The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_AP014821	Geminocystis sp. NIES-3709	4150181	869263	938432	4150181	transposase	Streptococcus_phage(20.0%)	52	NA	NA
WP_066115324.1|869263_870529_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_066116431.1|870853_872581_+	flavin reductase	NA	NA	NA	NA	NA
WP_082712913.1|872842_873682_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_066116433.1|873815_875201_-	flavin monoamine oxidase family protein	NA	T2AWI2	Cannes_8_virus	35.7	3.6e-06
WP_066116435.1|875515_888790_-	hypothetical protein	NA	A0A2L0UZ53	Agrobacterium_phage	25.8	4.3e-16
WP_066116437.1|889421_891146_+	carbamoyltransferase	NA	A0A1B1IVF2	uncultured_Mediterranean_phage	35.2	1.8e-55
WP_066116439.1|891275_891704_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_066121704.1|892035_892389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071828008.1|892465_892675_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_066116441.1|892703_893549_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_066116442.1|894090_894432_+	DUF1830 domain-containing protein	NA	NA	NA	NA	NA
WP_066116444.1|894836_895589_+	metal ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	4.0e-12
WP_066116446.1|895681_896551_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_066116448.1|896848_898501_+	acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	26.9	3.1e-49
WP_066116450.1|898686_899523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066116452.1|899748_902754_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_066116454.1|903173_903890_-	DUF1698 domain-containing protein	NA	NA	NA	NA	NA
WP_066116456.1|904072_905881_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.0	7.4e-28
WP_066116457.1|905931_907359_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_066116459.1|907445_908660_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_066116461.1|908662_909394_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_066116462.1|909437_910106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066116464.1|910095_911523_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_066116466.1|911587_912451_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_066116468.1|912645_913995_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	35.1	3.9e-74
WP_066116470.1|914468_916304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066116472.1|916387_917455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066116475.1|917477_918368_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_066116477.1|918462_919863_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_066116481.1|920132_920576_+	OstA family protein	NA	NA	NA	NA	NA
WP_066116483.1|920663_921392_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	1.5e-19
WP_066116486.1|921397_922555_+	YjgP/YjgQ family permease	NA	NA	NA	NA	NA
WP_066116488.1|922569_923385_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_066116490.1|923545_924160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071828009.1|924632_925631_+	RNA polymerase sigma factor, RpoD/SigA family	NA	F4YCU2	Synechococcus_phage	35.0	1.7e-42
WP_066116492.1|925701_925902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066116494.1|925972_926371_+	universal stress protein	NA	NA	NA	NA	NA
WP_066116496.1|926367_926697_-	DUF3082 domain-containing protein	NA	NA	NA	NA	NA
WP_066116498.1|926753_927530_-	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_066116502.1|927732_928197_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_066116504.1|928210_928855_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_066116508.1|928927_929824_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_066116510.1|930014_930437_-	YraN family protein	NA	NA	NA	NA	NA
WP_066121708.1|930491_932027_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_066116512.1|932312_933797_+	polyphosphate:AMP phosphotransferase	NA	NA	NA	NA	NA
WP_066116514.1|933814_934426_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	C7F482	Cyanophage	28.7	1.2e-06
WP_066116517.1|934540_935149_+|transposase	IS66 family transposase zinc-finger binding domain-containing protein	transposase	NA	NA	NA	NA
WP_173645738.1|935394_935877_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_173645739.1|935807_936554_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_066116520.1|936632_936971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066116522.1|937050_937368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144439385.1|937480_938432_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_AP014821	Geminocystis sp. NIES-3709	4150181	1526271	1566632	4150181	transposase,integrase	uncultured_Mediterranean_phage(28.57%)	34	1525568:1525590	1556547:1556569
1525568:1525590	attL	TGTCGAATAACATTTTATCTGTC	NA	NA	NA	NA
WP_066117494.1|1526271_1527270_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_144439414.1|1527262_1528660_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
WP_066117500.1|1529278_1529794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066117502.1|1529812_1532722_-	hypothetical protein	NA	H6U5K1	Mycobacterium_phage	27.8	7.5e-14
WP_066117505.1|1532795_1532990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066115324.1|1533537_1534803_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_066117507.1|1534782_1536735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066117510.1|1536923_1537481_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_066117512.1|1537521_1538547_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	26.5	7.0e-07
