534167.1|4580192_4581122_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000727217.1|4581248_4582904_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001044997.1|4583223_4583604_+	DUF3899 domain-containing protein	NA	NA	NA	NA	NA
WP_060852309.1|4584002_4584992_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000966127.1|4585339_4586086_-	YjbA family protein	NA	A0A0A0RP53	Bacillus_phage	40.5	1.8e-44
WP_000513279.1|4586229_4587018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000412656.1|4587124_4588363_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_001100547.1|4588394_4589327_-	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_001986215.1|4589715_4589892_-	competence protein ComG	NA	NA	NA	NA	NA
WP_002164601.1|4589946_4590819_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000028712.1|4590848_4591583_-	hydrolase	NA	NA	NA	NA	NA
WP_001211116.1|4591739_4591922_+	YjzD family protein	NA	NA	NA	NA	NA
WP_000365403.1|4591960_4594561_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	33.1	2.4e-120
WP_000531421.1|4594770_4594950_-	YjzC family protein	NA	NA	NA	NA	NA
WP_060852310.1|4595442_4596252_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_000516816.1|4596357_4596498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000527407.1|4596498_4596696_+	DUF3813 domain-containing protein	NA	NA	NA	NA	NA
WP_000364431.1|4596721_4597579_-	YitT family protein	NA	NA	NA	NA	NA
WP_001120851.1|4597679_4597811_+	DUF3941 domain-containing protein	NA	NA	NA	NA	NA
WP_001214214.1|4597939_4598797_+	peptidylprolyl isomerase PrsA	NA	NA	NA	NA	NA
WP_000281260.1|4598850_4599705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001040149.1|4599935_4600427_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_060852311.1|4601279_4602176_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060852312.1|4602481_4603837_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001055849.1|4603995_4605228_+	ammonium transporter	NA	NA	NA	NA	NA
WP_001069176.1|4605495_4606962_-	catalase	NA	A0A2K9L572	Tupanvirus	51.4	1.2e-124
WP_000727377.1|4607021_4607981_-	ferrochelatase	NA	NA	NA	NA	NA
WP_060852313.1|4608460_4609285_+	helix-turn-helix domain-containing protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	89.7	6.6e-133
WP_053512216.1|4609301_4609595_-	YolD-like family protein	NA	A0A1C8E992	Bacillus_phage	90.7	1.6e-44
WP_053512217.1|4609618_4609837_-	hypothetical protein	NA	A0A1C8E991	Bacillus_phage	91.7	2.1e-30
WP_000930621.1|4609986_4610658_+	hypothetical protein	NA	A0A1C8E993	Bacillus_phage	98.7	5.1e-115
WP_000119474.1|4610722_4611052_+	hypothetical protein	NA	A0A1C8E989	Bacillus_phage	100.0	2.8e-50
WP_060852314.1|4611572_4612625_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P7Q1	Bacillus_phage	97.7	3.0e-199
WP_060852315.1|4612621_4612852_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	94.7	2.4e-32
WP_060852316.1|4612969_4614151_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	69.9	1.5e-149
WP_060852317.1|4614165_4616508_-|tail	phage tail protein	tail	A0A1B1P7P0	Bacillus_phage	97.8	0.0e+00
WP_060852318.1|4616504_4617188_-|tail	phage tail family protein	tail	A0A1C8EA72	Bacillus_phage	99.1	1.3e-129
WP_060852319.1|4617189_4620711_-|tail	phage tail tape measure protein	tail	A0A1C8E982	Bacillus_phage	99.1	3.0e-291
WP_006927278.1|4620727_4620916_-	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	98.4	8.2e-31
WP_060852320.1|4620954_4621341_-	hypothetical protein	NA	A0A1B1P7Q6	Bacillus_phage	99.2	3.6e-65
WP_000215489.1|4621352_4621988_-	hypothetical protein	NA	A0A1B1P7Q4	Bacillus_phage	100.0	6.7e-117
WP_060852321.1|4621999_4622377_-	HK97 gp10 family phage protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	87.2	5.1e-56
WP_060852322.1|4622376_4622706_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	99.1	5.2e-57
WP_060852323.1|4622695_4623031_-	hypothetical protein	NA	A0A1C8E986	Bacillus_phage	97.2	7.2e-54
WP_060852324.1|4623005_4623266_-|head,tail	phage head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	97.7	1.2e-40
WP_060852325.1|4623267_4624584_-|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	88.5	3.6e-189
WP_053512992.1|4624585_4625167_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1C8EA63	Bacillus_phage	96.9	1.1e-97
WP_053512993.1|4625156_4626341_-|portal	phage portal protein	portal	A0A1B1P7N5	Bacillus_phage	98.0	2.3e-219
WP_060852326.1|4626379_4626595_-	hypothetical protein	NA	A0A1C8E977	Bacillus_phage	90.1	6.7e-29
WP_053512998.1|4626594_4626807_-	hypothetical protein	NA	A0A1C8E971	Bacillus_phage	95.7	6.8e-34
WP_060852327.1|4626821_4628543_-|terminase	terminase large subunit	terminase	A0A1B2AQ28	Phage_Wrath	93.6	0.0e+00
WP_060852328.1|4629094_4629460_-	HNH endonuclease	NA	A0A2H4JA38	uncultured_Caudovirales_phage	65.3	1.5e-41
WP_060852329.1|4629456_4629771_-	hypothetical protein	NA	A0A1B0T6C6	Bacillus_phage	85.6	2.2e-44
WP_060852545.1|4629767_4630106_-	hypothetical protein	NA	A0A1C8E9B7	Bacillus_phage	57.5	2.6e-27
WP_060852330.1|4630435_4630828_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	65.4	1.6e-44
WP_060852331.1|4631011_4631203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016097914.1|4631275_4631713_-	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	95.2	1.3e-71
WP_001273080.1|4631746_4632286_-	ERCC4 domain-containing protein	NA	A0A2H4J819	uncultured_Caudovirales_phage	91.1	1.1e-88
WP_001206918.1|4632288_4632657_-	hypothetical protein	NA	B4XYT8	Lactobacillus_phage	41.7	1.4e-13
WP_060852332.1|4632659_4633094_-	hypothetical protein	NA	A0A2H4J832	uncultured_Caudovirales_phage	73.9	1.1e-54
WP_060852333.1|4633095_4633470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852334.1|4633760_4636148_-	DNA primase	NA	A0A2H4JEX8	uncultured_Caudovirales_phage	94.5	0.0e+00
WP_060851531.1|4636217_4636652_-	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	64.1	5.3e-49
WP_060852335.1|4636651_4637581_-	AAA family ATPase	NA	A0A2H4JFH2	uncultured_Caudovirales_phage	54.2	1.2e-90
WP_060852336.1|4637583_4638132_-	host-nuclease inhibitor Gam family protein	NA	A0A2H4JFP8	uncultured_Caudovirales_phage	92.3	2.3e-89
WP_060852337.1|4638109_4638397_-	hypothetical protein	NA	A0A2H4J830	uncultured_Caudovirales_phage	48.9	1.3e-16
WP_170951711.1|4638416_4638572_-	hypothetical protein	NA	A0A2H4J977	uncultured_Caudovirales_phage	82.0	3.2e-17
WP_016097904.1|4638632_4639277_-	sigma-70 family RNA polymerase sigma factor	NA	W8CYN8	Bacillus_phage	79.8	3.0e-88
WP_060852338.1|4639301_4639652_-	hypothetical protein	NA	A0A2H4JGP5	uncultured_Caudovirales_phage	74.1	2.8e-40
WP_060852339.1|4639652_4639880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171840954.1|4639880_4640048_-	hypothetical protein	NA	A0A1B2APZ0	Phage_Wrath	78.2	2.1e-14
WP_000014073.1|4640116_4640281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000385075.1|4640346_4640619_-	helix-turn-helix transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	50.0	2.3e-10
WP_060852340.1|4640769_4641453_+	LexA family transcriptional regulator	NA	A0A2I6PF08	Staphylococcus_phage	30.7	5.9e-18
WP_000289676.1|4641468_4641687_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060852341.1|4641799_4643203_+	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	3.1e-114
WP_060852342.1|4643233_4645012_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.3	2.7e-22
WP_000616046.1|4645251_4645806_+	DUF2777 domain-containing protein	NA	NA	NA	NA	NA
WP_000233494.1|4645936_4646302_-	YisL family protein	NA	NA	NA	NA	NA
WP_000616658.1|4646452_4647643_+	ornithine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	27.7	1.4e-27
WP_000926857.1|4647753_4648035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001213071.1|4648071_4648971_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000462841.1|4649218_4649398_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_001111187.1|4649494_4649716_+	spore germination protein GerPA	NA	NA	NA	NA	NA
WP_001012508.1|4649730_4649937_+	spore germination protein GerPB	NA	NA	NA	NA	NA
WP_001070760.1|4650004_4650619_+	spore germination protein GerPC	NA	NA	NA	NA	NA
WP_001052807.1|4650625_4650820_+	spore germination protein GerPD	NA	NA	NA	NA	NA
WP_000902324.1|4650835_4651222_+	spore germination protein GerPE	NA	NA	NA	NA	NA
WP_001141566.1|4651264_4651480_+	spore germination protein GerPF	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	80.9	3.4e-25
WP_000255728.1|4651617_4651905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852343.1|4651917_4655643_-	helicase-exonuclease AddAB subunit AddA	NA	G3MA40	Bacillus_virus	25.1	5.8e-19
WP_060852344.1|4655639_4659155_-	helicase-exonuclease AddAB subunit AddB	NA	NA	NA	NA	NA
WP_000751919.1|4659271_4659835_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000347517.1|4659891_4660485_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_042597373.1|4661440_4662274_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	82.7	4.1e-122
WP_042597371.1|4662290_4662584_-	YolD-like family protein	NA	A0A1C8E992	Bacillus_phage	85.6	1.0e-40
WP_042597369.1|4662598_4662817_-	hypothetical protein	NA	A0A1C8E991	Bacillus_phage	94.4	1.1e-31
WP_042597368.1|4662954_4663284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042597366.1|4663512_4664451_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	92.9	1.5e-173
WP_060852345.1|4664440_4664875_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	89.1	2.9e-63
WP_060851554.1|4665140_4666352_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	4.4e-69
WP_042597362.1|4666513_4666888_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	93.5	4.3e-63