WP_066121787.1|1538718_1539132_-	type II toxin-antitoxin system death-on-curing family toxin	NA	D0R0D2	Streptococcus_phage	36.1	4.9e-12
WP_158506705.1|1539131_1539305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066117514.1|1539584_1540373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066117517.1|1542109_1542988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066117523.1|1542977_1543328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082712913.1|1543390_1544230_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_066117526.1|1544456_1547072_+	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	26.6	3.8e-09
WP_066117529.1|1547131_1548454_-	restriction endonuclease subunit S	NA	K7XYU9	uncultured_Mediterranean_phage	41.2	1.7e-26
WP_071828007.1|1548426_1548603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158506699.1|1549798_1549948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066116328.1|1550060_1550279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066117535.1|1550632_1550971_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_066117538.1|1550967_1553340_-	DEAD/DEAH box helicase family protein	NA	A0A0K1LKN7	Rhodobacter_phage	22.9	1.1e-10
WP_066117541.1|1553336_1553810_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071828023.1|1553901_1555725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066117546.1|1556829_1557462_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
1556547:1556569	attR	GACAGATAAAATGTTATTCGACA	NA	NA	NA	NA
WP_066117548.1|1557544_1558090_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_066117550.1|1558274_1559204_+	serine hydrolase	NA	NA	NA	NA	NA
WP_066117552.1|1559422_1560487_+	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144439415.1|1560691_1560862_+	ssl1498 family light-harvesting-like protein	NA	NA	NA	NA	NA
WP_066117555.1|1561198_1562266_-	photosystem II q(b) protein	NA	A0A1D8KNW7	Synechococcus_phage	89.8	2.3e-186
WP_066121789.1|1562509_1563202_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_066117558.1|1563310_1564804_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_066117561.1|1565010_1565658_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_082712913.1|1565792_1566632_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_AP014821	Geminocystis sp. NIES-3709	4150181	2595573	2633570	4150181	tRNA,transposase,tail	Planktothrix_phage(20.0%)	31	NA	NA
WP_066119157.1|2595573_2596929_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_173645748.1|2601429_2602050_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_066119162.1|2602174_2602540_+	NAD(P)H-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_144439428.1|2602608_2603547_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_066119165.1|2603665_2605366_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	24.1	5.2e-15
WP_066119168.1|2605889_2607008_-	SpoIID/LytB domain-containing protein	NA	Q2XU88	Pseudomonas_phage	32.1	2.4e-21
WP_082712913.1|2607860_2608700_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_066119171.1|2608795_2609737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082712983.1|2609862_2611902_-	magnesium chelatase ATPase subunit D	NA	NA	NA	NA	NA
WP_066119176.1|2612016_2612505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066119178.1|2612513_2612831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066119182.1|2612836_2613280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158506718.1|2613451_2613607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066119185.1|2613692_2616341_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	35.5	2.7e-66
WP_066119187.1|2616472_2617300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_066119190.1|2617589_2617796_+	type II toxin-antitoxin system HicB family antitoxin	NA	G9BWD3	Planktothrix_phage	47.3	2.8e-08
WP_173645713.1|2617962_2618589_+	ApaLI family restriction endonuclease	NA	NA	NA	NA	NA
WP_066119194.1|2618592_2619798_+	site-specific DNA-methyltransferase	NA	A0A0H3UZ66	Geobacillus_virus	36.9	1.9e-43
WP_066119197.1|2619809_2620013_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_066119200.1|2620005_2620239_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_066119202.1|2620532_2620748_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_066119205.1|2620750_2620972_+	type II toxin-antitoxin system HicB family antitoxin	NA	G9BWD3	Planktothrix_phage	46.2	3.2e-10
WP_066119207.1|2621292_2624223_-	cellulase family glycosylhydrolase	NA	G0YQI7	Erwinia_phage	35.4	1.1e-76
WP_158506720.1|2626606_2626777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066119210.1|2626777_2627773_-	hypothetical protein	NA	R9U464	Rhizobium_phage	31.6	2.0e-43
WP_066119213.1|2627760_2627970_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_066119217.1|2627975_2628422_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_066119220.1|2628475_2630716_-|tail	phage tail tape measure protein	tail	A7YG97	Campylobacter_phage	28.6	8.6e-26
WP_066119223.1|2630846_2631365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_066119226.1|2631364_2631862_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_066119229.1|2631866_2633570_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	38.3	1.2e-91