WP_060852346.1|4666903_4671769_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	82.0	0.0e+00
WP_145977426.1|4671765_4673229_-|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	74.4	2.0e-201
WP_080775463.1|4673262_4675989_-|tail	phage tail tape measure protein	tail	A0A2H4J957	uncultured_Caudovirales_phage	62.6	1.1e-94
WP_042597357.1|4675988_4676264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042597355.1|4676287_4676698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042597354.1|4676700_4677228_-|tail	tail protein	tail	A0A097PBF4	Streptococcus_pyogenes_phage	35.6	2.2e-09
WP_042597352.1|4677229_4677655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042597350.1|4677647_4678076_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_042597348.1|4678059_4678377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042597346.1|4678373_4678715_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_042597344.1|4678717_4678906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042597343.1|4678923_4679862_-	DUF5309 family protein	NA	D6PFH7	uncultured_phage	28.1	3.6e-18
WP_042597341.1|4679876_4680518_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_042597339.1|4680603_4680786_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_042598603.1|4680769_4681585_-|capsid	minor capsid protein	capsid	Q6SE81	Lactobacillus_prophage	36.4	1.2e-20
WP_042597338.1|4681703_4683185_-|portal	phage portal protein	portal	E5DV51	Deep-sea_thermophilic_phage	36.0	6.9e-48
WP_042597336.1|4683197_4684418_-|terminase	PBSX family phage terminase large subunit	terminase	A0A059T7K2	Staphylococcus_phage	65.4	4.7e-151
WP_042597334.1|4684414_4685182_-	hypothetical protein	NA	A0A2P1JTW4	Anoxybacillus_phage	46.4	5.3e-52
WP_060852348.1|4685862_4686156_-	hypothetical protein	NA	A0A0K2D0F2	Bacillus_phage	70.1	8.3e-30
WP_042597329.1|4686201_4686399_-	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	81.5	1.5e-22
WP_000834382.1|4686569_4686761_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_060852349.1|4686838_4687264_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A090DBV2	Clostridium_phage	50.0	1.1e-25
WP_060852350.1|4687329_4688205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016109416.1|4688271_4688460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852351.1|4688877_4689387_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J8J4	uncultured_Caudovirales_phage	83.4	1.3e-59
WP_042597321.1|4689522_4689846_-	zinc-finger domain-containing protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	86.0	1.6e-50
WP_033699649.1|4689842_4690370_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	93.7	1.5e-90
WP_052497242.1|4690404_4690878_-	hypothetical protein	NA	A0A0K2FL91	Brevibacillus_phage	38.6	1.1e-23
WP_042597319.1|4690912_4691221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042597317.1|4691260_4691659_-	hypothetical protein	NA	A0A0U3SQD7	Bacillus_phage	96.2	1.1e-69
WP_060852352.1|4691697_4692093_-	hypothetical protein	NA	H0USU9	Bacillus_phage	91.6	1.2e-68
WP_060852353.1|4692108_4692294_-	hypothetical protein	NA	J9PRR8	Bacillus_phage	61.7	1.8e-14
WP_060852354.1|4692315_4692861_-	hypothetical protein	NA	A0A1Z1DA37	Bacillus_phage	47.3	8.5e-36
WP_060852355.1|4692901_4693081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852356.1|4693123_4693660_-	dUTP diphosphatase	NA	A0A2H4J4W9	uncultured_Caudovirales_phage	90.4	1.7e-89
WP_042597308.1|4693784_4694219_-	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	95.1	2.3e-76
WP_042597306.1|4694257_4694815_-	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	67.9	2.0e-61
WP_042597305.1|4694838_4695069_-	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	98.7	9.7e-34
WP_060852357.1|4695061_4695541_-	hypothetical protein	NA	A0A1C8E9A8	Bacillus_phage	92.5	9.3e-79
WP_060852358.1|4695552_4696488_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	95.8	8.3e-132
WP_060852359.1|4696582_4696921_-	hypothetical protein	NA	A0A2H4J6H7	uncultured_Caudovirales_phage	98.2	2.3e-52
WP_014894867.1|4696853_4697069_-	hypothetical protein	NA	A0A2H4J3B2	uncultured_Caudovirales_phage	90.1	2.0e-28
WP_042597301.1|4697068_4697782_-	hypothetical protein	NA	A0A1C8EA84	Bacillus_phage	97.9	3.0e-126
WP_042597300.1|4697800_4698235_-	hypothetical protein	NA	A0A1C8E9A2	Bacillus_phage	98.6	1.4e-73
WP_001187283.1|4698261_4698450_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	62.9	2.6e-13
WP_060852360.1|4698461_4699217_-	ORF6C domain-containing protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	86.6	1.1e-113
WP_171840955.1|4699231_4699387_-	hypothetical protein	NA	A0A1C8E9A0	Bacillus_phage	92.0	5.3e-20
WP_171840956.1|4699413_4699560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042597296.1|4699556_4699757_-	helix-turn-helix transcriptional regulator	NA	A0A0F6N3M9	Staphylococcus_phage	54.5	1.2e-08
WP_042597294.1|4700037_4700445_+	helix-turn-helix transcriptional regulator	NA	A0A0M4QX29	Bacillus_phage	46.4	4.2e-24
WP_042597293.1|4700467_4700902_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	54.4	1.1e-33
WP_042597292.1|4700933_4702367_+	recombinase family protein	NA	A0A2P1JU08	Anoxybacillus_phage	47.5	4.7e-110
WP_000391373.1|4702878_4703064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356916.1|4703413_4703617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000301522.1|4703814_4704018_-	RNA chaperone/antiterminator CspA	NA	Q9AZD3	Lactococcus_phage	62.9	8.0e-16
>prophage 18
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	4827210	4867049	5896839	transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_145977416.1|4827210_4827882_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	49.2	4.6e-07
WP_000275580.1|4827961_4829257_+|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000798699.1|4829246_4829999_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_145977417.1|4830045_4830306_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	8.7e-07
WP_002164614.1|4830549_4831161_-	DUF2812 domain-containing protein	NA	NA	NA	NA	NA
WP_001078066.1|4831174_4831489_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001035207.1|4831629_4832274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000288218.1|4832399_4834133_-	S-layer homology domain-containing protein	NA	NA	NA	NA	NA
WP_060852375.1|4835266_4835548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000395467.1|4835916_4836810_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000940664.1|4837430_4837820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000106150.1|4838216_4839326_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.3	2.6e-92
WP_000464477.1|4840145_4840604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113732247.1|4840798_4841011_-	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_011109878.1|4841049_4841241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852376.1|4841519_4841822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081097597.1|4841986_4843738_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_000204220.1|4843916_4844483_+	dihydroxyacetone kinase transcriptional activator DhaS	NA	NA	NA	NA	NA
WP_000723364.1|4844502_4845501_+	DhaKLM operon coactivator DhaQ	NA	NA	NA	NA	NA
WP_000556719.1|4845600_4846236_-	VanZ family protein	NA	NA	NA	NA	NA
WP_000169374.1|4846909_4848217_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	23.8	1.7e-10
WP_060852377.1|4850540_4851848_-	group II intron reverse transcriptase/maturase	NA	H7BV92	unidentified_phage	23.8	1.7e-10
WP_003286404.1|4853559_4853922_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000566919.1|4854216_4854609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000249013.1|4854620_4854878_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_001060032.1|4855053_4855509_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_000694778.1|4856191_4856662_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_060852378.1|4856987_4857248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000877046.1|4857356_4857710_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_000056044.1|4857743_4859381_-	EndoU domain-containing protein	NA	A0A0A7RVN1	Clostridium_phage	46.6	1.4e-25
WP_000076120.1|4859377_4859740_-	DUF3958 family protein	NA	NA	NA	NA	NA
WP_000529655.1|4859781_4860057_-	TIGR04197 family type VII secretion effector	NA	NA	NA	NA	NA
WP_000918591.1|4860243_4860540_-	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
WP_145977427.1|4860666_4860825_-	ornithine cyclodeaminase	NA	NA	NA	NA	NA
WP_000272480.1|4860934_4861081_-	DUF4176 domain-containing protein	NA	NA	NA	NA	NA
WP_001053955.1|4861324_4862761_-|transposase	IS4-like element IS231A family transposase	transposase	NA	NA	NA	NA
WP_000116992.1|4862991_4864422_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000364215.1|4864570_4864981_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_145977397.1|4865853_4867049_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.3	4.6e-26
>prophage 19
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	4925262	4983040	5896839	coat,transposase	Bacillus_phage(30.0%)	59	NA	NA
WP_060852384.1|4925262_4926456_-|transposase	IS110-like element ISBth13 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.1	1.5e-24
WP_000953783.1|4928590_4930351_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.9	2.0e-46
WP_000213625.1|4930947_4932387_+	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000423681.1|4932465_4933551_-	DUF3626 domain-containing protein	NA	A0A2H4UV60	Bodo_saltans_virus	23.9	2.5e-07
WP_060852385.1|4933661_4934417_-	glutamate racemase	NA	NA	NA	NA	NA
WP_001053969.1|4934531_4935968_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_001186301.1|4936688_4938113_+	amino acid permease	NA	NA	NA	NA	NA
WP_000021361.1|4938173_4939373_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060852386.1|4939565_4941563_+	catalase	NA	A0A2K9L572	Tupanvirus	51.3	1.7e-150
WP_000037548.1|4941586_4942102_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_162900581.1|4942164_4942314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001063856.1|4942412_4942616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000508206.1|4942667_4943930_-	MFS transporter	NA	NA	NA	NA	NA
WP_000699823.1|4944036_4945776_+	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000789173.1|4945848_4946397_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000511552.1|4946420_4946960_-	ester cyclase	NA	NA	NA	NA	NA
WP_001059470.1|4947129_4947468_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000742953.1|4947501_4948704_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_002025356.1|4948916_4949495_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000539671.1|4949646_4949961_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000796022.1|4949963_4950308_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000288065.1|4950727_4951087_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000878068.1|4951221_4951992_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000686663.1|4952072_4952528_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000446097.1|4952656_4953151_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001146231.1|4953356_4954268_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000897997.1|4954302_4954788_-	PRK06770 family protein	NA	G3MB13	Bacillus_virus	29.1	1.2e-09
WP_001126699.1|4954787_4955189_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_001077751.1|4955342_4955747_-	DoxX family protein	NA	NA	NA	NA	NA
WP_000580626.1|4955899_4956973_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_000711293.1|4957021_4958386_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000892350.1|4958410_4959295_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000648168.1|4959450_4960314_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000704958.1|4960343_4960658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113732246.1|4960782_4961994_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_000838703.1|4962168_4963572_+	amino acid permease	NA	NA	NA	NA	NA
WP_001174838.1|4963600_4963771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000435797.1|4963783_4963987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000375674.1|4964066_4966526_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002164628.1|4966878_4967304_+	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
WP_000525819.1|4967360_4967705_-	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
WP_060852388.1|4967725_4968094_-	DUF3992 domain-containing protein	NA	NA	NA	NA	NA
WP_000435017.1|4968192_4968798_-	DedA family protein	NA	NA	NA	NA	NA
WP_000733844.1|4968815_4969097_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_000557738.1|4969448_4970261_+	Ku protein	NA	A0A249XRB2	Mycobacterium_phage	30.8	3.3e-28
WP_000440994.1|4970279_4971059_-	DUF2935 domain-containing protein	NA	A0A2I2L551	Orpheovirus	35.6	1.8e-39
WP_162837398.1|4971073_4971502_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_000362188.1|4971536_4971752_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_002157501.1|4971748_4972024_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_000265278.1|4972036_4972606_+|coat	spore coat protein CotJC	coat	NA	NA	NA	NA
WP_001260934.1|4972823_4974140_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_000269962.1|4974184_4975189_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000239670.1|4975190_4976057_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000388712.1|4976146_4976881_-	TIGR02206 family membrane protein	NA	NA	NA	NA	NA
WP_000728844.1|4977092_4978196_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000609104.1|4978192_4978867_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	2.1e-36
WP_060852389.1|4978869_4979988_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060852390.1|4980445_4981819_+	SH3 domain-containing protein	NA	J9PQW7	Bacillus_phage	71.8	3.6e-35
WP_085963705.1|4981880_4983040_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	8.7e-38
>prophage 20
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	5087982	5157068	5896839	transposase,head,capsid,integrase,protease,tail,terminase,portal	Bacillus_phage(87.1%)	78	5107104:5107124	5158883:5158903
WP_042884452.1|5087982_5089140_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q331V1	Clostridium_botulinum_C_phage	60.9	9.3e-125
WP_000816203.1|5089136_5089400_-	MerR family transcriptional regulator	NA	Q331V0	Clostridium_botulinum_C_phage	31.5	5.5e-17
WP_060852396.1|5089578_5090871_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	31.4	5.8e-43
WP_001164897.1|5091152_5092544_+	amino acid permease	NA	NA	NA	NA	NA
WP_000791509.1|5092725_5094273_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_060852397.1|5094308_5096030_-	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_000771694.1|5096170_5097472_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_000443143.1|5097724_5099110_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.7	6.4e-64
WP_001249814.1|5099140_5100220_-	YHYH domain-containing protein	NA	NA	NA	NA	NA
WP_085963705.1|5100377_5101537_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	8.7e-38
WP_001041726.1|5101650_5102283_-	class A sortase	NA	NA	NA	NA	NA
WP_001080043.1|5102400_5102874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000154019.1|5102866_5103085_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001105777.1|5103197_5104490_-	cell wall-binding protein	NA	A0A143FNS3	Bacillus_phage	65.5	1.8e-31
WP_000495037.1|5104710_5105652_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.4	7.3e-11
WP_000434794.1|5105788_5106601_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000471238.1|5106780_5107068_+	hypothetical protein	NA	NA	NA	NA	NA
5107104:5107124	attL	ATAAAGTGAAACTTTAATCAG	NA	NA	NA	NA
WP_001268332.1|5107198_5107402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000128025.1|5107573_5108725_+	VanZ family protein	NA	NA	NA	NA	NA
WP_000948959.1|5108778_5110095_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_000373754.1|5110082_5111255_-	amino acid deaminase/aldolase	NA	NA	NA	NA	NA
WP_000730127.1|5111752_5112634_+	helix-turn-helix domain-containing protein	NA	I7ILW0	Bacillus_phage	100.0	1.5e-159
WP_000842173.1|5112638_5113247_-	replication-relaxation family protein	NA	A0A0S2GLL8	Bacillus_phage	100.0	3.3e-113
WP_000511371.1|5113236_5114403_-	DNA translocase FtsK	NA	A0A0S2GLG9	Bacillus_phage	100.0	9.4e-226
WP_000495118.1|5114413_5114734_-	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	100.0	1.9e-51
WP_000467327.1|5115196_5115418_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	100.0	2.9e-35
WP_000423300.1|5115486_5115816_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	100.0	2.4e-54
WP_000542506.1|5115856_5116675_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	100.0	3.2e-164
WP_001076454.1|5116674_5116887_-	hypothetical protein	NA	A0A0S2GM50	Bacillus_phage	100.0	1.4e-34
WP_000151530.1|5116889_5117171_-	hypothetical protein	NA	A0A0S2GM64	Bacillus_phage	100.0	9.1e-42
WP_000822820.1|5117184_5118144_-|integrase	site-specific integrase	integrase	A0A0S2GLC8	Bacillus_phage	99.7	3.1e-182
WP_060852398.1|5118240_5122266_-|tail	tail fiber domain-containing protein	tail	A0A0S2GLH1	Bacillus_phage	99.9	0.0e+00
WP_000232880.1|5122262_5123747_-|tail	phage tail family protein	tail	A0A0S2GLF9	Bacillus_phage	100.0	9.9e-297
WP_038413316.1|5123758_5127685_-|tail	phage tail tape measure protein	tail	A0A0S2GLG8	Bacillus_phage	100.0	0.0e+00
WP_000344048.1|5127699_5127876_-	hypothetical protein	NA	I3WTY5	Bacillus_phage	100.0	1.1e-26
WP_000779042.1|5127905_5128223_-	hypothetical protein	NA	A0A0S2GLH2	Bacillus_phage	100.0	8.9e-54
WP_000896661.1|5128269_5128875_-|tail	tail protein	tail	A0A0S2GLI0	Bacillus_phage	100.0	9.2e-100
WP_060852399.1|5128875_5129235_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	98.3	1.7e-61
WP_000763223.1|5129231_5129669_-	HK97 gp10 family phage protein	NA	A0A0S2GLH3	Bacillus_phage	100.0	7.9e-77
WP_001068030.1|5129661_5129985_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	100.0	1.1e-56
WP_000244586.1|5129971_5130259_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	100.0	1.8e-45
WP_015382182.1|5130279_5131446_-|capsid	phage major capsid protein	capsid	A0A0S2GLG0	Bacillus_phage	100.0	3.3e-210
WP_015382181.1|5131483_5132194_-|protease	Clp protease ClpP	protease	A0A0S2GLD5	Bacillus_phage	100.0	5.5e-128
WP_015382180.1|5132180_5133434_-|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	99.8	3.5e-242
WP_015382179.1|5133622_5135317_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	100.0	0.0e+00
WP_000233388.1|5135318_5135822_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	100.0	8.0e-89
WP_001139459.1|5135950_5136328_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	100.0	6.8e-69
WP_001198493.1|5136317_5136572_-	hypothetical protein	NA	A0A0S2GLL6	Bacillus_phage	100.0	3.9e-44
WP_000778983.1|5136707_5136920_-	hypothetical protein	NA	A0A0S2GM40	Bacillus_phage	100.0	2.7e-30
WP_000002720.1|5136936_5137176_-	hypothetical protein	NA	A0A0S2GLE8	Bacillus_phage	98.7	5.2e-22
WP_000443964.1|5137204_5137390_-	hypothetical protein	NA	A0A0S2GLH7	Bacillus_phage	100.0	8.6e-25
WP_001050326.1|5137438_5138305_-	hypothetical protein	NA	A0A0S2GLF7	Bacillus_phage	100.0	2.8e-166
WP_000792998.1|5138386_5138569_-	hypothetical protein	NA	A0A0S2GLH0	Bacillus_phage	100.0	3.1e-27
WP_015382178.1|5138940_5139186_-	hypothetical protein	NA	A0A0S2GLK0	Bacillus_phage	100.0	9.0e-38
WP_001012176.1|5139392_5139935_-|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	100.0	3.3e-96
WP_015382492.1|5139931_5140417_-	transcription regulator	NA	A0A0S2GLJ9	Bacillus_phage	100.0	7.9e-86
WP_015382275.1|5140444_5140609_-	hypothetical protein	NA	A0A0S2GLH8	Bacillus_phage	100.0	6.5e-16
WP_000965619.1|5140774_5141056_-	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	100.0	8.7e-45
WP_000404184.1|5142464_5142872_-	hypothetical protein	NA	A0A0S2GLF8	Bacillus_phage	100.0	4.9e-73
WP_001098845.1|5143225_5143525_-	hypothetical protein	NA	A0A0S2GLL5	Bacillus_phage	100.0	2.7e-52
WP_000705118.1|5143675_5143975_+	hypothetical protein	NA	A0A0S2GLD6	Bacillus_phage	100.0	1.9e-50
WP_001025406.1|5143971_5144187_-	hypothetical protein	NA	A0A0S2GLC6	Bacillus_phage	100.0	8.7e-37
WP_000817807.1|5144204_5144369_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	100.0	1.0e-24
WP_000436951.1|5144440_5144707_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_002133989.1|5144748_5145561_-	ATP-binding protein	NA	A0A0S2GLK2	Bacillus_phage	100.0	1.2e-155
WP_060852400.1|5145523_5146552_-	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	95.9	9.6e-182
WP_000123128.1|5146775_5147423_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	100.0	1.8e-117
WP_000218620.1|5147697_5148012_-	hypothetical protein	NA	A0A0S2GLB6	Bacillus_phage	100.0	1.1e-51
WP_015382175.1|5148173_5148953_-	phage regulatory protein	NA	A0A0S2GLP8	Bacillus_phage	100.0	1.6e-141
WP_000549466.1|5149178_5149367_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	100.0	3.2e-27
WP_000813892.1|5149399_5149636_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE0	Bacillus_phage	100.0	8.7e-38
WP_000511082.1|5149784_5150129_+	helix-turn-helix transcriptional regulator	NA	I7J6V3	Bacillus_phage	100.0	4.2e-57
WP_000466636.1|5150528_5151767_-	hypothetical protein	NA	I7J4K0	Bacillus_phage	100.0	8.2e-236
WP_000262047.1|5152284_5153385_+|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	100.0	8.6e-205
WP_060852401.1|5153323_5154370_-	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.0	5.3e-87
WP_000730997.1|5154446_5155298_-	phospholipase C	NA	NA	NA	NA	NA
WP_000948210.1|5155551_5155896_-	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_000645827.1|5156015_5157068_-	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
5158883:5158903	attR	ATAAAGTGAAACTTTAATCAG	NA	NA	NA	NA
>prophage 21
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	5475643	5553156	5896839	coat,capsid,plate,integrase,protease,tail,tRNA,terminase,portal	Bacillus_phage(81.63%)	87	5516647:5516679	5554944:5554976
WP_000432509.1|5475643_5476093_-|coat	spore coat protein B	coat	NA	NA	NA	NA
WP_000051525.1|5476113_5476629_-|coat	spore coat protein B	coat	NA	NA	NA	NA
WP_002025240.1|5476864_5477104_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000235476.1|5477290_5477659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001078299.1|5477854_5478904_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000732597.1|5479237_5480158_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002025239.1|5480206_5481247_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000983753.1|5481243_5482251_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000926554.1|5482295_5482937_-	L-fuculose-phosphate aldolase	NA	NA	NA	NA	NA
WP_042884389.1|5482990_5484037_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_000033076.1|5484046_5485276_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_000924420.1|5485866_5486430_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_000599501.1|5486444_5487971_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	30.8	1.2e-18
WP_060852430.1|5488011_5488758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005624.1|5488761_5489370_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000853516.1|5489645_5490761_-	M20 peptidase aminoacylase family protein	NA	NA	NA	NA	NA
WP_060852431.1|5490943_5492365_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_000972800.1|5492353_5493625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000704479.1|5493718_5494828_+	dipeptide epimerase	NA	Q6A202	Oenococcus_phage	25.1	3.3e-18
WP_000217548.1|5494842_5495538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233754.1|5495757_5496465_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_001251703.1|5496560_5497079_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	36.5	5.6e-21
WP_000566708.1|5497430_5498420_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_000105024.1|5498581_5499958_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.7	6.5e-117
WP_060852432.1|5500383_5501580_+	pyrimidine nucleoside transporter NupC	NA	NA	NA	NA	NA
WP_000875591.1|5501626_5502334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233731.1|5502871_5503954_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000007349.1|5504070_5505300_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000915109.1|5505345_5505837_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_000263262.1|5505969_5506293_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_060852433.1|5506340_5507792_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000225136.1|5507784_5509152_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_001093019.1|5509267_5510632_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_060852434.1|5510786_5511530_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_060852435.1|5511670_5512576_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.5	1.2e-26
WP_001047685.1|5513133_5514561_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000051433.1|5514575_5516033_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_000086999.1|5516048_5516339_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
5516647:5516679	attL	ATACCTGAAAGCGCACAAACAAATGAAGTCCAT	NA	NA	NA	NA
WP_060852436.1|5517017_5517893_+	cytosolic protein	NA	I7ILW0	Bacillus_phage	73.5	2.1e-105
WP_060852437.1|5517895_5518504_-	replication-relaxation family protein	NA	A0A0S2GLL8	Bacillus_phage	80.1	1.2e-91
WP_060852438.1|5518493_5519660_-	DNA translocase FtsK	NA	W8CYG2	Bacillus_phage	80.7	1.2e-183
WP_060852439.1|5519670_5519991_-	hypothetical protein	NA	A0A0S2GLK1	Bacillus_phage	67.9	6.1e-34
WP_060852440.1|5520456_5520681_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P883	Bacillus_phage	78.4	7.7e-28
WP_060852441.1|5521271_5521469_+	hypothetical protein	NA	A0A1B0T6A3	Bacillus_phage	86.2	4.9e-18
WP_060852442.1|5521561_5522260_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	63.5	1.4e-107
WP_060852549.1|5522259_5522466_-	hypothetical protein	NA	D2XR32	Bacillus_phage	86.4	9.3e-28
WP_060852443.1|5522474_5522756_-	hypothetical protein	NA	D2XR31	Bacillus_phage	75.8	6.5e-32
WP_060852444.1|5522827_5524009_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	70.9	5.3e-152
WP_060852445.1|5524023_5526366_-|tail	phage tail protein	tail	A0A1C8E983	Bacillus_phage	88.8	0.0e+00
WP_060852446.1|5526362_5527046_-|tail	phage tail family protein	tail	A0A1C8EA72	Bacillus_phage	80.1	6.1e-108
WP_081097603.1|5527047_5531058_-	hypothetical protein	NA	Q0H230	Geobacillus_phage	54.3	4.1e-127
WP_060852447.1|5531225_5531693_-	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	35.3	1.1e-18
WP_060852448.1|5531713_5532298_-	hypothetical protein	NA	A0A1B1P778	Bacillus_phage	56.0	1.8e-55
WP_060852449.1|5532303_5532726_-	hypothetical protein	NA	R4IBU7	Listeria_phage	37.7	1.1e-19
WP_060852450.1|5532715_5533102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852451.1|5533091_5533442_-	hypothetical protein	NA	A0A1B1P760	Bacillus_phage	63.4	2.4e-31
WP_060852452.1|5533422_5533719_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	96.9	5.8e-47
WP_088025150.1|5533711_5533807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852453.1|5533859_5535023_-|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	42.2	8.0e-84
WP_060852454.1|5535064_5535775_-|protease	Clp protease ClpP	protease	A0A2H4JC91	uncultured_Caudovirales_phage	50.2	1.2e-53
WP_060852455.1|5535761_5536928_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	82.9	3.3e-186
WP_060852456.1|5536942_5538598_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	81.1	1.2e-271
WP_060852457.1|5538590_5538905_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	57.7	2.2e-20
WP_060852458.1|5539011_5539317_-	hypothetical protein	NA	A0A1B1P767	Bacillus_phage	89.4	3.6e-44
WP_060852550.1|5539319_5539667_-	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	51.3	1.4e-23
WP_060852459.1|5539672_5539897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046648212.1|5539903_5540128_-	hypothetical protein	NA	A0A1B1P745	Bacillus_phage	70.3	9.2e-21
WP_060852460.1|5540117_5540546_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	53.3	8.5e-07
WP_060852461.1|5540586_5540805_-	cell division protein FtsK	NA	A0A1B1P7C1	Bacillus_phage	40.0	5.1e-08
WP_001028515.1|5541419_5541962_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	100.0	1.5e-96
WP_001041469.1|5541958_5542429_-	hypothetical protein	NA	A0A1B1P744	Bacillus_phage	99.4	5.5e-84
WP_000866143.1|5542449_5542620_-	hypothetical protein	NA	A0A1B1P735	Bacillus_phage	100.0	2.5e-10
WP_171840933.1|5543516_5543666_-	hypothetical protein	NA	W8CYP0	Bacillus_phage	83.3	4.2e-14
WP_060852462.1|5544284_5544887_-	hypothetical protein	NA	A0A0F6SJ62	Sinorhizobium_phage	31.5	2.1e-19
WP_060852463.1|5544925_5545324_-	hypothetical protein	NA	A0A0E3D9K2	Bacillus_phage	94.7	7.5e-66
WP_000817805.1|5545551_5545716_-	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	85.2	9.6e-20
WP_060852464.1|5545766_5546033_-	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	98.9	6.6e-42
WP_060852465.1|5546074_5546887_-	ATP-binding protein	NA	W8CZ50	Bacillus_phage	98.1	3.3e-153
WP_060852466.1|5546849_5547866_-	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	97.6	2.4e-185
WP_060852468.1|5548108_5548756_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	96.3	3.0e-112
WP_060852470.1|5549506_5550286_-	ORF6C domain-containing protein	NA	A0A0S2GLP8	Bacillus_phage	99.2	6.9e-140
WP_000788399.1|5550331_5550487_-	hypothetical protein	NA	I7J4K2	Bacillus_phage	96.1	2.6e-22
WP_060852471.1|5550511_5550700_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	82.3	8.5e-20
WP_060852551.1|5550721_5550952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852472.1|5551173_5551503_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	89.9	1.3e-47
WP_171840958.1|5551786_5551936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081097605.1|5551935_5553156_-	hypothetical protein	NA	H0UST6	Bacillus_phage	67.0	2.1e-135
5554944:5554976	attR	ATACCTGAAAGCGCACAAACAAATGAAGTCCAT	NA	NA	NA	NA
>prophage 22
NZ_AP014864	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain	5896839	5557939	5689862	5896839	transposase,head,capsid,integrase,protease,tail,terminase,tRNA,portal	Bacillus_phage(13.95%)	105	5624906:5624923	5637702:5637719
WP_060851554.1|5557939_5559151_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	37.9	4.4e-69
WP_000721599.1|5559468_5560323_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001261870.1|5560344_5561010_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060852474.1|5560999_5562019_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	2.1e-32
WP_000844925.1|5562491_5563037_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000259555.1|5563307_5564855_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_060852475.1|5565009_5565780_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_000717030.1|5565876_5567073_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_000031450.1|5567089_5569099_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.7	1.5e-125
WP_060852553.1|5569113_5571363_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.2	6.0e-136
WP_000272098.1|5571375_5572065_-	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000812346.1|5572402_5572780_+	DUF2892 domain-containing protein	NA	NA	NA	NA	NA
WP_000660669.1|5572999_5573845_+	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_001085171.1|5573860_5574025_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001101965.1|5574061_5575333_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000745438.1|5575598_5577134_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	53.3	5.1e-78
WP_000088589.1|5577158_5577746_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
WP_001262439.1|5577742_5578783_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000879025.1|5578888_5580304_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_000055544.1|5580288_5582508_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.3	6.7e-164
WP_000666786.1|5582491_5583175_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|5583171_5583426_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170544.1|5583418_5584138_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000625682.1|5584226_5585534_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_000196814.1|5585530_5586682_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000839365.1|5586678_5587164_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.9	6.6e-24
WP_060852476.1|5593240_5595172_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_000275580.1|5595287_5596583_+|transposase	IS21-like element IS232 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	28.8	5.3e-12
WP_000798699.1|5596572_5597325_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000651231.1|5597427_5598204_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230820.1|5598242_5599187_-	GDP-mannose 4,6-dehydratase	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	31.3	2.1e-26
WP_000790044.1|5599479_5600274_+	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	50.8	1.4e-66
WP_000405122.1|5600492_5601215_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001031897.1|5601242_5602115_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000690976.1|5602338_5603415_+	glycoside hydrolase family 99-like domain-containing protein	NA	NA	NA	NA	NA
WP_000651997.1|5608691_5609405_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	1.3e-36
WP_000845331.1|5609394_5610408_+	HAMP domain-containing histidine kinase	NA	A0A2K9L4R6	Tupanvirus	23.4	2.1e-08
WP_000074581.1|5610476_5611406_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.8	3.0e-41
WP_000247711.1|5611398_5612136_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_060852477.1|5612153_5612951_+	undecaprenyl-diphosphate phosphatase UppP	NA	NA	NA	NA	NA
WP_060852478.1|5613305_5613764_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000719204.1|5618915_5620421_-	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.3	9.2e-32
WP_000929885.1|5620404_5621106_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_000833082.1|5621250_5622576_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	30.1	6.4e-45
5624906:5624923	attL	TTACATCATTCCGCCCAT	NA	NA	NA	NA
WP_060852479.1|5625217_5625427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852480.1|5625439_5625769_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_060852481.1|5625785_5627426_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	51.9	1.4e-158
WP_060852482.1|5627430_5627778_-	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	41.2	7.3e-17
WP_060852483.1|5627902_5628193_-	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	51.1	1.4e-24
WP_060852484.1|5628185_5628473_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0A7RWM0	Clostridium_phage	31.9	3.7e-06
WP_060852485.1|5628540_5629803_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_060852486.1|5629807_5630386_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBP9	Clostridium_phage	30.2	2.6e-11
WP_060852487.1|5630382_5631582_-|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	38.9	1.8e-67
WP_060852488.1|5631631_5631862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852489.1|5632194_5634624_-	DUF927 domain-containing protein	NA	Q4ZE73	Staphylococcus_phage	32.7	2.6e-84
WP_060852490.1|5634725_5635031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171840959.1|5635037_5635184_-	hypothetical protein	NA	A0A1B2APZ0	Phage_Wrath	71.1	6.8e-09
WP_060852491.1|5635320_5635590_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060852492.1|5635811_5636396_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060852493.1|5636444_5637623_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	62.4	2.6e-138
WP_001029993.1|5637701_5639336_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
5637702:5637719	attR	TTACATCATTCCGCCCAT	NA	NA	NA	NA
WP_000917311.1|5639374_5639659_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_000745324.1|5640048_5640798_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001246201.1|5640794_5640986_+	YdiK family protein	NA	NA	NA	NA	NA
WP_000372699.1|5641015_5641645_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002040561.1|5641778_5643758_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	2.8e-52
WP_000414585.1|5644238_5645255_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.4	1.9e-68
WP_000367190.1|5645254_5645698_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000865740.1|5645711_5646404_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000049642.1|5646384_5646858_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_000344234.1|5653352_5653811_-	SprT family protein	NA	NA	NA	NA	NA
WP_001143642.1|5654006_5654123_+	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_000426244.1|5654180_5656349_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_000635963.1|5656416_5656767_-	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	4.9e-13
WP_000004570.1|5656771_5657059_-	antitoxin EndoAI	NA	NA	NA	NA	NA
WP_000390615.1|5657367_5658537_-	alanine racemase	NA	NA	NA	NA	NA
WP_002004297.1|5658654_5659605_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000583416.1|5659761_5660121_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_000586917.1|5660214_5660787_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_000961164.1|5660779_5661742_-	UV DNA damage repair endonuclease UvsE	NA	NA	NA	NA	NA
WP_085963705.1|5661852_5663012_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	8.7e-38
WP_000206592.1|5663128_5664730_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	37.2	1.7e-68
WP_000595959.1|5665035_5666412_-	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_000161427.1|5666474_5667560_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_060852494.1|5667788_5669060_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	24.5	9.6e-14
WP_000809361.1|5669168_5670584_-	amino acid permease	NA	NA	NA	NA	NA
WP_013141710.1|5670815_5671988_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000674004.1|5671953_5672910_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000810922.1|5672976_5674095_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_001083689.1|5674488_5674599_-	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000654250.1|5674642_5674759_-	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000654250.1|5674793_5674910_-	DUF3948 family protein	NA	NA	NA	NA	NA
WP_000664237.1|5674944_5675052_-	DUF3948 family protein	NA	NA	NA	NA	NA
WP_025988984.1|5675096_5675213_-	DUF3948 family protein	NA	NA	NA	NA	NA
WP_060852495.1|5675645_5676518_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001294518.1|5676552_5677518_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.2	1.5e-19
WP_000030789.1|5677514_5678495_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.1	7.1e-17
WP_000451077.1|5678505_5679426_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_060852496.1|5679936_5681373_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_060852497.1|5682164_5683892_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000369254.1|5684261_5684459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145977420.1|5684850_5686782_-	ABC-F type ribosomal protection protein	NA	Q6DMX7	Streptococcus_phage	32.9	3.8e-46
WP_002023099.1|5687411_5687540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852499.1|5687675_5688437_+	DUF4931 domain-containing protein	NA	NA	NA	NA	NA
WP_085961003.1|5688507_5689862_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	85.5	7.3e-129
>prophage 1
NZ_AP014865	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence	437451	10811	80434	437451	integrase,transposase	Enterobacteria_phage(16.67%)	43	17876:17892	45028:45044
WP_060852562.1|10811_12386_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.7	1.5e-21
WP_060852563.1|12397_13177_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	32.2	3.3e-33
WP_060852564.1|14518_15028_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_060852565.1|15008_16025_+	anti sigma factor C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001053969.1|16474_17911_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
17876:17892	attL	AAATAGTTGTAATTCAT	NA	NA	NA	NA
WP_000444120.1|22378_23059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000793411.1|23060_23237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852566.1|23963_25124_+	serine hydrolase	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	25.1	1.9e-16
WP_000395068.1|27133_27307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204525.1|29509_29698_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000189814.1|30716_31718_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_060852568.1|32121_33315_+|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	23.7	9.0e-06
WP_060852569.1|33601_34897_-	amino acid permease	NA	NA	NA	NA	NA
WP_000372880.1|35047_35488_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_060852570.1|36411_37110_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_060852571.1|37131_38022_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_060852572.1|38304_39624_+	septum formation initiator	NA	NA	NA	NA	NA
WP_000196515.1|39978_40278_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_145977432.1|40893_41481_-	TetR/AcrR family transcriptional regulator C-terminal ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000064490.1|41838_43029_+	MFS transporter	NA	NA	NA	NA	NA
WP_042884146.1|44290_44899_+	Fic family protein	NA	NA	NA	NA	NA
WP_060852573.1|45314_48197_+	collagenase ColA	NA	NA	NA	NA	NA
45028:45044	attR	ATGAATTACAACTATTT	NA	NA	NA	NA
WP_000364215.1|49123_49534_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000116992.1|49682_51113_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000275580.1|54224_55520_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|55509_56262_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_060852575.1|57788_60518_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_060852576.1|60987_61569_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060852577.1|61664_62534_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025687304.1|63112_64714_+	S-layer homology domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	54.9	5.0e-44
WP_016078303.1|65985_66384_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.2	1.2e-50
WP_060852578.1|66395_67508_+	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	48.6	6.1e-81
WP_000582596.1|70136_70769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852580.1|70765_71401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000828156.1|71697_72081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852581.1|72097_72736_+	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	37.4	4.0e-21
WP_088010471.1|73025_73775_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001154000.1|73926_74085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000287794.1|75137_75923_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.5	3.9e-26
WP_000353530.1|75939_76797_-	glucose transporter GlcU	NA	NA	NA	NA	NA
WP_000210393.1|77855_78149_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001206765.1|78696_79110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852582.1|80035_80434_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.2	1.2e-50
>prophage 2
NZ_AP014865	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence	437451	138147	249481	437451	protease,transposase	Tupanvirus(33.33%)	58	NA	NA
WP_060852598.1|138147_139266_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.9	2.9e-171
WP_060852599.1|139725_140712_-	choloylglycine hydrolase family protein	NA	M1I458	Paramecium_bursaria_Chlorella_virus	32.3	3.0e-31
WP_000472915.1|141562_141988_-	DUF4879 domain-containing protein	NA	NA	NA	NA	NA
WP_060852600.1|142573_144043_+	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_081097637.1|144733_145654_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000725626.1|146044_146491_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001039025.1|146949_148038_-	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_000743455.1|148311_149442_-	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_001053955.1|150210_151647_-|transposase	IS4-like element IS231A family transposase	transposase	NA	NA	NA	NA
WP_000798699.1|153972_154725_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000275580.1|154714_156010_-|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000416178.1|156326_156494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852602.1|157002_157644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000947505.1|157905_158157_-	DUF2164 family protein	NA	NA	NA	NA	NA
WP_060852603.1|158296_159070_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002164693.1|159202_160171_-	2,3-diaminopropionate biosynthesis protein SbnB	NA	NA	NA	NA	NA
WP_000914216.1|160198_161176_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	C3U2M1	Lactococcus_phage	29.2	4.4e-27
WP_001007707.1|161340_162273_-	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	28.1	1.6e-18
WP_140165520.1|162745_162961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028932.1|163064_163763_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_060852604.1|163997_170534_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.6	3.8e-183
WP_060852688.1|170775_171495_-	thioesterase	NA	NA	NA	NA	NA
WP_060852605.1|171550_176047_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.7	1.7e-81
WP_000031546.1|176028_177108_-	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_060852606.1|177104_180188_-	cyclic peptide export ABC transporter	NA	A0A2P1JQM9	Mycobacterium_phage	28.1	2.8e-11
WP_000608548.1|180203_181280_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_060852607.1|181298_188987_-	hybrid non-ribosomal peptide synthetase/type I polyketide synthase	NA	A0A2K9KZV5	Tupanvirus	26.1	1.3e-94
WP_025686627.1|188961_190539_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	32.1	4.4e-69
WP_060852608.1|190535_191729_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001152970.1|191728_191974_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_060852609.1|192004_192853_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_060852610.1|192893_194111_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_060852611.1|194130_195258_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_060852612.1|195254_196403_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000368639.1|196399_196663_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_060852613.1|196695_199350_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_060852614.1|199669_205393_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.4	7.3e-170
WP_060852615.1|205419_215430_-	type I polyketide synthase	NA	D0R7J2	Paenibacillus_phage	35.2	6.1e-63
WP_060852616.1|216671_217067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102753.1|217357_217711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852617.1|217726_220615_-	S-layer protein	NA	NA	NA	NA	NA
WP_060852618.1|220940_228533_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	28.5	1.7e-166
WP_060852619.1|228898_229825_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_060852620.1|230309_231767_+	2,4-diaminobutyrate decarboxylase	NA	NA	NA	NA	NA
WP_001019438.1|231867_232512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001056472.1|233351_233762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001105577.1|233889_234108_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060852621.1|234253_234580_+	helix-turn-helix transcriptional regulator	NA	A0A0A7RTK4	Clostridium_phage	55.9	4.8e-10
WP_000289919.1|235323_235719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000284559.1|237430_237733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852622.1|238158_238725_-	acyltransferase	NA	NA	NA	NA	NA
WP_060852623.1|238717_239848_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_060852624.1|239867_242426_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.8	6.8e-11
WP_000787392.1|242602_243394_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_060852625.1|243759_244881_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	82.6	3.3e-175
WP_060852626.1|245397_245610_-	transcriptional regulator	NA	A0A1Z1LZP5	Bacillus_phage	65.7	2.6e-17
WP_060852627.1|246154_246823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053969.1|248044_249481_+|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_AP014866	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK2, complete sequence	293217	82343	222571	293217	holin,protease,integrase,bacteriocin,transposase	Bacillus_phage(31.25%)	112	118464:118483	144297:144316
WP_001098031.1|82343_83279_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_000502626.1|83368_83638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000869334.1|83751_83955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180021.1|84011_84197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001216652.1|84313_84733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233517.1|84799_85150_+	PrgI family protein	NA	NA	NA	NA	NA
WP_000892000.1|85150_86065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016090237.1|86067_88176_+	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000890337.1|88206_92226_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000108316.1|93891_95697_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.1	5.5e-31
WP_001149935.1|96705_98529_+	maturase	NA	A0A0U4J920	Pseudomonas_phage	33.8	2.5e-23
WP_014481869.1|98688_99564_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A7KUS1	Bacillus_phage	38.3	3.5e-15
WP_000757464.1|99580_100156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001242518.1|100317_100701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000104242.1|100697_100997_+	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_000659905.1|101125_101434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343609.1|101473_102199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852695.1|102249_102495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001065855.1|102826_103510_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001186844.1|103966_105112_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_000725572.1|105152_105635_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000523962.1|106245_107592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000025329.1|107591_108020_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_060852696.1|108332_109406_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	43.9	3.0e-77
WP_000802626.1|109656_111147_+	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_000888766.1|112126_112378_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_000364215.1|112729_113140_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000169374.1|114851_116159_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	8.6e-26
WP_001053969.1|116955_118392_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
118464:118483	attL	TTCTTAAGTTGATGGGCATG	NA	NA	NA	NA
WP_000351941.1|119279_120179_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000020440.1|120301_120889_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_000921229.1|120903_121833_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000650425.1|122261_123236_-	DUF4179 domain-containing protein	NA	NA	NA	NA	NA
WP_000955500.1|123239_123770_-	RNA polymerase sigma factor SigX	NA	NA	NA	NA	NA
WP_000898260.1|124313_124553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000417392.1|124605_124857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001154608.1|125075_125450_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	52.5	4.8e-30
WP_053512450.1|125498_125840_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_000272577.1|125836_127102_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.7	4.2e-102
WP_001053969.1|127910_129347_-|transposase	IS4-like element IS231C family transposase	transposase	NA	NA	NA	NA
WP_000914524.1|129451_129967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043935.1|130456_130729_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	68.9	3.3e-25
WP_031303430.1|130975_131170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014481865.1|131444_131585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000843046.1|131651_131930_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	2.3e-13
WP_000475295.1|132631_134275_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060852697.1|134481_134670_+	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	51.9	7.0e-06
WP_060852562.1|134736_136311_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.7	1.5e-21
WP_060852563.1|136322_137102_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	32.2	3.3e-33
WP_000734601.1|138325_138478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019020.1|138810_139137_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	51.0	2.4e-22
WP_001021539.1|139350_140394_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.1	1.2e-09
WP_000149389.1|140625_140976_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000121085.1|140997_141510_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000346798.1|142093_142258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053955.1|142751_144188_+|transposase	IS4-like element IS231A family transposase	transposase	NA	NA	NA	NA
WP_000532004.1|144390_145695_+	WXG100 family type VII secretion target	NA	NA	NA	NA	NA
144297:144316	attR	TTCTTAAGTTGATGGGCATG	NA	NA	NA	NA
WP_000128275.1|145717_145936_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000790837.1|146009_146402_-	DUF4878 domain-containing protein	NA	NA	NA	NA	NA
WP_001236345.1|146757_147987_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.4	4.5e-85
WP_000997955.1|148717_149467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065268.1|149754_149979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033679476.1|150158_150989_+	SEC-C motif-containing protein	NA	NA	NA	NA	NA
WP_171840965.1|151072_151237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000737575.1|151360_151498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103226.1|151494_152589_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	48.8	1.5e-92
WP_000844156.1|152933_153182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000845491.1|153318_153528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032039.1|154080_154380_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060852698.1|154946_155981_+	exosporium leader peptide-containing protein	NA	NA	NA	NA	NA
WP_000364215.1|156403_156814_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000116992.1|156962_158393_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_014481859.1|159202_159739_+	ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_014481860.1|159698_160010_+	mono-ADP-ribosyltransferase C3 (Exoenzyme C3)	NA	NA	NA	NA	NA
WP_001053955.1|160423_161860_-|transposase	IS4-like element IS231A family transposase	transposase	NA	NA	NA	NA
WP_000520933.1|162285_163158_-	DMT family transporter	NA	NA	NA	NA	NA
WP_060852699.1|163303_164731_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000116992.1|165168_166599_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000364215.1|166747_167158_-	DUF1878 family protein	NA	NA	NA	NA	NA
WP_000892197.1|168283_168706_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	77.3	1.3e-52
WP_033679389.1|169066_169318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852700.1|171440_171944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852701.1|172110_172914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852702.1|173003_174905_+	pesticidal protein Cry2Ab	NA	NA	NA	NA	NA
WP_000555978.1|176965_177598_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_000591046.1|177612_178638_+	macro domain-containing protein	NA	A0A0B4N0V6	Escherichia_phage	40.4	9.1e-23
WP_014481901.1|178803_179910_+	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.4	2.0e-07
WP_060852703.1|182801_186314_-	pesticidal protein	NA	NA	NA	NA	NA
WP_060852704.1|186622_187579_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	39.8	9.6e-51
WP_001053956.1|189371_190808_+|transposase	IS4-like element IS231B family transposase	transposase	NA	NA	NA	NA
WP_000275580.1|191015_192311_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|192300_193053_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_000704745.1|194348_195515_-	nucleotide sugar dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	52.1	1.4e-107
WP_014481840.1|195797_198815_-	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	28.0	4.1e-39
WP_003275306.1|198811_200059_-	MFS transporter	NA	A0A1B0RXG2	Streptococcus_phage	25.1	9.4e-06
WP_000560325.1|200386_201514_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_000412005.1|201510_202521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000028781.1|202501_203743_-	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_060852706.1|203726_204749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000660942.1|204956_205823_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_000644939.1|205819_206680_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_000700965.1|206676_207447_+	coenzyme F420-0:L-glutamate ligase	NA	NA	NA	NA	NA
WP_000021282.1|207773_208004_-	hypothetical protein	NA	A0A217ERD4	Bacillus_phage	51.8	2.2e-06
WP_167374445.1|208028_208382_-	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_048520037.1|208672_208882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595411.1|209348_210455_-	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	47.5	1.3e-78
WP_015413263.1|210466_210865_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	69.7	3.1e-51
WP_001043946.1|211315_211588_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.8	1.8e-23
WP_060852707.1|212350_212674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081097649.1|212780_213638_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	45.4	6.2e-33
WP_000169374.1|216587_217895_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	8.6e-26
WP_060852709.1|219622_222571_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	26.7	1.4e-79
>prophage 2
NZ_AP014866	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK2, complete sequence	293217	252682	262314	293217	transposase	Lactococcus_phage(33.33%)	7	NA	NA
WP_015406625.1|252682_253801_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.5	3.0e-173
WP_000275580.1|254162_255458_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|255447_256200_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_087874946.1|256790_257949_+|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000929144.1|258391_258688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762722.1|259936_260341_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	67.6	6.5e-41
WP_087986228.1|260753_262314_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	57.6	4.9e-68
>prophage 1
NZ_AP014867	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK3, complete sequence	130548	24773	91097	130548	transposase	Bacillus_phage(29.41%)	47	NA	NA
WP_060852562.1|24773_26348_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.7	1.5e-21
WP_171840967.1|27625_28549_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000169374.1|29053_30361_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	8.6e-26
WP_060852728.1|32621_32972_-	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_060852729.1|35461_36820_-	hypothetical protein	NA	A0A1V0E017	Clostridioides_phage	25.4	1.1e-07
WP_060852730.1|36974_39695_-	RICIN domain-containing protein	NA	A0A1V0E026	Clostridioides_phage	31.5	5.3e-86
WP_060852731.1|39732_41913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852732.1|43401_44691_-	VanW family protein	NA	NA	NA	NA	NA
WP_060852733.1|44859_45708_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_060852734.1|46021_47473_+	spore germination protein	NA	NA	NA	NA	NA
WP_060852735.1|47469_48546_+	endospore germination permease	NA	NA	NA	NA	NA
WP_060852736.1|48545_49646_+	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_081097662.1|50537_51290_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000275580.1|52349_53645_+|transposase	IS21-like element IS232 family transposase	transposase	A0A059NT83	Lactococcus_phage	31.0	1.0e-42
WP_000798699.1|53634_54387_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	47.3	7.0e-57
WP_171840968.1|54707_55916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081097657.1|57114_58545_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_060852738.1|60495_62139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153598656.1|62887_63034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171840969.1|63505_63670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852739.1|64225_64738_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_145977436.1|64759_65116_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_060852741.1|66592_66919_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	52.1	1.1e-22
WP_171840970.1|67251_67407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852742.1|67403_68627_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	66.1	1.8e-150
WP_060852743.1|68826_70470_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000843047.1|71114_71393_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	59.0	3.0e-13
WP_003308768.1|71729_71924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852744.1|72169_72442_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	65.6	4.1e-23
WP_060852745.1|73492_74551_-	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.5	6.7e-21
WP_060852746.1|74580_74991_-	type II toxin-antitoxin system MqsR family toxin	NA	NA	NA	NA	NA
WP_060852562.1|75313_76888_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	27.7	1.5e-21
WP_060852563.1|76899_77679_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	32.2	3.3e-33
WP_060852747.1|78084_79350_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.0	1.2e-101
WP_060852748.1|79346_79688_+	YolD-like family protein	NA	NA	NA	NA	NA
WP_060852749.1|79736_80111_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	50.8	8.1e-30
WP_033699747.1|80331_80583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852750.1|80902_82018_-	RapH N-terminal domain-containing protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.3	4.3e-95
WP_060852751.1|82322_83015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060852752.1|83283_83718_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_060852753.1|83714_84137_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_060852754.1|84403_85039_-	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	36.6	2.7e-09
WP_060852755.1|85303_86215_-	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_060852756.1|86419_87193_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_171840971.1|87313_87472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852757.1|88133_88616_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_060852758.1|89660_91097_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_AP014869	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK5, complete sequence	23773	9064	23499	23773	transposase	Bacillus_phage(33.33%)	15	NA	NA
WP_000538375.1|9064_12028_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.2	4.1e-201
WP_000721624.1|12374_12515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016099414.1|12561_13719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002084061.1|14212_14533_+	helix-turn-helix transcriptional regulator	NA	A0A139ZPI6	Marinitoga_camini_virus	57.1	3.1e-06
WP_060852786.1|14710_15307_+	DUF4236 domain-containing protein	NA	F6K8R9	Clostridium_phage	43.7	2.2e-05
WP_000377660.1|15592_15754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060852787.1|15890_16151_-	RNA chaperone Hfq	NA	D2XQ08	Bacillus_virus	78.0	4.2e-33
WP_145977397.1|16237_17433_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	36.7	3.4e-37
WP_060852788.1|17841_18804_+	helix-turn-helix domain-containing protein	NA	A0A2H4J2N5	uncultured_Caudovirales_phage	43.2	1.0e-12
WP_060852789.1|18818_19496_+	hypothetical protein	NA	A0A0A7AR45	Bacillus_phage	44.7	1.2e-47
WP_153598626.1|19525_20119_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_001246648.1|20184_20463_+	hypothetical protein	NA	A0A0A7AQY6	Bacillus_phage	72.5	5.8e-33
WP_060852790.1|21165_21375_-	preprotein translocase	NA	NA	NA	NA	NA
WP_060852791.1|21679_22294_+	DUF3967 domain-containing protein	NA	NA	NA	NA	NA
WP_060852792.1|22488_23499_+	plasmid segregation protein ParM	NA	A0A2H4IZP5	uncultured_Caudovirales_phage	28.2	9.2e-28
>prophage 1
NZ_AP014870	Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK6	14827	352	14119	14827		Bacillus_phage(100.0%)	23	NA	NA
WP_060852795.1|352_3049_+	hypothetical protein	NA	S5Z7F3	Bacillus_phage	94.7	0.0e+00
WP_016124063.1|3413_4211_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A160LKP9	Bacillus_phage	99.6	5.6e-137
WP_060852796.1|4212_5100_-	hypothetical protein	NA	Q5ILA2	Bacillus_phage	51.7	7.2e-85
WP_060852797.1|5103_6012_-	hypothetical protein	NA	Q5ILA3	Bacillus_phage	79.1	6.9e-115
WP_021729042.1|6024_6537_-	hypothetical protein	NA	Q5ILA4	Bacillus_phage	99.4	8.7e-91
WP_060852798.1|6484_7237_-	glucosaminidase domain-containing protein	NA	Q5ILA5	Bacillus_phage	97.6	2.3e-132
WP_060852799.1|7236_7851_-	hypothetical protein	NA	A0A160LKP5	Bacillus_phage	95.1	9.8e-73
WP_021729040.1|7854_8130_-	hypothetical protein	NA	Q5ILA7	Bacillus_phage	97.8	1.1e-47
WP_023901799.1|8143_8290_-	hypothetical protein	NA	Q5ILA8	Bacillus_phage	97.9	6.1e-18
WP_023901798.1|8286_8463_-	hypothetical protein	NA	Q5ILA9	Bacillus_phage	98.3	5.0e-22
WP_060852800.1|8459_8927_-	hypothetical protein	NA	Q5ILB0	Bacillus_phage	97.9	2.3e-18
WP_000339993.1|9000_9207_-	hypothetical protein	NA	A0A160LKQ4	Bacillus_phage	100.0	2.5e-12
WP_021729037.1|9210_9441_-	hypothetical protein	NA	Q5ILB3	Bacillus_phage	97.4	1.0e-35
WP_060852801.1|9482_10553_-	hypothetical protein	NA	A0A160LKS4	Bacillus_phage	90.4	2.7e-187
WP_060852802.1|10552_10855_-	hypothetical protein	NA	Q5ILB5	Bacillus_phage	77.0	2.2e-33
WP_171840974.1|10856_10997_-	hypothetical protein	NA	Q5ILB6	Bacillus_phage	91.3	1.9e-16
WP_023901797.1|11013_11154_-	hypothetical protein	NA	Q5ILB8	Bacillus_phage	95.7	4.2e-16
WP_060852808.1|11168_11807_-	hypothetical protein	NA	A0A161J814	Bacillus_phage	96.2	2.5e-119
WP_060852803.1|11872_12457_-	hypothetical protein	NA	A0A160LKS6	Bacillus_phage	79.3	5.1e-55
WP_060852804.1|12444_12813_-	hypothetical protein	NA	Q5ILC3	Bacillus_phage	91.0	9.2e-10
WP_060852805.1|12787_13054_-	hypothetical protein	NA	S5YPF7	Bacillus_phage	62.8	6.8e-23
WP_060852806.1|13186_13525_-	helix-turn-helix domain-containing protein	NA	S5Y6I2	Bacillus_phage	79.5	4.4e-43
WP_060852809.1|13555_14119_-	hypothetical protein	NA	S5Z7C9	Bacillus_phage	80.6	5.2e-81
